Herunterladen: Tess Gerritsen In der Schwebe

Tess Gerritsen In der Schwebe scanned 05-2006/V1.0 Emma Watson, medizinische Forscherin mit großen Ambitionen, will das Verhalten des menschlichen Organismus im Weltraum studieren. Aber auf ihrer Weltraumstation kommt es zu seltsamen Vorfällen: Emma entdeckt im All eine Kultur von Einzellern, die ihr ganzes Team zu befallen beginnen; sie verursachen eine Krankheit, die zu einem äußerst qualvollen Tod führt. Die NASA versucht sofort, die Forscher wieder zur Erde zu bringen – aber die NASA-Rakete zerschellt und lässt die Weltraumstation stark beschädigt zurück. Verzweifelt versucht Emma, die töd...
Autor Anonym
Downloads: 0 Abrufe 0

Dokumentinhalt

Tess Gerritsen In der Schwebe

scanned 05-2006/V1.0 Emma Watson, medizinische Forscherin mit großen Ambitionen, will das Verhalten des menschlichen Organismus im Weltraum studieren. Aber auf ihrer Weltraumstation kommt es zu seltsamen Vorfällen: Emma entdeckt im All eine Kultur von Einzellern, die ihr ganzes Team zu befallen beginnen; sie verursachen eine Krankheit, die zu einem äußerst qualvollen Tod führt. Die NASA versucht sofort, die Forscher wieder zur Erde zu bringen – aber die NASA-Rakete zerschellt und lässt die Weltraumstation stark beschädigt zurück. Verzweifelt versucht Emma, die tödlichen Mikroben einzufangen. Gleichzeitig sucht die NASA immer noch nach einer Möglichkeit, Emma auf die Erde zurückzuholen. Aber noch ist keine Rettung in Sicht … ISBN: 978-3-442-36411-4 Original: Gravity Aus dem Amerikanischen von Andreas Jäger Verlag: Blanvalet Erscheinungsjahr: Januar 2006 Umschlaggestaltung: Design Team München

Dieses E-Book ist nicht zum Verkauf bestimmt!!!

, Buch Emma Watson, medizinische Forscherin mit großen Ambitionen, hat sich lange auf den Auftrag ihres Lebens vorbereitet: das Verhalten des menschlichen Organismus im Weltraum zu studieren. Jack, ihr Ehemann, ist ebenfalls von der Idee begeistert, ins All zu fliegen, aber sein angeschlagener gesundheitlicher Zustand macht ihm einen Strich durch die Rechnung. Am großen Tag ist Jack dazu verdammt, vom Boden aus zuzusehen, wie seine Frau ins Shuttle steigt und zu ihrer ersten Weltraummission abhebt. Als Emma und ihre Crew die internationale Weltraumstation erreichen, auf der die Experimente durchgeführt werden sollen, kommt es schon bald zu seltsamen Vorfällen: Emma entdeckt im All eine Kultur von Einzellern, die bisher nur auf dem Meeresgrund nachgewiesen wurden. Die Zellen vermehren sich mit rasanter Geschwindigkeit und beginnen die Besatzung der Station zu befallen; sie verursachen eine Krankheit, die zu einem äußerst qualvollen Tod führt. Die NASA reagiert zwar sofort und versucht, das Forscherteam wieder zur Erde zu bringen – aber der Versuch mündet in eine Katastrophe. Die NASA-Rakete zerschellt und lässt die Weltraumstation stark beschädigt zurück. Verzweifelt versucht Emma, die tödlichen Mikroben einzufangen. Gleichzeitig suchen Jack und die NASA immer noch nach einer Möglichkeit, Emma auf die Erde zurückzuholen. Aber noch ist keine Rettung in Sicht …, Autor Tess Gerritsen war erfolgreiche Internistin, bevor ihr mit dem Thriller Kalte Herzen der internationale Durchbruch und der Sprung auf die amerikanischen Bestsellerlisten gelang. Tess Gerritsen lebt in Maine., Den Männern und Frauen, durch die Raumfahrt zur Wirklichkeit wurde. Die größten Errungenschaften der Menschheit sind aus Träumen hervorgegangen., DIE SEE, Galapagos-Graben 0, 3 Grad Süd / 9 0, 3 Grad West Er glitt am Rand des Abgrunds entlang. Unter ihm gähnte die schwarze Weite einer kalten Unterwasserwelt, zu der die Sonne nie durchgedrungen war und in der das flüchtige Funkeln von Leuchtorganismen die einzige Lichtquelle war. Dr. Stephen D. Ahearn lag ausgestreckt mit dem Gesicht nach unten in der eng anliegenden Mulde der Deep Flight IV, während sein Kopf in der transparenten, kegelförmigen Acrylnase des Bootes ruhte. Er hatte das berauschende Gefühl, ganz und gar losgelöst durch die Weiten des Alls zu fliegen. In den Lichtkegeln der an den Flügeln angebrachten Scheinwerfer sah er den sanften, unablässigen Regen aus organischen Abfällen, die langsam aus den lichtdurchfluteten Wasserschichten hoch über ihm herabsanken. Es handelte sich um abgestorbene Protozoen, Urtierchen, die durch Tausende Meter Wasser auf ihre endgültige Ruhestätte am Meeresboden zutrieben. Während er durch den lautlosen Niederschlag aus toter Materie dahinglitt, steuerte er die Deep Flight IV am Rand des Unterwasser-Cañons entlang, den Abgrund immer backbords, unter sich den Grund des Plateaus. Obwohl die Sedimentschicht scheinbar unfruchtbar war, ließen sich doch überall Anzeichen von Leben entdecken. Umherstreifende Kreaturen, die sich jetzt sicher unter ihrer schützenden Sedimentdecke verbargen, hatten Abdrücke und Furchen im Meeresboden hinterlassen. Aber auch Zeugnisse menschlicher Zivilisation waren zu finden. Er sah eine verrostete Kette, die sich um einen verloren gegangenen Anker schlängelte, eine halb im Schlamm versunkene Limoflasche. Geisterhafte Überreste der fremden Welt dort, oben. Urplötzlich bot sich ihm ein verblüffender Anblick. Er hatte den Eindruck, auf einen Unterwasserhain aus verkohlten Baumstümpfen gestoßen zu sein. Was er sah, waren so genannte Schwarze Raucher, Röhren oder Schlote von sechs Metern Durchmesser, entstanden durch aufgelöste Minerale, die aus der Erdkruste hervorquollen. Mit den beiden Steuerknüppeln lenkte er die Deep Flight behutsam nach steuerbord, um den Schloten auszuweichen. »Ich habe die hydrothermale Spalte gefunden«, sagte er. »Geschwindigkeit zwei Knoten, Schwarze Raucher backbords.« »Wie fährt es sich?« Helens Stimme drang durch das Rauschen in seinem Kopfhörer. »Prächtig. So einen Schlitten hätte ich auch gerne.« Sie lachte. »Dann machen Sie sich darauf gefasst, einen ziemlich fetten Scheck auszustellen, Steve. Haben Sie das Knollenfeld schon entdeckt? Es müsste direkt vor Ihnen sein.« Ahearn war einen Moment lang still, während er in die trüben Wassermassen hinausspähte. Dann sagte er: »Ich sehe sie.« Die Manganknollen glichen über den Meeresboden verstreuten Kohleklumpen. Entstanden aus Mineralien, die sich um Steine oder Sandkörner herum abgelagert und dabei seltsame, geradezu bizarre Formen angenommen hatten, waren sie eine höchst begehrte Quelle von Titan und anderen Edelmetallen. Aber er schenkte den Knollen keinerlei Beachtung. Er war auf der Suche nach einem weitaus wertvolleren Schatz. »Ich steuere jetzt in den Cañon hinein«, sagte er. Mit den Steuerknüppeln lenkte er die Deep Flight über den Rand des Plateaus hinweg. Er erhöhte die Geschwindigkeit auf zweieinhalb Knoten, und die Flügel, die so konstruiert waren, dass sie den umgekehrten Effekt eines Flugzeugflügels hatten, zogen das U-Boot nach unten. Er begann den Abstieg in die, Schlucht. »Elfhundert Meter«, zählte er mit. »Elfhundertfünfzig …« »Achten Sie auf den Sicherheitsabstand. Es ist eine enge Spalte. Überprüfen Sie regelmäßig die Wassertemperatur?« »Sie steigt langsam an. Liegt jetzt bei vierzehn Grad.« »Ist noch ein gutes Stück bis zur Spaltenöffnung. Noch zweitausend Meter, und es wird so richtig heiß.« Ein Schatten schoss plötzlich direkt vor Ahearns Gesicht vorbei. Er zuckte zusammen und gab dabei dem Steuerknüppel unwillkürlich einen Ruck. Das Boot rollte nach steuerbord, es gab ein dumpfes metallisches Dröhnen, und der harte Aufprall an der Wand des Cañons ließ den gesamten Rumpf erzittern. »Herr im Himmel!« »Status?«, rief Helen. »Steve, wie ist Ihr Status?« Er hyperventilierte, in Panik schlug sein Herz gegen die Mulde, in der er lag. Der Rumpf! Habe ich den Rumpf beschädigt? Durch das Rasseln seines eigenen Atems horchte er auf das Ächzen des nachgebenden Stahls, auf den tödlichen Schwall eindringenden Wassers. Er befand sich eintausendeinhundert Meter unter dem Meeresspiegel, und ein Druck von über einhundert Atmosphären umschloss das Boot von allen Seiten wie eine Faust. Ein Leck im Rumpf, und das Wasser würde hineinströmen und ihn zerquetschen. »Steve, sagen Sie etwas!« Sein Körper war mit kaltem Schweiß bedeckt. Schließlich fand er die Sprache wieder. »Etwas hat mich erschreckt – bin mit der Wand des Cañons kollidiert …« »Ist etwas beschädigt?« Er warf einen Blick durch die Acrylscheibe. »Kann ich nicht sagen. Ich glaube, ich bin mit dem vorderen Sonarelement gegen die Felswand geknallt.« »Sind Sie noch manövrierfähig?«, Er betätigte die Steuerknüppel und gab dem Boot einen kleinen Ruck Richtung backbord. »Ja. Ja.« Er stieß einen tiefen Seufzer aus. »Ich denke, ich bin okay. Irgendetwas ist direkt an meinem Sichtfenster vorbeigeschwommen. Hat mich aus dem Konzept gebracht.« »Irgendetwas?« »Es war gleich wieder weg! Da war nur dieser Strich – wie eine Schlange, die an einem vorbeizischt.« »Sah es aus wie ein Aal mit dem Kopf eines Fischs?« »Ja. Ja, genau so etwas habe ich gesehen.« »Dann war es eine Aalquappe. Thermarces cerberus.« Cerberus, dachte Ahearn und schauderte. Der dreiköpfige Hund, der die Pforten der Hölle bewachte. »Sie werden von Hitze und Schwefel angelockt«, sagte Helen. »Sie werden noch mehr von denen sehen, wenn Sie sich der Spalte nähern.« Na, wenn Sie das sagen. Ahearn wusste so gut wie nichts über Meeresbiologie. Die Lebewesen, die jetzt an seiner Acrylkuppel vorbeischwammen, waren für ihn lediglich Objekte der Neugierde, lebende Hinweisschilder, die ihm den Weg zu seinem Ziel wiesen. Er hatte jetzt beide Steuerhebel fest im Griff und manövrierte die Deep Flight IV tiefer in den Abgrund. Zweitausend Meter. Dreitausend. Und wenn er den Rumpf nun doch beschädigt hatte? Viertausend Meter, und der ohnehin schon ungeheure Wasserdruck stieg linear an, je weiter er in die Tiefe vordrang. Das Wasser war jetzt noch schwärzer, gefärbt von den Schwefelwolken, die aus der Erdspalte drangen. Die Flügelscheinwerfer konnten die dichte Mineralsuspension kaum noch durchdringen. Durch aufgewirbelte Ablagerungen hindurch, die ihm die Sicht raubten, steuerte er das Boot aus dem schwefelgetönten Wasser heraus, bis er allmählich wieder, mehr erkennen konnte. Er sank jetzt neben der hydrothermalen Spalte herab, außerhalb der Fontäne des vom Magma erhitzten Wassers, doch die Außentemperatur stieg weiter. Fünfzig Grad Celsius. Wieder zuckte eine blitzartige Bewegung quer über sein Gesichtsfeld. Diesmal gelang es ihm, die Steuerknüppel ruhig zu halten. Er sah weitere Aalquappen; gleich fetten, kopfüber aufgehängten Schlangen schwebten sie wie im luftlosen Raum dahin. Das Wasser, das aus dem Spalt im Meeresboden hervorbrach, war reich an erhitztem Schwefelwasserstoff, einer toxischen und lebensfeindlichen Chemikalie. Aber selbst in diesen schwarzen, giftigen Gewässern hatte Leben gedeihen können; es blühte hier in fantastischen, wunderschönen Formen. An der Wand der Schlucht hafteten fast zwei Meter lange Riftia- Würmer, deren federartiger scharlachroter Kopfschmuck in der Strömung wiegte. Er sah Ansammlungen von riesigen Muscheln mit weißen Schalen, aus denen samtig-rote Zungen hervorlugten. Und er sah Krabben von unwirklich blasser Färbung, die Geistern gleich in den Felsspalten umherhuschten. Obwohl die Klimaanlage in Betrieb war, spürte er allmählich die Hitze. Sechstausend Meter. Wassertemperatur zweiundachtzig Grad. Im Inneren der vom kochenden Magma erhitzten Wasserfontäne würde die Temperatur über zweihundertfünfzig Grad betragen. Dass sogar hier, in völliger Dunkelheit, in diesem giftigen und extrem aufgeheizten Wasser, noch Leben existieren konnte, war wie ein Wunder. »Ich bin jetzt auf sechstausendsechzig«, sagte er. »Ich kann es nicht sehen.« Durch das Rauschen und Knacken in seinem Kopfhörer drang schwach Helens Stimme. »Es gibt da einen Felsvorsprung in der Wand. Sie sollten ihn bei etwa sechstausendachtzig Metern erkennen können.«, »Ich suche danach.« »Verlangsamen Sie Ihre Fahrt. Er wird gleich auftauchen.« »Sechstausendsiebzig, ich suche immer noch. Das ist eine regelrechte Erbsensuppe hier unten. Vielleicht ist meine Position falsch.« »… Sonarwerte … bricht über Ihnen zusammen!« Ihre aufgeregte Stimme ging in dem stärker werdenden Rauschen unter. »Das habe ich nicht verstanden. Wiederholen Sie.« »Die Wand des Cañons bricht zusammen! Die Trümmer fallen auf Sie herunter. Sehen Sie zu, dass Sie da wegkommen!« Das laute Trommeln von Steinbrocken, die auf den Rumpf aufschlugen, ließ ihn in Panik die Steuerknüppel nach vorne stoßen. Im Halbdunkel sah er einen gewaltigen Schatten direkt vor seinen Augen herabstürzen und von einem Felsvorsprung abprallen. Erneut ergoss sich ein Schauer von Geröll in den Abgrund. Der Trommelwirbel wurde schneller. Dann gab es einen ohrenbetäubenden Knall, und gleichzeitig traf ihn ein heftiger Ruck wie der Schlag einer riesigen Faust. Sein Kopf wurde zur Seite geschleudert, und er prallte mit dem Unterkiefer gegen die Mulde. Er spürte, wie sich sein Körper zur Seite neigte, und er hörte ein fürchterliches metallisches Kreischen, als der Steuerbordflügel die Felswand streifte. Das U-Boot rollte weiter, während aufgewirbelte Ablagerungen die Kuppel in eine Wolke hüllten, die jegliche Orientierung unmöglich machte. Er riss den Nothebel für Ballastabwurf um und mühte sich verzweifelt, das Boot nach oben zu steuern. Die Deep Flight IV machte einen Satz nach vorne, wieder ertönte das Kreischen von Metall auf Stein, und dann kam das Fahrzeug mit einem Ruck zum Stillstand. Er saß in dem nach steuerbord geneigten Boot fest. Wie wild bearbeitete er die Steuerknüppel, schaltete die Hilfspropeller auf volle Fahrt voraus., Keine Reaktion. Er hielt inne. Sein Herz pochte, während er sich bemühte, die in ihm aufsteigende Panik zu unterdrücken. Warum bewegte er sich nicht? Warum reagierte das Boot nicht? Er zwang sich, die beiden digitalen Anzeigenfelder zu überprüfen. Batterieladung im grünen Bereich. Klimaanlage funktioniert. Tiefenmessung bei sechstausendzweiundachtzig Meter. Die Sedimentteilchen gaben allmählich die Sicht wieder frei, und im Schein seines Backbord-Strahlers konnte er einzelne Formen erkennen. Er spähte angestrengt durch die Acrylkuppel geradeaus und erblickte eine fremdartige Landschaft aus gezackten schwarzen Steinen und blutroten Riftia-Würmern. Dann reckte er den Hals zur Seite, um einen Blick auf seinen Steuerbordflügel zu werfen. Was er dort sah, drehte ihm fast den Magen um. Der Flügel war zwischen zwei Felsbrocken eingeklemmt. Er konnte weder vor noch zurück. Ich bin lebendig begraben, sechstausend Meter unter dem Meeresspiegel. »… hören? Steve, können Sie mich hören?« Er hörte seine eigene Stimme, schwach vor Angst: »Kann nicht von der Stelle – Steuerbordflügel eingeklemmt …« »… Backbordflügelklappen. Mit einem Giermanöver könnten Sie sich vielleicht Stück für Stück befreien.« »Das habe ich schon versucht. Ich habe alles versucht. Ich kann mich nicht rühren.« Im Kopfhörer wurde es totenstill. Hatte er sie verloren? War die Verbindung gekappt worden? Er dachte an das Schiff dort oben, an das Deck, das sich sanft in der Dünung wiegte. Er dachte an den Sonnenschein. Es war ein wunderbar sonniger Tag gewesen dort an der Oberfläche. Vögel, die am Himmel vorüberzogen, das Meer tiefblau … Jetzt war eine männliche Stimme zu hören. Sie gehörte Palmer, Stevens, dem Mann, der die Expedition finanziert hatte. Er sprach ruhig und beherrscht, so wie immer. »Wir leiten die Rettungsmaßnahmen ein, Steve. Das andere U-Boot wird schon zu Wasser gelassen. Wir bringen Sie so schnell wie möglich nach oben.« Eine Pause, und dann: »Können Sie irgendetwas erkennen? Wie sieht Ihre Umgebung aus?« »Ich – ich befinde mich auf einem Felsvorsprung direkt über der Spalte.« »Welche Einzelheiten können Sie erkennen?« »Was?« »Sie sind auf sechstausendzweiundachtzig Meter. Genau die Tiefe, die uns interessiert. Was können Sie über den Vorsprung sagen, auf dem Sie festsitzen? Die Felsen?« Ich werde sterben, und er stellt mir Fragen über die verdammten Felsen. »Steve, schalten Sie den Stroboskopscheinwerfer ein. Sagen Sie uns, was Sie sehen.« Er zwang sich, den Blick auf die Instrumententafel zu richten, und drückte den Stroboskopschalter. Helle Lichtblitze durchzuckten das trübe Wasser. Er starrte die Landschaft an, die sich flackernd vor seiner Netzhaut aufbaute. Zuvor hatte er sich auf die Würmer konzentriert. Jetzt wandte er seine Aufmerksamkeit dem riesigen Trümmerfeld zu, das den Boden des Felsvorsprungs bedeckte. Die Steine glichen Magnesiumknollen, nur dass diese hier gezackte Ränder hatten, wie Glassplitter. Er drehte den Kopf nach rechts zu den frisch abgebrochenen Felsbrocken, die den Flügel des Bootes einklemmten – und mit einem Mal wurde ihm klar, was er da sah. »Helen hat Recht«, flüsterte er. »Ich habe Sie nicht verstanden.« »Sie hatte Recht! Die Iridiumquelle – ich kann sie ganz, deutlich sehen …« »Sie werden schwächer. Ich rate Ihnen …« Gabriels Stimme wurde von Rauschen überlagert und verstummte schließlich. »Ich habe nicht verstanden. Ich wiederhole, ich habe Sie nicht verstanden!«, rief Ahearn. Keine Antwort. Er hörte nur das Pochen seines Herzens, das Zischen seines eigenen Atems. Ruhig, ganz ruhig. Ich verbrauche meinen Sauerstoff zu schnell … Auf der anderen Seite der Acrylkuppel tanzten die Lebewesen der Tiefe mit anmutigen Bewegungen durch das giftige Wasser. Während die Minuten sich zu Stunden dehnten, beobachtete er die Riftia-Würmer, die mit wiegenden Bewegungen ihrer roten Federbüsche das Wasser nach Nahrung durchkämmten. Er sah eine augenlose Krabbe, die langsam über die von Steinen übersäte Ebene kroch. Das Licht wurde schwächer. Das Gebläse der Klimaanlage verstummte abrupt. Die Batterie war leer. Er schaltete den Stroboskopscheinwerfer aus. Nur der schwache Strahl des Backbord-Flügelscheinwerfers spendete noch Licht. In wenigen Minuten würde er allmählich die Hitze des Wassers zu spüren beginnen, das vom Magma auf fast neunzig Grad aufgeheizt wurde. Sie würde den Rumpf durchdringen, würde ihn bei lebendigem Leib ganz langsam in seinem eigenen Schweiß kochen. Schon spürte er, wie ein Schweißtropfen von seiner Schläfe sickerte und über seine Wange rann. Er hielt den Blick starr auf diese eine Krabbe gerichtet, die mit vorsichtigen Bewegungen über den Felsvorsprung tänzelte. Der Flügelscheinwerfer flackerte. Und erlosch., DER START, 7. Juli Zwei Jahre später Abbruch. Inmitten des ohrenbetäubenden Donnerns der Feststoffraketen und des markerschütternden Bebens des Raumtransporters schoss Missionsspezialistin Emma Watson plötzlich der Befehl Abbruch so deutlich durch den Kopf, als hätte ihr jemand das Wort über ihren Kopfhörer zugerufen. Tatsächlich hatte keines der Crewmitglieder es laut ausgesprochen, doch in diesem Moment wusste sie, dass eine Entscheidung getroffen werden musste, und zwar schnell. Noch hatte sie das Urteil weder von Commander Bob Kittredge noch von der Pilotin Jill Hewitt gehört, die beide im Cockpit vor ihr saßen, doch das war auch nicht nötig. Sie arbeiteten schon so lange als Team zusammen, dass jeder die Gedanken der anderen lesen konnte. Die gelben Warnlichter, die jetzt auf dem Kontrollpult des Shuttle aufleuchteten, diktierten ihre nächsten Schritte. Sekunden zuvor hatte die Endeavour Max Q erreicht, den Zeitpunkt der größten aerodynamischen Belastung während des Starts, wenn der Raumtransporter sich gegen den Widerstand der Atmosphäre stemmt und heftig zu zittern beginnt. Kittredge hatte den Schub vorübergehend auf siebzig Prozent gedrosselt, um die Vibrationen zu mildern. Jetzt zeigten die Warnlichter am Kontrollpult an, dass sie zwei ihrer drei Triebwerke verloren hatten. Auch wenn sie noch von einem Triebwerk und zwei Feststoffraketen angetrieben wurden, würden sie die Umlaufbahn nicht erreichen. Sie mussten den Start abbrechen., »Bodenkontrolle, hier Endeavour«, sagte Kittredge mit ruhiger, fester Stimme. Keine Spur von Besorgnis. »Können nicht durchstarten. Linkes und mittleres Haupttriebwerk bei Max Q ausgefallen. Wir hängen fest. Gehen auf Abbruch durch RTLS.« »Roger, Endeavour. Bestätigen Ausfall von zwei Haupttriebwerken. Fahren Sie fort mit RTLS, sobald Feststoffraketen abgebrannt.« Emma durchsuchte bereits den Stapel von Checklisten und fand die Karte mit den Anweisungen für »Abbruch durch RTLS« – durch Rückkehr zum Startplatz. Die Crew kannte jeden einzelnen Schritt auswendig, aber in der Aufregung und Hektik eines unvorhergesehenen Abbruchs konnte es vorkommen, dass ein entscheidender Handgriff vergessen wurde. Die Checkliste war ihr Sicherheitsnetz. Mit rasendem Puls las Emma die entsprechenden Anweisungen durch, die deutlich mit blauer Farbe hervorgehoben waren. Es war durchaus möglich, einen RTLS- Abbruch mit Ausfall von zwei Triebwerken zu überleben – aber nur theoretisch. Dazu musste jetzt eine ganze Reihe von Beinahe-Wundern geschehen. Zuerst mussten sie Treibstoff ablassen und das verbliebene Haupttriebwerk abschalten, bevor sie sich von dem riesigen externen Treibstofftank abkoppeln konnten. Anschließend würde Kittredge den Raumtransporter herumwerfen, sodass sie mit den Köpfen nach oben im Cockpit saßen und die Nase des Shuttle in Richtung Startrampe zeigte. Er hatte genau eine Chance, sie zu einer sicheren Landung beim Kennedy Space Center zu führen. Ein einziger Fehler, und die Endeavour würde samt Besatzung ins Meer stürzen. Ihr Leben lag jetzt in den Händen von Commander Kittredge. Seine Stimme – er war in ständiger Verbindung mit der Kontrollstation – klang immer noch ruhig, ja sogar etwas gelangweilt, während sie sich allmählich der Zwei-Minuten-, Marke näherten. Der nächste kritische Punkt. Auf der Anzeige blinkte das Pc<50-Signal. Die Feststoffraketen brannten planmäßig aus. Emma spürte plötzlich den enormen Geschwindigkeitsabfall, als die Raketen den letzten Rest Treibstoff verbraucht hatten. Dann zwang sie ein heller Lichtblitz im Fenster, die Augen zusammenzukneifen: Die Feststoffraketen waren abgesprengt worden. Das Tosen, das den Start begleitet hatte, verstummte mit einem Mal. Das heftige Beben hatte sich ebenfalls gelegt; sie glitten jetzt ruhig, fast friedlich dahin. In der plötzlich eingetretenen unheimlichen Stille bemerkte sie, wie ihr Puls sich beschleunigte und ihr Herz wie eine Faust gegen den Brustkorb hämmerte. »Bodenkontrolle, hier Endeavour«, sagte Kittredge, der immer noch unnatürlich ruhig war. »Haben SRB abgetrennt.« »Roger, wir können es sehen.« »Leiten Abbruch ein.« Kittredge drückte den Abbruch-Knopf; der Drehschalter war bereits auf RTLS eingestellt. Über ihren Kopfhörer hörte Emma Jill Hewitt rufen: »Emma, lass uns die Checkliste hören!« »Ich hab sie hier.« Emma begann laut vorzulesen, und ihre eigene Stimme klang ebenso verblüffend ruhig wie die von Kittredge und Hewitt. Hätte jemand ihre Unterhaltung belauscht, er wäre nie darauf gekommen, dass sie einer Katastrophe ins Auge blickten. Sie funktionierten jetzt wie Maschinen, sie unterdrückten ihre Panik, und jeder einzelne Handgriff vollzog sich mechanisch, gesteuert von Routine und der Erinnerung an auswendig gelernte Abläufe. Ihre Bordcomputer würden den Kurs für den Rückflug automatisch einstellen. Noch befanden sie sich auf ihrer geplanten Flugbahn. Der Raumtransporter ließ weiterhin Treibstoff ab, während er auf eine Höhe von vierhunderttausend Fuß stieg., Jetzt spürte sie die Schwindel erregende Schleuderbewegung – der Raumtransporter hatte das Wendemanöver begonnen und drehte sich um hundertachtzig Grad um seine Mittelachse. Der Horizont, der bisher auf dem Kopf gestanden hatte, richtete sich plötzlich auf, und sie nahmen Kurs auf das Kennedy Space Center, von dem sie inzwischen rund sechshundert Kilometer entfernt waren. »Endeavour, hier Bodenkontrolle. Schalten Sie Triebwerke ab.« »Roger«, erwiderte Kittredge. »Triebwerke abgeschaltet.« Auf der Instrumentenkonsole blinkten plötzlich die roten Statusanzeigen für die drei Triebwerke auf. Zwanzig Sekunden nach dem Abschalten würde der externe Treibstofftank sich vom Shuttle lösen und ins Meer stürzen. Wir verlieren rapide an Höhe, dachte Emma. Aber wir sind auf dem Weg nach Hause. Sie zuckte zusammen. Ein Warnsignal ertönte, und auf der Konsole leuchteten weitere Anzeigen auf. »Bodenkontrolle, wir haben Computer Nr. 3 verloren!«, rief Hewitt. »Wir haben einen Navigationsvektor verloren! Wiederhole, wir haben einen Navigationsvektor verloren!« »Es könnte sich um eine Störung bei der Trägheitsmessung handeln«, sagte Andy Mercer, der zweite Missionsspezialist, der neben Emma saß. »Ihr stellt sie am besten ab.« »Nein! Vielleicht ist ein Datenbus defekt!«, schaltete Emma sich ein. »Ich finde, wir sollten auf Reserve schalten.« »Einverstanden«, sagte Kittredge knapp. »Schalte auf Reserve«, sagte Hewitt. Sie stellte auf Computer Nr. 5 um. Der Vektor war wieder da. Alle atmeten erleichtert auf. Die Explosion der Sprengladungen markierte die Abtrennung des leeren Treibstofftanks. Sie konnten nicht sehen, wie er ins, Meer hinabstürzte, doch sie wussten, dass sie gerade einen weiteren kritischen Punkt überstanden hatten. Der Raumtransporter befand sich jetzt im freien Flug, ein fetter, ungelenker Vogel, der auf sein Nest zuschwebte. »Mist!«, stieß Hewitt hervor. »Wir haben eine APU verloren!« Emma fuhr zusammen, als erneut ein Warnsignal ertönte. Eine Hilfsenergieeinheit war ausgefallen. Dann heulte ein weiterer Alarm auf, und in Panik fiel ihr Blick auf die Konsole. Dort blinkte jetzt eine ganze Schar von gelben Warnsignalen. Alle Daten waren von den Bildschirmen verschwunden; stattdessen waren nur mehr ominöse schwarz-weiße Streifen zu sehen. Ein katastrophaler Computerabsturz. Sie flogen jetzt ohne Navigationsdaten. Sie hatten keine Kontrolle über die Steuerklappen. »Andy und ich kümmern uns um den APU-Ausfall!«, schrie Emma. »Wieder auf Reserve gehen!« Hewitt legte den Schalter um und fluchte. »Nichts zu machen, Leute. Keine Reaktion …« »Versuch’s noch mal!« »Er kommt immer noch nicht.« »Das Schiff legt sich quer!«, rief Emma. Sie spürte, wie ihr Magen einen Ruck zur Seite machte. Kittredge bearbeitete den Steuerknüppel, doch sie waren schon zu weit nach steuerbord gedriftet. Der Horizont stellte sich senkrecht und kippte dann ganz um. Wieder spürte Emma einen Ruck im Magen; diesmal legte sich das Shuttle nach links. Schon kam die nächste Umdrehung – der Horizont wirbelte in einer Schwindel erregenden Abfolge von Himmel, Meer und wieder Himmel. Eine Todesspirale. Sie hörte Hewitt stöhnen, hörte, wie Kittredge mit tonloser,, resignierter Stimme sagte: »Ich habe das Schiff verloren.« Der tödliche Wirbel wurde immer schneller, unaufhaltsam stürzten sie auf das abrupte, katastrophale Ende zu. Und dann war es plötzlich still. Über Funk kam eine amüsierte Stimme: »Tut mir Leid, Leute. Diesmal habt ihr es nicht geschafft.« Emma riss sich den Kopfhörer herunter. »Das war nicht fair, Hazel!« Jill Hewitt stimmte in den Protest ein: »Mensch, du hast uns absichtlich über die Klinge springen lassen. Wir hatten keine Chance, das Schiff zu retten.« Emma kroch als Erste aus dem Shuttle-Flugsimulator. Die anderen Crewmitglieder trabten hinter ihr her in den fensterlosen Kontrollraum, wo ihre drei Instruktoren an einer Reihe von Pulten saßen. Mit einem spitzbübischen Lächeln auf den Lippen schwang Hazel Barra, die Teamleiterin, ihren Stuhl herum und blickte Commander Kittredges erzürnter vierköpfiger Crew entgegen. Obwohl Hazel mit ihrem üppigen braunen Kraushaar aussah wie eine dralle Mutterfigur, war sie in Wahrheit eine gewiefte und unbarmherzige Spielerin, die ihre Crews durch die schwierigsten Flugsimulationen jagte und es sich als persönlichen Triumph anzurechnen schien, wenn es einer Mannschaft nicht gelang, den Flug lebend zu überstehen. Es war Hazel sehr wohl bewusst, dass jeder Start in einer Katastrophe enden konnte, und sie wollte, dass ihre Astronauten alle Überlebenstechniken perfekt beherrschten. Eines ihrer Teams zu verlieren, das war der Albtraum, von dem sie hoffte, er würde niemals Wirklichkeit werden. »Diese Simulation war wirklich unter der Gürtellinie, Hazel«, beklagte Kittredge sich., »Ihr überlebt ja auch ein ums andere Mal. Wir müssen einfach eure Überheblichkeit ein wenig zurechtstutzen.« »Also wirklich«, meinte Andy »Zwei Triebwerke beim Abheben ausgefallen? Ein defekter Datenbus? Eine APU, die den Geist aufgibt? Und dann legt ihr noch einen ausgefallenen Fünfer-Computer obendrauf? Wie viele Pannen und Funktionsstörungen sind das denn? Das ist einfach nicht realistisch.« Patrick, einer der anderen Instruktoren, schwenkte grinsend in seinem Stuhl herum. »Ihr habt ja gar nicht gemerkt, was wir sonst noch alles gemacht haben.« »Was gab es denn noch?« »Ich habe einen Defekt in eurem Sauerstofftank-Sensor beigesteuert. Gebt’s zu, keiner von euch hat die Veränderung in der Druckanzeige bemerkt.« Kittredge musste lachen. »Wann hätten wir denn dafür Zeit gehabt? Wir hatten uns schon mit einem Dutzend anderer Funktionsstörungen herumzuschlagen.« Hazel hob ihren stämmigen Arm, um den Streithähnen Einhalt zu gebieten. »Okay, Leute. Vielleicht haben wir es übertrieben. Ehrlich gesagt, waren wir überrascht, wie weit ihr mit dem RTLS-Abbruch gekommen seid. Wir wollten nur etwas zusätzlichen Sand ins Getriebe streuen, um die Sache spannender zu machen.« »Ihr hättet ja nicht gleich die ganze verfluchte Sandkiste reinkippen müssen«, schnaubte Hewitt. »Die Wahrheit ist«, meinte Patrick, »dass ihr einfach ein bisschen zu überheblich seid.« »Das heißt selbstsicher«, korrigierte Emma. »Und das ist gut«, räumte Hazel ein. »Es ist gut, wenn man selbstsicher ist. Eure Teamarbeit in der integrierten Simulation letzte Woche war hervorragend. Sogar Gordon Obie hat gesagt,, er sei beeindruckt gewesen.« »Hat die Sphinx das tatsächlich gesagt?« Kittredge zog überrascht eine Augenbraue hoch. Gordon Obie war der Direktor der Flugeinsatzabteilung, ein Mann von so ausgeprägter Schweigsamkeit und Unnahbarkeit, dass niemand im JSC ihn wirklich kannte. Es kam vor, dass er während einer gesamten Einsatzbesprechung kein einziges Wort sagte, und doch bezweifelte niemand, dass er im Geiste jedes Detail registrierte. Die Astronauten betrachteten Obie mit einer Mischung aus ehrfürchtiger Scheu und einer gehörigen Portion Angst. Er war die letzte Instanz, wenn es um die Benennung der Teilnehmer an einer Mission ging, und sein Wort konnte über eine ganze Astronautenkarriere entscheiden. Dass er Kittredges Team gelobt hatte, war mithin wirklich eine gute Nachricht. Im nächsten Atemzug stieß Hazel sie jedoch schon wieder von ihrem hohen Ross. »Allerdings«, sagte sie, »macht Obie sich Sorgen, dass ihr das Ganze zu leicht nehmen könntet. Dass ihr es immer noch wie ein Spiel betrachtet.« »Was sollen wir denn seiner Meinung nach tun?«, fragte Hewitt. »Sollen wir uns etwa ständig Gedanken machen über die zehntausend Arten, wie wir verbrennen oder sonst wie zu Tode kommen könnten?« »Eine Katastrophe ist kein reines Gedankenspiel.« Hazels ruhig ausgesprochene Feststellung ließ sie für einen Moment verstummen. Seit der Challenger-Katastrophe war es jedem Mitglied des Astronautenkorps bewusst, dass es nur eine Frage der Zeit war, bis es wieder zu einem größeren Zwischenfall kam. Wenn man an der Spitze einer Rakete sitzt, die mit einer Schubkraft von rund dreitausend Tonnen in den Weltraum geschossen wird, kann man es sich eigentlich nicht leisten, die Risiken des Berufs auf die leichte Schulter zu nehmen. Und doch sprachen sie nur selten über den Tod im All. Indem man darüber redete, gestand man sich ein, dass es, möglich war – dass man vielleicht beim nächsten Challenger- Flug selbst auf der Besatzungsliste stehen würde. Hazel merkte, dass sie der Hochstimmung der Crew einen gehörigen Dämpfer aufgesetzt hatte. So sollte eine Trainingseinheit eigentlich nicht enden, und deshalb nahm sie jetzt einen Teil ihrer früheren Kritik zurück. »Ich sage das doch nur, weil ihr schon so gut aufeinander eingespielt seid. Ich muss mich ganz schön anstrengen, um euch ins Stolpern zu bringen. Ihr habt noch drei Monate bis zum Start, und ihr seid jetzt schon glänzend in Form. Aber ich will euch noch besser in Form bringen.« »Mit anderen Worten, Leute«, sagte Patrick von seinem Pult aus, »nicht so überheblich, bitte.« Bob Kittredge senkte in gespielter Demut den Kopf. »Wir gehen jetzt nach Hause und streuen uns Asche aufs Haupt.« »Zu viel Selbstsicherheit ist gefährlich«, sagte Hazel. Sie stand von ihrem Stuhl auf und trat auf Kittredge zu. Mit drei Shuttleflügen war Kittredge schon so etwas wie ein Veteran. Er war einen halben Kopf größer als sie und besaß das sichere und bestimmte Auftreten des Marinepiloten, der er einmal gewesen war. Doch Hazel ließ sich weder von Kittredge noch von irgendeinem anderen ihrer Astronauten einschüchtern. Ob sie nun Raketenwissenschaftler oder militärische Helden waren, in ihr lösten sie immer die gleiche mütterliche Sorge aus: den Wunsch, dass sie von ihren Missionen lebend zurückkamen. »Du bist ein so guter Kommandant, Bob, dass du deine Crew dazu verleitet hast, das Ganze für ein Kinderspiel zu halten.« »Nein, sie lassen es nur wie ein Kinderspiel aussehen. Weil sie nämlich gut sind.« »Wir werden sehen. Die integrierte Simulation ist für Dienstag angesetzt, mit Hawley und Higuchi an Bord. Wir werden dann ein paar neue Tricks aus dem Hut zaubern.«, Kittredge lächelte spöttisch. »Also gut, du kannst versuchen, uns umzubringen. Aber bleib bitte fair.« »Das Schicksal ist selten fair«, sagte Hazel ernst. »Erwartet also nicht, dass ich es bin.« Emma und Bob Kittredge saßen an einem Tisch im Fly By Night Saloon und diskutierten bei einem Glas Bier die hinter ihnen liegenden Simulationen. Es war ein Ritual, das sie vor elf Monaten eingeführt hatten, zu Beginn ihrer Teambildung, als die vier zum ersten Mal als Besatzung des Shuttleflugs 162 zusammengekommen waren. Jeden Freitagabend trafen sie sich im Fly By Night, das ganz in der Nähe des Johnson Space Center an der NASA Road 1 lag, und besprachen den Fortgang ihres Trainings. Was sie richtig gemacht hatten, wo noch Verbesserungen nötig waren. Kittredge, der die Mitglieder seiner Crew persönlich ausgewählt hatte, hatte diese Treffen ins Leben gerufen. Obwohl sie ohnehin schon über sechzig Stunden in der Woche zusammenarbeiteten, schien er nicht besonders erpicht darauf, nach Hause zu gehen. Emma hatte geglaubt, es läge daran, dass Kittredge nach seiner kürzlich erfolgten Scheidung nun allein lebte und sich dagegen sträubte, in sein leeres Haus zurückzukehren. Doch nachdem sie ihn besser kennen gelernt hatte, war ihr klar geworden, dass diese Besprechungen ihm nur dazu dienten, das Adrenalinhoch, das der Job ihm verschaffte, noch länger aufrechtzuerhalten. Kittredge lebte, um zu fliegen. Er las furchtbar trockene Shuttle- Betriebsanleitungen als Unterhaltungslektüre und verbrachte jeden freien Moment im Cockpit einer der NASA-eigenen T-38- Maschinen. Es schien fast so, als würde er es bedauern, dass die Schwerkraft seine Füße an die Erde fesselte. Er begriff nicht, weshalb die anderen Crewmitglieder am Ende des Tages nach Hause gehen wollten, und an diesem Abend wirkte er ein wenig betrübt, weil sie nur zu zweit an ihrem angestammten Tisch saßen. Jill Hewitt war beim Klavierabend, ihres Neffen, und Andy Mercer feierte zu Hause seinen zehnten Hochzeitstag. Nur Emma und Kittredge waren zur vereinbarten Zeit aufgetaucht, und jetzt, wo sie die Simulationen der letzten Woche gründlich durchgekaut hatten, war eine längere Pause entstanden. Es gab nichts mehr zu fachsimpeln, und schon schien ihnen der Gesprächsstoff auszugehen. »Ich fliege morgen mit einer der T-38 rüber nach White Sands«, sagte er. »Möchtest du mitkommen?« »Geht nicht. Ich habe einen Termin bei meinem Anwalt.« »Ihr zieht es also durch, du und Jack?« Sie seufzte. »Die Dinge nehmen einfach ihren Lauf. Jack hat seinen Anwalt und ich habe meinen. Diese Scheidung ist wie ein D-Zug, der sich selbstständig gemacht hat.« »Das klingt, als wärst du dir nicht mehr ganz sicher.« Mit einer entschlossenen Bewegung stellte sie ihr Bierglas auf den Tisch. »Ich bin mir sicher.« »Warum trägst du dann immer noch seinen Ring?« Sie blickte auf den goldenen Ehering. Plötzlich zerrte sie heftig daran, musste aber feststellen, dass er sich keinen Millimeter bewegte. Sieben Jahre hatte sie ihn getragen, und jetzt schien der Ring mit ihrem Finger verschmolzen zu sein und sich nicht von der Stelle rühren zu wollen. Sie fluchte und versuchte erneut, ihn sich vom Finger zu reißen, diesmal so fest, dass es eine Abschürfung gab, als er über den Knöchel glitt. Sie legte ihn auf den Tisch. »Bitte sehr. Jetzt bin ich frei.« Kittredge lachte. »Ihr beide habt eure Scheidung schon länger hinausgezogen, als ich überhaupt verheiratet war. Worüber streitet ihr euch eigentlich noch?« Sie sank in ihren Stuhl zurück, war plötzlich erschöpft. »Über alles. Ich gebe ja zu, ich war auch nicht vernünftig. Vor ein paar Wochen haben wir versucht, uns hinzusetzen und eine, Liste unserer sämtlichen Besitztümer zu machen. Was ich behalten will, was er behalten will. Wir haben einander versprochen, uns wie zivilisierte Menschen zu benehmen. Zwei besonnene und reife Erwachsene. Wir hatten die Liste kaum zur Hälfte durch, da lagen wir uns auch schon in den Haaren. Der totale Krieg – Gefangene werden nicht gemacht.« Sie seufzte. Tatsächlich waren Jack und sie schon immer so gewesen. Beide gleich hartnäckig und von leidenschaftlicher Entschlossenheit erfüllt. Ob in der Liebe oder im Streit, immer flogen zwischen ihnen die Funken. »Es gab nur eine Sache, über die wir uns einig waren«, sagte sie. »Ich darf die Katze behalten.« »Herzlichen Glückwunsch.« Sie sah ihn an. »Hat es dir je Leid getan?« »Meine Scheidung, meinst du? Niemals.« Obwohl seine Antwort völlig unmissverständlich war, hatte er den Blick gesenkt, als suchte er eine Wahrheit zu verbergen, die sie beide kannten: Er trauerte seiner gescheiterten Ehe immer noch nach. Selbst ein Mann, der furchtlos genug war, sich auf einer Ladung von einigen Kilotonnen hochexplosiven Treibstoffs festzu- schnallen, konnte unter ganz gewöhnlicher Einsamkeit leiden. »Weißt du, das Problem ist Folgendes. Ich bin endlich dahinter gekommen«, sagte er. »Die Zivilisten verstehen uns nicht, weil sie nicht den gleichen Traum haben. Die Einzigen, die mit einem Astronauten verheiratet bleiben, sind die Heiligen und die Märtyrer. Oder die, denen es völlig schnuppe ist, ob wir leben oder sterben.« Er lachte höhnisch. »Bonnie war jedenfalls keine Märtyrerin. Und den Traum hat sie schon gar nicht verstanden.« Emma starrte ihren Ehering an, der vor ihr auf dem Tisch lag und glänzte. »Jack versteht ihn«, sagte sie leise. »Es war auch sein Traum. Das hat unsere Beziehung zerstört, weißt du. Dass ich fliegen darf und er nicht. Dass er ausgeschlossen ist.« »Dann muss er endlich erwachsen werden und sich mit der Realität abfinden. Nicht jeder hat das Zeug dazu.«, »Weißt du, ich wäre dir wirklich dankbar, wenn du von ihm nicht wie von irgendwelchem Ausschuss reden würdest.« »Entschuldige mal, schließlich ist er selbst zurückgetreten.« »Was hätte er denn anderes tun sollen? Er wusste, dass er nie mehr einen Flugeinsatz bekommen würde. Wenn sie dich nicht fliegen lassen, hat es keinen Sinn, dem Korps anzugehören.« »Dass sie ihn aus dem Verkehr gezogen haben, geschah nur zu seinem Besten.« »Es waren bloße medizinische Vermutungen. Wenn man einmal einen Nierenstein hat, bedeutet das noch nicht, dass man wieder welche bekommen wird.« »Okay, Dr. Watson – Sie sind die Ärztin. Aber sag mir eins: Würdest du Jack in deiner Shuttle-Crew haben wollen? Obwohl du von seinem gesundheitlichen Problem weißt?« Sie schwieg einen Moment. »Ja. Wenn ich als Ärztin sprechen soll – ja, auf jeden Fall. Es ist überhaupt nicht gesagt, dass Jack im All irgendwelche Schwierigkeiten haben würde. Er hat so viel zu bieten, dass ich mir nicht vorstellen kann, weshalb die ihn nicht da oben haben wollen. Ich lasse mich vielleicht von ihm scheiden, aber ich respektiere ihn trotzdem.« Kittredge lachte und trank dann sein Glas in einem Zug leer. »Du bist in der Angelegenheit nicht gerade objektiv, was?« Sie versuchte ihren Standpunkt zu begründen, doch dann wurde ihr klar, dass sie eigentlich keine Argumente hatte. Kittredge hatte Recht. Wenn es um Jack McCallum ging, war sie noch nie objektiv gewesen. Draußen in der feuchten Hitze der Houstoner Sommernacht blieb sie auf dem Parkplatz des Fly By Night stehen und blickte zum Himmel hinauf. Der Schein der Großstadtlichter ließ die Sterne verblassen, doch sie konnte immer noch einige vertraute Konstellationen ausmachen. Kassiopeia, Andromeda, die Plejaden. Jedes Mal, wenn sie diese Sternbilder betrachtete, fiel, ihr ein, was Jack zu ihr gesagt hatte, als sie in einer Sommernacht nebeneinander im Gras gelegen und zu den Sternen hochgeschaut hatten. In der Nacht, als ihr zum ersten Mal klar geworden war, dass sie in ihn verliebt war. Der Himmel ist voller Frauen. Du gehörst auch dorthin. Leise sagte sie: »Und du auch, Jack.« Sie schloss den Wagen auf und setzte sich ans Steuer. Dann griff sie in ihre Tasche und zog den Ehering hervor. Im Halbdunkel des Wageninneren betrachtete sie ihn und dachte an die sieben Jahre Ehe, für die er stand. Die bald zu Ende sein würde. Sie steckte den Ring wieder in die Tasche. Ihre linke Hand fühlte sich nackt an, schutzlos. Ich werde mich daran gewöhnen müssen, dachte sie, als sie den Zündschlüssel umdrehte., 10. Juli Dr Jack McCallum hörte das Heulen der Sirene des ersten Krankenwagens und sagte: »Jetzt gilt’s, Leute!« Während er hinaus in die Zufahrt der Notaufnahme trat, spürte er, wie sein Puls in eine Tachykardie verfiel und ein Adrenalinstoß seine Nerven in knisternde Hochspannungsleitungen verwandelte. Er hatte keine Ahnung, was da auf das Miles Memorial Hospital zukam, außer dass mehr als ein Patient auf dem Weg zu ihnen war. Sie hatten in der Notaufnahme über Funk die Meldung erhalten, dass bei einer Massenkarambolage mit fünfzehn Fahrzeugen auf der Interstate 45 zwei Personen auf der Stelle getötet und etwa zwanzig weitere verletzt worden waren. Obwohl die kritischsten Fälle ins Bayshore oder ins Texas Med eingeliefert wurden, waren alle kleineren Krankenhäuser der Umgegend, darunter auch das Miles Memorial, darauf vorbereitet, die restlichen aufzunehmen. Jack ließ den Blick über die Zufahrtsrampe schweifen, um sich davon zu überzeugen, dass sein Team bereit war. Die andere Unfallärztin, Anna Slezak, stand direkt neben ihm, sie blickte wild entschlossen drein. Unterstützt wurden die beiden von vier Krankenschwestern, einem Laborassistenten und einem ängstlich wirkenden Assistenzarzt. Dieser hatte sein Medizin- studium erst vor einem Monat abgeschlossen; er war das unerfahrenste Mitglied des Notaufnahme-Teams und hatte ganz offensichtlich zwei linke Hände. Der ist wie für die Psychiatrie geschaffen, dachte Jack. Die Sirene heulte ein letztes Mal auf und verstummte abrupt,, als der Krankenwagen in die Zufahrt einbog und rückwärts an die Rampe heranfuhr. Jack riss die Hecktür auf und warf einen ersten Blick auf die Patientin – eine junge Frau, deren Kopf und Hals mit einer Halskrawatte ruhig gestellt waren, das Haar von Blut verfilzt. Als sie sie aus dem Rettungswagen zogen und er ihr Gesicht genauer erkennen konnte, durchfuhr Jack plötzlich ein fröstelndes Gefühl. Er kannte sie. »Debbie«, sagte er. Sie blickte zu ihm auf, ohne ihn dabei wirklich anzusehen; offensichtlich wusste sie nicht, wer er war. »Ich bin’s, Jack McCallum«, sagte er. »Oh, Jack.« Sie schloss die Augen und stöhnte. »Mein Kopf tut weh.« Er tätschelte ihr beruhigend die Schulter. »Wir werden uns gut um dich kümmern, meine Liebe. Mach dir keine Sorgen.« Sie schoben sie durch die Türen der Notaufnahme in den Traumaraum. »Sie kennen sie?«, fragte Anna ihn. »Sie ist die Frau von Bill Haning. Dem Astronauten.« »Sie meinen, er ist einer von den Jungs da oben in der Raumstation?« Anna lachte. »Also, das wird wirklich ein Ferngespräch.« »Es ist kein Problem, ihn zu erreichen, wenn es sein muss. Das JSC kann einen Anruf direkt durchstellen.« »Möchten Sie, dass ich die Patientin übernehme?« Das war durchaus keine abwegige Frage. Normalerweise vermieden Ärzte es, Freunde und Verwandte zu behandeln; man kann nicht objektiv bleiben, wenn der Patient, der mit einem Herzstillstand vor einem auf dem Tisch liegt, jemand ist, den man kennt und mag. Obwohl er und Debbie sich eine Zeit lang öfter bei gesellschaftlichen Anlässen begegnet waren, betrachtete Jack sie jedoch lediglich als Bekannte und nicht als Freundin, weshalb es, ihm auch nichts ausmachte, sie zu verarzten. »Ich übernehme sie«, sagte er und folgte der fahrbaren Trage in den Traumaraum. Im Geiste nahm er schon die Schritte vorweg, die unternommen werden mussten. Ihre einzige sichtbare Verletzung waren die Abschürfungen am Kopf; da sie aber offensichtlich ein Schädeltrauma hatte, musste er zunächst Schädel- oder Halswirbelfrakturen ausschließen. Während die Schwestern Blut für das Labor abnahmen und vorsichtig Debbies restliche Kleidung entfernten, machte der Rettungssanitäter Jack rasch mit der Vorgeschichte vertraut. »Ihr Wagen war ungefähr der Fünfte in der Karambolage. Soweit wir das feststellen konnten, ist ihr einer hinten reingefahren, dann wurde ihr Wagen zur Seite geschleudert, und dann ist noch einer in sie reingerauscht, auf der Fahrerseite. Die Tür war eingedrückt.« »War sie bei Bewusstsein, als Sie bei ihr ankamen?« »Sie war ein paar Minuten bewusstlos. Ist aufgewacht, während wir den Zugang gelegt haben. Wir haben gleich ihr Rückgrat immobilisiert. Blutdruck und Herzrhythmus waren die ganze Zeit stabil. Sie hatte noch Glück.« Der Sanitäter schüttelte den Kopf. »Sie hätten mal den Typ hinter ihr sehen sollen.« Jack trat an die Trage, um die Patientin zu untersuchen. Debbies Pupillen reagierten beide auf Lichteinstrahlung, die extraokularen Bewegungen waren normal. Sie konnte ihren Namen sagen und wusste, wo sie war, konnte aber nicht sagen, welcher Tag es war. Nur zweifach orientiert, dachte er. Grund genug, sie stationär aufzunehmen, wenn auch nur zur Beobachtung für eine Nacht. »Debbie, ich schicke Sie zum Röntgen«, sagte er. »Wir wollen sichergehen, dass Sie sich nichts gebrochen haben.« Er wandte sich an die Krankenschwester. »Sofort CT von Schädel und C- Wirbel machen lassen. Und …« Er brach ab und horchte. Eine weitere Krankenwagensirene näherte sich., »Sehen Sie zu, dass die Aufnahmen gemacht werden«, befahl er. Dann trabte er zur Rampe zurück, wo sein Team sich schon wieder versammelte. Ein weiteres, schwächeres Sirenengeräusch hatte sich zu dem Ersten gesellt. Jack und Anna sahen sich besorgt an. Waren da etwa zwei Ambulanzen auf dem Weg zu ihnen? »Das wird wieder einer von diesen Tagen«, murmelte er. »Ist der Traumaraum frei?«, fragte Anna. »Die Patientin ist unterwegs zum Röntgen.« Er trat zu dem ersten Rettungswagen, der an die Rampe heranfuhr. Sobald der Wagen stand, riss er die Tür auf. Diesmal war es ein übergewichtiger Mann mittleren Alters, dessen Haut blass und feucht war. Anzeichen von Schock war Jacks erste Einschätzung, doch er sah kein Blut, keine Spur einer Verletzung. »Sein Wagen hatte nur einen leichten Blechschaden«, sagte der Rettungssanitäter, während sie den Mann in den Behandlungsraum rollten. »Bekam plötzlich Brustschmerzen, als wir ihn rauszogen. Rhythmus so weit stabil, ein wenig tachykard, aber keine Extrasystolen. Systolischer Druck bei neunzig. Wir haben vor Ort Morphium und Nitroglyzerin verabreicht, Sauerstoff ist auf sechs Liter eingestellt.« Alle waren hundertprozentig auf Draht. Während Anna Krankengeschichte und Befund aufnahm, schlossen die Krankenschwestern das EKG an. Die Maschine begann die Herzfrequenz anzuzeigen. Jack riss das Blatt aus dem Drucker; die ST-Hebungen in den V1- und V2-Anschlüssen fielen ihm sofort ins Auge. »Früherer Myokardinfarkt«, sagte er zu Anna. Sie nickte. »Ich hab mir gleich gedacht, dass er ein Kandidat für tPA ist.« Eine Krankenschwester rief durch die Tür: »Der nächste, Rettungswagen ist angekommen!« Jack und die zwei Schwestern liefen hinaus. Eine junge Frau lag schreiend und sich windend auf der Trage. Jack warf einen Blick auf ihr verkürztes rechtes Bein mit dem fast gänzlich zur Seite gedrehten Fuß und wusste, dass diese Patientin sofort in die Chirurgie gehörte. Rasch schnitt er ihre Kleider auf und legte eine eingestauchte Hüftfraktur frei, bei der sich der Oberschenkelknochen durch den Aufprall des Knies auf das Armaturenbrett tief in die Gelenkpfanne gebohrt hatte. Allein beim Anblick ihres grauenhaft verdrehten Beins wurde ihm fast übel. »Morphium?«, fragte die Krankenschwester. Er nickte. »Geben Sie ihr so viel, wie sie braucht. Sie hat ungeheure Schmerzen. Blutgruppenbestimmung und Kreuz- probe, sechs Einheiten. Und schaffen Sie so schnell wie möglich einen Orthopäden …« »Dr. McCallum sofort in die Röntgenabteilung! Dr. McCallum sofort in die Röntgenabteilung!« Jack blickte erschrocken auf. Debbie Haning. Er stürzte aus dem Zimmer. Debbie lag auf dem Röntgentisch; die Schwester aus der Notaufnahme und der Röntgenassistent beugten sich über sie. »Wir waren gerade mit den Wirbel- und Schädelaufnahmen fertig,« sagte der Assistent, »und jetzt kriegen wir sie nicht mehr wach. Sie reagiert nicht mal auf Schmerz.« »Wie lange ist sie schon ohne Bewusstsein?« »Ich weiß nicht. Sie hat schon zehn, fünfzehn Minuten auf dem Tisch gelegen, bevor wir gemerkt haben, dass sie nicht mehr mit uns redet.« »Haben Sie schon die CT gemacht?« »Der Computer ist abgestürzt. Das dauert ein paar Stunden, bis er wieder läuft.«, Jack leuchtete mit einer kleinen Taschenlampe in Debbies Augen und hatte plötzlich das unangenehme Gefühl, sein Magen befände sich im freien Fall. Ihre linke Pupille war geweitet und ohne Reaktion. »Zeigen Sie mir die Aufnahmen.« »Der C-Wirbel hängt schon am Lichtkasten.« Jack ging rasch in den Nebenraum und betrachtete die Röntgenaufnahmen, die an dem von hinten beleuchteten Schaukasten aufgehängt waren. Er sah keine Frakturen; die Halswirbelsäule war stabil. Er riss die Bilder herunter und ersetzte sie durch die Röntgenaufnahmen des Schädels. Auch hier sah er auf den ersten Blick nichts unmittelbar Auffälliges. Doch dann fiel sein Blick auf eine kaum wahrnehmbare Linie, die sich quer über das linke Schläfenbein zog. Sie war so fein, dass sie mit einer Nadel in den Röntgenfilm geritzt schien. Eine Fraktur. War die linke mittlere Hirnhautarterie angerissen? Das würde zu Blutungen im Schädel führen. Durch das sich ansammelnde Blut und den wachsenden Druck würde das Gehirn zusammen- gequetscht werden. Das erklärte die rapide Verschlechterung ihres mentalen Zustands und die geweitete Pupille. Das Blut musste sofort drainiert werden. »Bringen Sie sie zurück in die Notaufnahme!«, sagte er. Innerhalb von Sekunden hatten sie Debbie auf der fahrbaren Trage festgeschnallt und rollten sie im Laufschritt durch den Korridor. Als sie mit ihr in einen freien Behandlungsraum fuhren, rief er der Stationsschwester zu: »Piepsen Sie sofort die Neurochirurgie an! Sagen Sie, wir haben hier eine Epiduralblutung und bereiten eine Nottrepanation vor.« Er wusste, dass Debbie eigentlich in den OP musste, aber ihr Zustand verschlechterte sich so rapide, dass sie keine Zeit verlieren durften. Der Behandlungsraum würde als OP herhalten müssen. Sie hoben sie auf den Tisch und verkabelten ihre Brust, mit EKG-Schnüren. Ihre Atmung war jetzt unregelmäßig; es war Zeit, sie zu intubieren. Er hatte eben die Packung mit dem Endotrachealtubus aufgerissen, als die Schwester sagte: »Sie atmet nicht mehr!« Er schob das Laryngoskop in Debbies Rachen. Sekunden später war der Tubus an Ort und Stelle, und Sauerstoff wurde in ihre Lungen gepumpt. Eine Schwester stöpselte den Elektrorasierer ein. Debbies blonde Haare fielen in seidigen Büscheln zu Boden, während ihre Kopfhaut Stück für Stück freigelegt wurde. Die Stationsschwester schaute zur Tür herein. »Der Neurochirurg steckt im Stau! Er kann frühestens in einer Stunde hier sein.« »Dann holen Sie einen anderen her!« »Die sind alle im Texas Med! Die haben die ganzen Kopfverletzungen gekriegt.« O Gott, jetzt sitzen wir in der Tinte, dachte Jack und schaute Debbie an. Mit jeder Minute, die verstrich, stieg der Druck in ihrem Schädel weiter an. Gehirnzellen starben ab. Wenn das hier meine Frau wäre, würde ich nicht mehr warten. Keine Sekunde. Er schluckte vernehmlich. »Holen Sie mir den Hudson- Knochenbohrer! Ich werde selbst trepanieren.« Er sah die verblüfften Blicke der Krankenschwestern und fügte mit gespielter Gelassenheit hinzu: »Es ist, wie wenn man Löcher in eine Wand bohrt. Ich mache das nicht zum ersten Mal.« Während die Schwestern die frisch geschorene Kopfhaut vorbereiteten, schlüpfte Jack in einen OP-Kittel und zog sich Gummihandschuhe über. Er zog die sterilen Abdecktücher zurecht und war erstaunt, dass seine Hände immer noch ganz ruhig waren, auch wenn sein Herz raste. Es stimmte, dass er schon einmal trepaniert hatte, jedoch erst ein einziges Mal, und das war vor Jahren gewesen – unter der Aufsicht eines, Neurochirurgen. Es bleibt keine Zeit mehr. Sie stirbt. Tu’s! Er griff nach dem Skalpell und machte oberhalb des Schläfenbeins einen geraden Einschnitt. Blut sickerte heraus. Er tupfte es weg und kauterisierte die blutenden Gefäße. Mit einem Wundspreizer sicherte er Hautlappen und schnitt tiefer durch die Kopfschwarte, bis er die Schädelhaut erreichte. Er kratzte sie zur Seite und legte die Schädeloberfläche frei. Dann nahm er den Bohrer zur Hand. Es war ein mechanischer Apparat, handbetrieben und von fast antikem Aussehen – ein Werkzeug, wie man es in Großvaters Schreinerwerkstatt hätte finden können. Zuerst benutzte er den Perforator, eine spatenförmige Bohrspitze, die sich gerade tief genug in den Knochen eingrub, dass ein kleines Loch entstand. Dann tauschte er ihn gegen die Rosette, einen kugelförmigen Einsatz mit aufgerauter Oberfläche. Er holte noch einmal Luft, setzte den Bohrer an und begann tiefer zu bohren. Auf das Gehirn zu. Die ersten Schweißtropfen traten ihm auf die Stirn. Er hatte keine CT-Aufnahmen, nach denen er sich hätte richten können; seine einzige Orientierungshilfe war sein medizinisches Urteil. Er wusste nicht einmal, ob er die richtige Stelle anbohrte. Ein Schwall Blut schoss plötzlich aus dem Loch und spritzte auf die OP-Tücher. Eine Schwester reichte ihm eine Schale. Er zog den Bohrer heraus und sah zu, wie ein stetiger roter Strom aus dem Schädel floss und sich in der Schale zu einer glänzenden Lache sammelte. Er hatte die richtige Stelle angezapft. Mit jedem abfließenden Tropfen ließ der Druck auf Debbie Hanings Gehirn nach. Er atmete tief durch, und mit einem Mal fiel die Spannung von ihm ab; er fühlte sich erschöpft, und seine Muskeln schmerzten. »Machen Sie das Knochenwachs fertig«, sagte er. Dann legte er den Bohrer weg und griff nach dem Absaugkatheter., Eine weiße Maus hing mitten in der Luft. Es sah aus, als schwimme sie im klaren Wasser des Ozeans. Dr. Emma Watson schwebte auf sie zu, wobei die Bewegungen ihrer zierlichen Gliedmaßen anmutig waren wie die einer Unterwassertänzerin. Ihre aufgefächerten braunen Ringellöckchen umhüllten ihren Kopf wie ein verschwommener Heiligenschein. Sie griff nach der Maus und drehte sich langsam um die eigene Achse, bis sie in die Kamera blickte. In der anderen Hand hielt sie eine Spritze. Die Aufnahmen waren über zwei Jahre alt, gefilmt an Bord des Shuttles Atlantis während der Mission STS 141, doch es war immer noch Gordon Obies bevorzugter PR-Film, weshalb er jetzt auch über alle Videobildschirme des Teague-Auditoriums der NASA lief. Wem würde es nicht Spaß machen, Emma Watson zu beobachten? Sie war grazil und gewandt, sprühte regelrecht vor Schwung und Energie, und in ihren Augen brannte ein neugieriges Feuer. Von der winzigen Narbe oberhalb ihrer Augenbraue bis zu dem etwas angeschlagenen Schneidezahn (ein Souvenir einer allzu wilden Schussfahrt, wie er gehört hatte) war ihr Gesicht ein Abbild ihres überschwänglichen Lebensstils. Aber was sie für Gordon in erster Linie anziehend machte, war ihre Intelligenz. Ihre Kompetenz. Er hatte Emmas Karriere bei der NASA mit Interesse verfolgt, und das hatte nichts mit der Tatsache zu tun, dass sie eine attraktive Frau war. Als Direktor der Flugeinsatzabteilung hatte Gordon Obie einen beträchtlichen Einfluss auf die Auswahl der Crewmitglieder, und er war bemüht, eine sichere emotionale Distanz – manche hätten auch von Herzlosigkeit gesprochen – gegenüber seinen Astronauten zu wahren. Er war selbst Astronaut gewesen, zweimal auch Shuttle-Commander, und schon damals war er als »Sphinx« bekannt gewesen, als verschlossener, unnahbarer Mann, der nichts von Smalltalk hielt. Er hatte sich in seiner stillen Isolation und relativen Anonymität recht gut eingerichtet., Obwohl er jetzt mit einer ganzen Reihe von hohen NASA- Vertretern auf dem Podium saß, wussten die meisten Leute im Zuhörerraum nicht, wer Gordon Obie war. Er war nur zur Dekoration da. Genau wie der Film mit Emma Watson nur der Dekoration diente, ein hübsches Gesicht, mit dem das Interesse der Zuschauer wach gehalten werden sollte. Das Video brach unvermittelt ab, und auf den Bildschirmen erschien stattdessen das NASA-Logo, auch scherzhaft als »Fleischklops« bezeichnet – ein mit Sternen gespickter blauer Kreis, verziert mit einer stilisierten elliptischen Umlaufbahn und durchkreuzt von einem gegabelten roten Strich. Der NASA- Verwaltungschef Leroy Connell und der Direktor des JSC Ken Blankenship traten an das Rednerpult, um sich den Fragen zu stellen. Ihre Mission bestand schlicht und einfach darin, um Geld zu betteln, und sie hatten es hier mit einer Versammlung von skeptischen Kongressabgeordneten und Senatoren zu tun, Mitgliedern der verschiedenen Unterausschüsse, die über das Budget der NASA zu entscheiden hatten. Die NASA litt jetzt schon im zweiten Jahr unter verheerenden Kürzungen, und seit einiger Zeit herrschte in den Räumen des Johnson Space Center eine ausgesprochen düstere Atmosphäre. Gordon Obie blickte in die Reihen von elegant gekleideten Männern und Frauen, und er hatte das Gefühl, einer fremden Kultur gegenüberzustehen. Was war nur los mit diesen Politikern? Wie konnten sie bloß so kurzsichtig sein? Er begriff nicht, dass sie seine leidenschaftlichste Überzeugung nicht teilten: dass nämlich allein der Hunger nach Wissen den Menschen vom Tier unterscheidet. Jedes Kind stellt die universelle Frage: Warum? Von Geburt an ist der Mensch darauf programmiert, neugierig zu sein, zu forschen, wissenschaftliche Wahrheiten zu entdecken. Doch diese gewählten Volksvertreter hatten die Neugier verloren, die den Menschen so einmalig macht. Die Frage, mit der sie nach Houston gekommen waren, lautete nicht Warum?,, sondern Wozu soll das eigentlich gut sein? Es war Cornells Idee gewesen, sie mit dem zu umgarnen, was er zynisch »die Tom-Hanks-Tour« nannte – eine Anspielung auf den Film Apollo 13, der immer noch mit die beste Werbung war, die die NASA je gehabt hatte. Cornell hatte ihnen bereits die jüngsten Forschungserfolge an Bord der International Space Station präsentiert. Er hatte sie ein paar echten Astronauten die Hand schütteln lassen. Träumte davon nicht jeder? Eine dieser Lichtgestalten, dieser Heldenfiguren zu berühren? Anschließend würden sie einen Rundgang durch das Johnson Space Center machen, beginnend mit Bau 30 und dem Flugkontrollraum. Es spielte gar keine Rolle, dass dieses Publikum ein Kontrollpult nicht von einem Nintendo-Computerspiel unterscheiden konnte. Die glitzernden technischen Apparaturen würden sie gewiss blenden und sie zu wahren Gläubigen machen. Aber es funktioniert nicht, dachte Gordon verbittert. Diese Politiker fallen nicht darauf rein. Die NASA hatte es mit mächtigen Gegenspielern zu tun, angefangen mit Senator Phil Parish, der in der ersten Reihe saß. Parish war sechsundsiebzig Jahre alt, ein kompromissloser Falke aus South Carolina, dessen oberste Priorität die Wahrung des Verteidigungsetats war – zur Hölle mit der NASA. Jetzt stemmte er seine zweieinhalb Zentner aus dem Sitz, um Cornell in dem gedehnten Tonfall des Südstaaten-Gentlemans anzureden. »Ihre Behörde hat mit dieser Raumstation ihr Budget um Milliarden Dollar überzogen«, sagte er. »Ich glaube ehrlich gesagt nicht, dass das amerikanische Volk bereit ist, seine Verteidigungsbereitschaft zu opfern, damit Sie sich da oben die Zeit mit Ihren schlauen Laborexperimenten vertreiben können. Das Ganze sollte doch ein internationales Projekt sein, oder? Nun, wenn ich es richtig sehe, bleiben wir auf dem größten Teil der Rechnung sitzen. Wie soll ich diese gewaltige Geldverschwendung gegenüber den braven Bürgern von South, Carolina rechtfertigen?« Der NASA-Verwaltungsdirektor reagierte mit einem telegenen Lächeln. Cornell war der geborene Politiker, sein Charme und sein Charisma machten ihn zum Liebling der Presse. Auch in Washington kam er gut an; hier verbrachte er den größten Teil seiner Zeit damit, im Kongress und im Weißen Haus Geld locker zu machen, Geld und noch mehr Geld, um das ewig löchrige Budget der Weltraumbehörde zu stopfen. Er war das öffentliche Gesicht der NASA, während Ken Blankenship, der die Verantwortung für die alltäglichen Abläufe im JSC hatte, das private, nur den Insidern vertraute Gesicht war. Sie bildeten das Yin und Yang der NASA-Führung – zwei so grundverschiedene Temperamente, dass man sich nur schwerlich vorstellen konnte, dass sie als Team funktionierten. In der NASA kursierte der Witz, dass Leroy Cornell ganz Stil ohne jeglichen Gehalt sei, während Blankenship für sein Gehalt recht wenig Stil zeige. Cornell gab eine geschliffene Erwiderung auf Senator Parishs Frage. »Sie fragen, weshalb die anderen Länder keinen Beitrag leisten. Die Antwort, Senator Parish, ist, dass sie das bereits getan haben. Dies ist eine wahrhaft internationale Raumstation. Zugegeben, die Russen sind ausgesprochen knapp bei Kasse. Und es stimmt auch, dass wir für die Differenz aufgekommen sind. Aber sie engagieren sich mit ganzem Herzen für diese Station. Zurzeit haben sie einen Kosmonauten dort oben, und sie haben allen Grund, uns zu helfen, die ISS in Gang zu halten. Was die Frage betrifft, warum wir die Station brauchen – nun, schauen Sie doch nur einmal an, was dort im Augenblick an medizinischer und biologischer Forschung betrieben wird, an materialwissenschaftlichen und geophysikalischen Experimenten. Wir werden es beide noch erleben, dass die Früchte dieser Forschungsarbeit geerntet werden.« Wieder stand jemand im Publikum auf, und Gordon spürte, wie sein Blutdruck stieg. Wenn es jemanden gab, den er noch, mehr verachtete als Senator Parish, dann war es der Kongressabgeordnete Joe Bellingham aus Montana, dessen markiges Erscheinungsbild nicht darüber hinwegtäuschen konnte, dass er auf dem Gebiet der Wissenschaft extrem unterbelichtet war. In seinem letzten Wahlkampf hatte er gefordert, die Schöpfungslehre zum Pflichtfach in Schulen zu machen. Schmeißt die Biologiebücher aus dem Fenster und schlagt lieber die Bibel auf. Er glaubt wahrscheinlich, Raketen würden von Engeln gezogen. »Was ist denn mit der ganzen Technologie, die wir mit den Russen und Japanern teilen?«, fragte Bellingham. »Ich habe die Sorge, dass wir damit unser geheimes High-Tech-Wissen ohne Gegenleistung herausrücken. Das mit der internationalen Kooperation klingt wunderbar nobel und hochgesinnt, aber was soll diese Leute denn davon abhalten, eine Kehrtwendung zu machen und ihr Wissen gegen uns zu verwenden? Warum sollten wir den Russen vertrauen?« Irrationale Befürchtungen. Verfolgungswahn. Unwissenheit und Aberglaube. Es gab zu viel davon im Land, und Gordon bekam schon Depressionen, wenn er Bellingham nur zuhörte. Er wandte sich angeekelt ab. In diesem Moment sah er, wie Hank Millar mit düsterem Gesicht das Auditorium betrat. Millar war der Leiter des Astronautenbüros. Er blickte Gordon direkt in die Augen, und dieser wusste sofort, dass es irgendwo ein ernstes Problem gab. Gordon verließ unauffällig das Podium, und die beiden Männer traten in die Eingangshalle hinaus. »Was gibt es denn?« »Es ist ein Unfall passiert. Bill Hanings Frau. Wie wir hören, sieht es schlecht aus.« »O Gott.« »Bob Kittredge und Woody Ellis warten drüben im Medienzentrum. Wir müssen uns unterhalten.« Gordon nickte. Er warf noch einen Blick durch die Tür in das, Auditorium, wo der Kongressabgeordnete Bellingham sich immer noch darüber ausließ, wie gefährlich es sei, Technologie mit den Roten zu teilen. Mit grimmiger Miene folgte er Hank nach draußen, über den Hof und auf das nächste Gebäude zu. Das Treffen fand in einem Hinterzimmer statt. Kittredge, der Shuttle-Commander des Flugs STS 162, war ganz rot vor Aufregung. Dagegen wirkte Woody Ellis, der für die ISS zuständige Flugdirektor, wesentlich ruhiger. Allerdings hatte Gordon Ellis noch nie erregt oder aufgebracht erlebt, nicht einmal in extrem angespannten Situationen. »Wie schwer war denn der Unfall?«, fragte Gordon. »Mrs. Hanings Wagen war in eine Massenkarambolage auf der I 45 verwickelt«, sagte Hank. »Man hat sie mit dem Krankenwagen ins Miles Memorial gebracht. Jack McCallum hat sie in der Notaufnahme gesehen.« Gordon nickte. Sie alle kannten Jack gut. Obwohl er nicht mehr zum Astronautenkorps gehörte, stand er immer noch auf der Liste der aktiven Flugärzte der NASA. Vor einem Jahr hatte er die meisten Aufgaben bei der NASA niedergelegt, seither arbeitete er als Unfallarzt im zivilen Bereich. »Jack war derjenige, der unser Büro wegen Debbie angerufen hat«, sagte Hank. »Hat er irgendetwas über ihren Zustand gesagt?« »Schwere Kopfverletzungen. Sie liegt im Koma auf der Intensivstation.« »Prognose?« »Dazu konnte er nichts sagen.« In der nun eintretenden Stille dachten sie alle daran, was diese Tragödie für die NASA bedeutete. Hank seufzte. »Wir werden es Bill sagen müssen. Wir können ihm diese Nachricht nicht vorenthalten. Das Problem ist …« Er vollendete den Satz nicht, was auch nicht nötig war, denn sie wussten alle, was das Problem war., Bill Haning kreiste zurzeit mit der ISS um die Erde. Er hatte erst einen Monat seines auf vier Monate angelegten Einsatzes hinter sich. Diese Nachricht würde ihn umhauen. Von allen Faktoren, die einen längeren Aufenthalt im All so schwierig machten, bereitete die emotionale Belastung der NASA die größten Sorgen. Ein depressiver Astronaut konnte einer Mission verheerenden Schaden zufügen. Vor Jahren war in der Mir eine ähnliche Situation eingetreten, als der Kosmonaut Volodya Dezhurov vom Tod seiner Mutter erfahren hatte. Tagelang hatte er sich in einer der Mir-Kapseln eingeschlossen und sich geweigert, mit der Bodenkontrolle in Moskau zu sprechen. Sein Zustand hatte die Arbeit der gesamten Mir-Besatzung beeinträchtigt. »Die beiden haben eine sehr enge Beziehung«, sagte Hank. »Ich kann euch schon jetzt sagen, dass Bill das ganz schön zusetzen wird.« »Schlagen Sie vor, wir sollen ihn ersetzen?«, fragte Gordon. »Mit dem nächsten planmäßigen Shuttleflug. Es wird ihm schwer genug fallen, die nächsten zwei Wochen dort oben festzusitzen. Wir können nicht verlangen, dass er die ganzen vier Monate durchzieht.« Leise fügte Hank hinzu: »Sie haben schließlich zwei kleine Kinder.« »Seine Vertretung für die ISS ist Emma Watson«, sagte Woody Ellis. »Wir könnten sie mit STS 160 raufschicken. In Vance’ Crew« Gordon achtete sorgfältig darauf, bei der Erwähnung von Emmas Namen keinerlei Zeichen eines besonderen Interesses zu zeigen. Oder irgendeines Gefühls. »Was halten Sie von Watson? Ist sie in der Lage, drei Monate früher als vorgesehen zu fliegen?« »Sie ist Bills reguläre Ablösung. Bei den meisten Bordexperimenten ist sie schon jetzt auf dem erforderlichen Trainingsstand. Ich denke, es ist machbar.«, »Also, mir gefällt das überhaupt nicht«, warf Bob Kittredge ein. Gordon stieß einen müden Seufzer aus und sah den Shuttle- Commander an. »Das hatte ich auch nicht erwartet.« »Watson ist ein fester Bestandteil meiner Crew. Wir sind zu einem Team zusammengewachsen. Ich würde es nur äußerst ungern auflösen.« »Ihr Team hat noch drei Monate bis zum Start. Sie haben genügend Zeit, Änderungen vorzunehmen.« »Sie erschweren mir meine Arbeit sehr.« »Wollen Sie etwa sagen, dass Sie in dieser Zeit kein neues Team bilden können?« Kittredge presste die Lippen zusammen. »Ich sage lediglich, dass mein Team bereits eine funktionierende Einheit ist. Wir wären nicht sehr erfreut darüber, Watson zu verlieren.« Gordon sah Hank an. »Was ist mit der Crew von STS 160? Mit Vance und seinem Team?« »Von deren Seite gibt es keine Schwierigkeiten. Watson wäre einfach nur ein weiterer Passagier an Deck. Sie würden sie bei der ISS abliefern wie jede andere Nutzlast.« Gordon dachte darüber nach. Noch sprachen sie nur über Möglichkeiten, nicht über Gewissheiten. Vielleicht wachte Debbie Haning wieder auf und erholte sich, und Bill konnte wie geplant in der ISS bleiben. Aber wie alle anderen bei der NASA hatte Gordon sich beigebracht, sämtliche Eventualitäten in seine Planung einzubeziehen. Er hatte in solchen Fällen immer ein Flussdiagramm im Kopf, in dem die entsprechenden Schritte im Falle von a, b oder c eingezeichnet waren. Er sah Woody Ellis an, um eine letzte Bestätigung zu erhalten. Woody antwortete mit einem Nicken. »Okay«, sagte Gordon. »Bringen Sie mir Emma Watson.«, Sie entdeckte ihn am Ende des Krankenhausflurs. Er sprach gerade mit Hank Millar, und obwohl er ihr den Rücken zukehrte und die übliche grüne Krankenhauskleidung trug, wusste Emma, dass es Jack war. Sieben Jahre Ehe hatten eine Vertrautheit geschaffen, die weit über das bloße Erkennen seines Gesichts hinausging. Genauso hatte sie Jack McCallum auch zum allerersten Mal gesehen, als sie beide ihre Facharztausbildung im San Francisco General Hospital gemacht hatten. Er hatte an der Theke der Stationsschwester gestanden und etwas in eine Krankenakte geschrieben; seine breiten Schultern hatten müde gewirkt, und sein Haar war so zerzaust gewesen, als hätte er sich eben erst aus dem Bett gewälzt. Das hatte er tatsächlich: Es war der Morgen nach einer hektischen Nacht im Bereitschaftsdienst. Und wenn er auch unrasiert und verschlafen war – in dem Moment, als er sich umgedreht und sie zum ersten Mal angesehen hatte, hatte es augenblicklich zwischen ihnen gefunkt. Jetzt war Jack zehn Jahre älter, in seinem schwarzen Haar waren graue Strähnen zu sehen, und wieder einmal lastete die Erschöpfung auf seinen Schultern. Sie hatte ihn drei Wochen nicht gesehen, hatte lediglich vor ein paar Tagen kurz mit ihm telefoniert – ein Gespräch, das wieder einmal zu einer lautstarken Auseinandersetzung ausgeartet war. Es schien, als könnten sie in letzter Zeit einfach nicht vernünftig miteinander umgehen und wären nicht in der Lage, eine noch so kurze zivilisierte Unterhaltung zu führen. Hank Millar erkannte sie zuerst, und seine Gesichtsmuskeln spannten sich augenblicklich an, als wisse er, dass eine Schlacht unmittelbar bevorstand, und er sich flugs aus dem Staub machen wolle, bevor die Schießerei losging. Jack musste bemerkt haben, wie sich Hanks Miene veränderte, denn er blickte sich um, um herauszufinden, was der Grund war. Sobald er Emma erblickte, schien er zu erstarren, und das, spontane Begrüßungslächeln gefror auf seinen Lippen. Es sah fast so aus, als sei er sowohl überrascht als auch erfreut, sie zu sehen – aber nur für einen kurzen Moment. Dann übernahm etwas anderes die Kontrolle; sein Lächeln verschwand und wurde durch einen Ausdruck ersetzt, der weder freundlich noch unfreundlich war, sondern einfach nur neutral. Das Gesicht eines Fremden, dachte sie. Und das tat irgendwie mehr weh, als hätte er sie mit offener Feindseligkeit empfangen. Dann wäre wenigstens noch irgendein Gefühl übrig gewesen, irgendein noch so klägliches Überbleibsel einer Ehe, die einmal glücklich gewesen war. Unwillkürlich erwiderte sie seinen ausdruckslosen Blick mit einer Miene, die um keinen Deut weniger neutral war. Und als sie zu sprechen begann, richtete sie ihre Worte an beide Männer gleichzeitig, ohne einen zu bevorzugen. »Gordon hat mir von Debbie erzählt«, sagte sie. »Wie geht es ihr?« Hank warf Jack einen Blick zu, als erwarte er, dass dieser zuerst antwortete. Schließlich sagte er: »Sie ist immer noch nicht bei Bewusstsein. Wir halten so eine Art Wache im Wartezimmer. Wenn Sie uns Gesellschaft leisten wollen …« »Ja. Natürlich.« Sie ging auf das Wartezimmer für Besucher zu. »Emma!«, rief Jack ihr nach. »Kann ich mit dir reden?« »Wir sehen uns dann später«, sagte Hank, der die Gelegenheit zu einem hastigen Rückzug nutzte. Sie warteten, bis er um die Ecke verschwunden war, dann sahen sie sich an. »Debbie geht es nicht gut«, sagte Jack. »Was ist denn passiert?« »Sie hatte eine Epiduralblutung. Als sie eingeliefert wurde, war sie bei Bewusstsein und konnte sprechen. Innerhalb von wenigen Minuten ging es ihr rapide schlechter. Ich war mit einer, anderen Patientin beschäftigt, sodass ich es nicht gleich bemerkt habe. Ich habe erst trepaniert, als …« Er verstummte und wandte den Blick ab. »Sie wird künstlich beatmet.« Emma hob die Hand, um ihn zu berühren, doch dann überlegte sie es sich anders – er würde sie doch nur von sich stoßen. Es war so lange her, dass er irgendwelche tröstenden Worte von ihr hatte annehmen können. Was auch immer sie sagte und wie ehrlich sie es auch meinte, er würde es als Mitleid interpretieren. Und das verabscheute er. Alles, was sie sagen konnte, war: »So eine Diagnose ist nicht einfach, Jack.« »Ich hätte sie eher stellen müssen.« »Du hast gesagt, dass sich ihr Zustand rapide verschlechtert hat. Du darfst dir nicht im Nachhinein Vorwürfe machen.« »Das ist mir ehrlich gesagt keine allzu große Hilfe.« »Ich will dir ja auch gar nicht helfen!«, rief Emma zornig. »Ich habe lediglich die einfache Feststellung gemacht, dass du die richtige Diagnose gestellt und entsprechend gehandelt hast. Kannst du nicht einmal ein wenig nachsichtig mit dir selbst sein?« »Hör mal, hier geht’s nicht um mich, okay?«, gab er zurück. »Es geht um dich!« »Was meinst du damit?« »Debbie kommt so schnell nicht wieder raus. Und das bedeutet, dass Bill …« »Ich weiß. Gordon Obie hat mich schon vorgewarnt.« Jack antwortete nicht sofort. »Dann ist es also entschieden?« Sie nickte. »Bill kommt nach Hause. Ich werde ihn mit dem nächsten Flug ablösen.« Ihr Blick schweifte hinüber zur Intensivstation. »Sie haben zwei Kinder«, sagte sie leise. »Er kann nicht da oben bleiben. Nicht drei Monate.«, »Du bist noch nicht so weit. Du hast keine Zeit gehabt …« »Ich werde so weit sein.« Sie drehte sich um. »Emma.« Er streckte die Hand aus, um sie zurückzuhalten, und seine Berührung überraschte sie. Sie drehte sich zu ihm um. Sofort ließ er sie wieder los. »Wann gehst du nach Kennedy?« »In einer Woche. Quarantäne.« Er sah betroffen aus. Doch er schwieg, während er versuchte, die Nachricht zu verarbeiten. »Da fällt mir ein«, sagte sie, »könntest du dich um Humphrey kümmern, wenn ich weg bin?« »Warum gibst du ihn nicht in Pflege?« »Es ist grausam, eine Katze drei Monate lang einzusperren.« »Hast du dem kleinen Ungeheuer schon die Krallen stutzen lassen?« »Stell dich nicht so an, Jack. Er wetzt nur dann seine Krallen, wenn er das Gefühl hat, dass man ihn ignoriert. Kümmer dich richtig um ihn, dann lässt er auch deine Möbel in Ruhe.« Jack hob den Blick, als die Durchsage über den Lautsprecher kam: »Dr. McCallum in die Notaufnahme. Dr. McCallum in die Notaufnahme.« »Du musst jetzt wohl gehen«, sagte sie und wandte sich von ihm ab. »Warte. Das geht alles so schnell. Wir hatten gar keine Zeit zum Reden.« »Falls es um die Scheidung geht, kann dir mein Anwalt alle Fragen beantworten, solange ich weg bin.« »Nein.« Sein scharfer Ton schreckte sie auf. »Nein, ich will nicht mit deinem Anwalt reden!« »Und was willst du mir so Dringendes sagen?« Er starrte sie einen Augenblick lang an, als suche er nach den, richtigen Worten. »Es geht um diese Mission«, sagte er schließlich. »Das Ganze ist überstürzt. Ich habe kein gutes Gefühl dabei.« »Was soll das denn heißen?« »Du wirst in letzter Minute eingewechselt und fliegst mit einer fremden Crew« »Vance hat sein Schiff voll im Griff. Ich habe keine Bedenken, was diesen Flug betrifft.« »Und was ist mit der Raumstation? Es könnte sein, dass du sechs Monate im Orbit bleiben musst.« »Das schaffe ich schon.« »Aber so war es nicht geplant. Das ist alles in letzter Minute zusammengeschustert worden.« »Was willst du mir damit sagen, Jack? Dass ich kneifen soll?« »Ich weiß nicht!« Frustriert fuhr er sich mit der Hand durchs Haar. »Ich weiß es nicht.« So standen sie eine Weile schweigend da. Keiner wusste genau, was er sagen sollte, und doch waren beide noch nicht bereit, das Gespräch zu beenden. Sieben Jahre Ehe, dachte sie, und das ist dabei herausgekommen. Zwei Menschen, die nicht zusammenbleiben können und sich auch nicht voneinander trennen können. Und jetzt bleibt keine Zeit mehr, die Dinge zwischen uns zu klären. Wieder kam eine Durchsage über den Lautsprecher: »Dr. McCallum sofort in die Notaufnahme!« Jack sah sie an. Sein Blick drückte Zerrissenheit aus. »Emma …« »Geh, Jack«, drängte sie ihn. »Du wirst gebraucht.« Enttäuscht stöhnte er auf und machte sich im Laufschritt auf den Weg in die Notaufnahme. Und sie drehte sich um und ging in die andere Richtung., 12. Juli An Bord der ISS Durch das Beobachtungsfenster in der Kuppel des Verbindungsknotens in der Mitte der Station konnte Dr. William Haning sehen, wie die Wolken fünfhundert Kilometer unter ihm über den Atlantischen Ozean wirbelten. Er berührte das Glas, und seine Finger glitten über die Trennscheibe, die ihn vor dem Vakuum des Weltalls schützte. Sie war wie ein weiteres Hindernis zwischen ihm und seinem Zuhause. Zwischen ihm und seiner Frau. Er sah, wie die Erde sich unter ihm drehte, sah den Atlantik allmählich verschwinden, sah, wie Nordafrika und dann der Indische Ozean vorüberglitten und die Dunkelheit der Nacht heranrückte. Obwohl sein Körper schwerelos im Raum schwebte, schien die Last des Kummers auf seine Brust zu drücken und ihm das Atmen zur Qual zu machen. In einem Krankenhaus in Houston kämpfte in diesem Augenblick seine Frau um ihr Leben, und er konnte nichts tun, um ihr zu helfen. Für die nächsten zwei Wochen würde er hier gefangen sein; er würde die Stadt sehen können, in der Debbie vielleicht gerade im Sterben lag, und würde sie doch nicht erreichen, nicht berühren können. Er konnte bestenfalls die Augen schließen und sich vorzustellen versuchen, er säße an ihrer Seite und hielte ihre Hand fest in der seinen. Du musst durchhalten. Du musst kämpfen. Ich bin bald bei dir. »Bill? Alles in Ordnung mit dir?« Er drehte sich um und sah Diana Estes aus der US- Laborkapsel in das Verbindungsmodul schweben. Es überraschte ihn, dass sie sich nach seinem Befinden erkundigte., Obwohl sie schon einen Monat auf engstem Raum zusammenlebten, hatte er sich mit der Engländerin nicht anfreunden können. Sie war zu kalt, zu emotionslos. Sie sah mit ihrem blonden Haar auf unterkühlte Weise zwar gut aus, aber sie war nicht die Art Frau, zu der er sich jemals hingezogen fühlen würde. Auch sie hatte nicht das geringste Interesse an ihm bekundet. Allerdings wurde ihre Aufmerksamkeit auch die meiste Zeit von Michael Griggs in Anspruch genommen. Die Tatsache, dass Griggs eine Frau hatte, die unten auf der Erde auf ihn wartete, schien für die beiden keinerlei Bedeutung zu haben. Diana und Griggs waren wie die beiden Hälften eines Doppelsterns, die einander ständig umkreisten, aneinander gefesselt durch eine gewaltige Anziehungskraft. Das gehörte zu den unerfreulichen Begleiterscheinungen, mit denen man sich abzufinden hatte, wenn man einer von sechs Menschen aus vier verschiedenen Ländern war, die in so beengten Verhältnissen zusammenleben mussten: die ständig wechselnden Bündnisse und Spaltungen, die unstete Trennlinie zwischen uns und denen. Der Stress des Eingeschlossenseins über so lange Zeit machte sich bei jedem auf eigene Weise bemerkbar. Der Russe Nikolai Rudenko, der schon am längsten in der ISS weilte, war in letzter Zeit immer mürrischer und reizbarer geworden. Kenichi Hirai von der japanischen Weltraumorganisation NASDA war wegen seiner mangelhaften Englischkenntnisse so frustriert, dass er oft in beklommenes Schweigen verfiel. Nur Luther Arnes kam immer noch mit allen gut aus. Als Houston die schlechte Nachricht über Debbie durchgegeben hatte, war Luther derjenige gewesen, der instinktiv gewusst hatte, wie er mit Bill zu reden hatte. Er hatte einfach aus dem Herzen gesprochen, von Mensch zu Mensch. Luther war der Sohn eines beliebten schwarzen Geistlichen aus Alabama, und er hatte von seinem Vater das Talent geerbt, Trost zu spenden. »Das ist gar keine Frage, Bill«, hatte Luther gesagt. »Du musst, heim zu deiner Frau. Du sagst jetzt Houston, sie sollen dir das Taxi schicken, das dich nach Hause bringt, oder sie kriegen es mit mir zu tun.« Wie anders hatte doch Diana reagiert. Logisch denkend wie immer, hatte sie ganz ruhig darauf hingewiesen, dass Bill doch ohnehin nichts tun könne, um die Genesung seiner Frau zu beschleunigen. Debbie lag im Koma; sie würde nicht einmal merken, ob er da war. So kalt und spröde wie die Kristalle, die sie in ihrem Labor züchtet. Das war Bills Urteil über Diana. Und deshalb fand er es merkwürdig, dass sie sich jetzt nach ihm erkundigte. Sie hielt am Eingang des Verbindungsmoduls inne, distanziert wie immer. Ihre langen blonden Haare wehten ihr ins Gesicht wie Seegras in der Strömung. Er drehte sich wieder zum Fenster um. »Ich warte darauf, dass Houston auftaucht«, sagte er. »Du hast wieder einen Haufen E-Mails aus dem Nutzlastzentrum.« Er erwiderte nichts, sondern starrte nur auf die funkelnden Lichter von Tokio hinab, wo jetzt gerade die Morgendämmerung hereinbrach. »Bill, es sind Sachen dabei, die deine Aufmerksamkeit erfordern. Wenn du dich nicht dazu in der Lage siehst, werden wir anderen deine Pflichten unter uns aufteilen müssen.« Pflichten. Also deshalb war sie gekommen. Nicht, um mit ihm über seinen Schmerz zu reden, sondern um herauszufinden, ob sie sich noch darauf verlassen konnten, dass er die ihm zugewiesenen Aufgaben im Labor erfüllte. Die Tage an Bord der ISS waren gründlich verplant, es blieb nur wenig Zeit zum Nachdenken oder Trauern. Wenn ein Mitglied der Crew arbeitsunfähig wurde, mussten die anderen in die Bresche springen und sich um die laufenden Experimente kümmern. »Manchmal«, sagte Diana mit ihrer makellosen Logik, »ist Arbeit das beste Mittel, um sich nicht vom Kummer, überwältigen zu lassen.« Er legte einen Finger auf den Lichtfleck, der Tokio darstellte. »Tu nicht so, als hättest du ein Herz, Diana. Darauf fällt niemand rein.« Einen Augenblick lang sagte sie nichts. Er hörte nur das ununterbrochene summende Hintergrundgeräusch der Raumstation, an das er sich schon so sehr gewöhnt hatte, dass er es normalerweise kaum noch wahrnahm. Unbeeindruckt fuhr sie fort: »Ich verstehe ja, dass es schwer für dich ist. Es ist gewiss nicht leicht, hier gefangen zu sein, ohne jede Möglichkeit, nach Hause zu gelangen. Aber du kannst es nun mal nicht ändern. Du musst eben auf das Shuttle warten.« Er lachte bitter. »Warum denn warten, wenn ich doch in vier Stunden zu Hause sein kann?« »Red doch keinen Unsinn, Bill.« »Das ist kein Unsinn. Ich sollte einfach in das CRV steigen und abhauen,« »Und uns ohne Rettungsboot zurücklassen? Du hast wohl den Verstand verloren.« Sie machte eine Pause. »Hör mal, vielleicht würdest du dich besser fühlen, wenn du ein paar Medikamente nehmen würdest. Nur um diese Phase besser durchzustehen.« Er drehte sich zu ihr um, und all sein Schmerz und seine Trauer machten plötzlich einer Aufwallung von Zorn Platz. »Ich soll eine Pille schlucken, und dann wird alles gut, ja?« »Es könnte helfen, Bill. Ich muss einfach sicher sein können, dass du nicht irgendetwas Unvernünftiges tust.« »Du kannst mich mal.« Er stieß sich von der Kuppel ab und schwebte an ihr vorbei auf die Luke des Labors zu. »Bill!« »Wie du netterweise bereits erwähnt hast, habe ich zu tun.« »Ich habe doch gesagt, wir können deine Aufgaben unter uns aufteilen. Wenn du meinst, du schaffst es nicht …«, »Ich werde meine verdammte Arbeit selbst machen!« Er glitt in das US-Labor hinein. Erleichtert stellte er fest, dass sie ihm nicht folgte. Als er einen Blick zurück riskierte, sah er, wie sie in die Wohnkapsel schwebte. Zweifellos hatte sie vor, den Zustand des Crew Return Vehicle zu überprüfen. Das CRV, ausgelegt für die Evakuierung aller sechs Astronauten, war das einzige Rettungsboot, mit dem sie im Fall einer Katastrophe zur Erde zurückkehren konnten. Mit seiner beiläufigen Bemerkung, er könne sich mit dem CRV davonmachen, hatte er ihr einen gehörigen Schrecken eingejagt. Es tat ihm bereits Leid. Sie würde ihn nun ständig beobachten und sorgfältig auf Anzeichen eines bevorstehenden emotionalen GAUs achten. Es war schon qualvoll genug, in dieser besseren Sardinen- büchse dreihundert Kilometer über dem Erdboden festzusitzen; dabei auch noch argwöhnisch observiert zu werden, machte das Ganze nur schlimmer. Ja, er war von dem Wunsch besessen, nach Hause zurückzukehren, aber er war gewiss nicht psychisch labil. All die Jahre des Trainings, all die psychologischen Tests hatten nur die Tatsache bestätigt, dass Bill Haning ein Profi war – und gewiss kein Mann, der seine Kollegen in Gefahr bringen würde. Mit einer eingeübten Bewegung stieß er sich von der Wand ab und schwebte durch die Laborkapsel auf seinen Arbeitsplatz zu. Dort sah er die zahlreichen neu eingetroffenen E-Mails durch. In einem Punkt hatte Diana Recht gehabt: Die Arbeit würde ihn von seiner Sorge um Debbie ablenken. Die meisten Mails kamen vom Ames Biological Research Center der NASA in Kalifornien und betrafen Routineanfragen zur Bestätigung von Daten. Viele Experimente wurden von der Erde aus überwacht, und manchmal stellten die Wissenschaftler die Daten in Frage, die ihnen von der ISS geliefert wurden. Er ließ die Nachrichten über den Monitor laufen und verzog das Gesicht angesichts einer weiteren Bestellung von Urin- und Stuhlproben von den Astronauten. Er scrollte weiter und hielt, plötzlich inne, als eine neue Nachricht auf dem Bildschirm erschien. Das hier war etwas anderes. Die Mail kam nicht aus Arnes, sondern von einer privaten Firma, die Nutzlasten in den Weltraum schickte. Die Privatindustrie finanzierte verschiedene Experimente an Bord der Station, und so erhielt er des Öfteren E-Mails von Forschern außerhalb der NASA. Diese Nachricht stammte von SeaScience in La Jolla, Kalifornien. An: Dr. William Haning, ISS Biowissenschaften Absender: Helen Koenig, Wissenschaftliche Leiterin Betreff: Experiment CCU Nr. 23 (Archäen-Zellkultur) Nachricht: Die jüngsten uns übermittelten Daten deuten auf eine rapide und unerwartete Zunahme der Zellkulturmasse hin. Bitte um Überprüfung mittels Ihrer an Bord befindlichen Mikromassen-Messvorrichtung. Wir sollen also wieder mal nachsehen, wo ’s klemmt, dachte er gelangweilt. Viele Experimente im Orbit wurden durch Anweisungen von Wissenschaftlern auf der Erde gesteuert. Die Daten wurden in den verschiedenen Laborracks mit Hilfe von Videokameras und automatischen Vorrichtungen zur Gewinnung von Proben ermittelt, worauf die Ergebnisse per Satellit direkt an die Forscher auf der Erde geschickt wurden. Bei so viel High- Tech-Ausrüstung an Bord der ISS musste es dann und wann zu kleineren Störungen kommen. Das war der eigentliche Grund, weshalb man hier oben Menschen brauchte – um einzugreifen, wenn die launische Elektronik wieder mal versagte. Auf dem Nutzlast-Computer rief er die Datei für CCU Nr. 23 auf und überprüfte das Protokoll. Die Zellen in dieser Kultur waren Archäen, bakterienartige Meeresorganismen, die aus, hydrothermalen Spalten in der Tiefsee gewonnen wurden. Für Menschen waren sie harmlos. Er schwebte durch das Labor auf die Zellkulturanlage zu und schlüpfte mit den Füßen, an denen er nur Strümpfe trug, in die Haltegurte, um nicht wegzudriften. Die kastenförmige Apparatur besaß ein integriertes Leitungssystem, mit dem zwei Dutzend Zellkulturen und Gewebeproben ständig befeuchtet werden konnten. Die meisten Experimente liefen von selbst ohne jedes menschliche Zutun. In den vier Wochen, die er an Bord der ISS war, hatte Bill nur ein einziges Mal einen Blick auf den Behälter Nr. 23 geworfen. Er zog den Schubkasten mit den Zellproben heraus. Darin waren vierundzwanzig Röhrchen mit Kulturen im Kreis angeordnet. Er fand Nr. 23 und nahm das Röhrchen heraus. Er merkte sofort, dass etwas nicht stimmte. Der Deckel des Glasröhrchens war nach außen gewölbt, als stünde er unter Druck. Anstelle der erwarteten leicht eingetrübten Flüssigkeit sah er eine leuchtend blaugrün gefärbte Masse. Er drehte das Röhrchen auf den Kopf, aber die Kultur rührte sich nicht von der Stelle. Sie war nicht mehr flüssig, sondern viskos, beinahe fest. Er kalibrierte das Mikromassen-Messgerät und schob das Röhrchen in die dafür vorgesehene Aussparung. Einen Augenblick später tauchten die Daten auf dem Bildschirm auf. Irgendetwas ist hier absolut nicht in Ordnung, dachte er. Es hat irgendeine Verunreinigung gegeben. Entweder war die ursprüngliche Zellprobe nicht rein, oder ein anderer Organismus ist in das Röhrchen gelangt und hat die Primärkultur zerstört. Er tippte seine Antwort an Dr. Koenig: … Bestätige die Ihnen übermittelten Daten. Die Kultur ist offensichtlich drastisch verändert. Sie ist nicht mehr flüssig,, sondern scheint sich in eine gallertartige Masse verwandelt zu haben und weist jetzt eine kräftige, fast neonartige blaugrüne Färbung auf. Die Möglichkeit einer Verunreinigung muss in Betracht gezogen werden … Er hielt inne. Es gab noch eine andere Möglichkeit: die Auswirkungen der Mikrogravitation. Auf der Erde wuchsen Kulturen meist nur zweidimensional und breiteten sich in einer flachen Schicht am Boden des Behältnisses aus. Im Weltraum, befreit von der Wirkung der Schwerkraft, zeigten dieselben Kulturen ein verändertes Verhalten. Sie wuchsen dreidimensional und nahmen Formen an, die auf der Erde nie möglich wären. Wenn nun Nr. 23 gar nicht kontaminiert war? Wenn sich die Archäen ganz einfach so verhielten, weil keine Schwerkraft sie hemmte? Doch fast im gleichen Moment ließ er den Gedanken wieder fallen. Diese Veränderungen waren zu drastisch. Die Schwerelosigkeit konnte unmöglich einen einzelligen Organismus in diese höchst sonderbare grüne Masse verwandelt haben. Er schrieb: … Werde Ihnen mit dem nächsten Shuttleflug eine Probe von Kultur Nr. 23 senden. Bitte wenden Sie sich an mich, falls Sie weitere Instruktionen haben … Das plötzliche Klappern eines Schubkastens schreckte ihn auf. Er drehte sich um und sah Kenichi Hirai, der an seinem eigenen Laborrack zugange war. Das hartnäckige Schweigen dieses Mannes irritierte Bill. Kenichi war so etwas wie das Hausgespenst der Station; wortlos schlich er umher und erschreckte alle. Bill wusste, woran es lag: Kenichi war so unsicher, was sein Englisch betraf, dass er es vorzog, wenig oder, gar nichts zu sagen, um sich nicht zu blamieren. Wenigstens beim Hereinkommen hätte er »Hallo« rufen können, um die Nerven seiner fünf Kollegen ein bisschen zu schonen. Bill wandte seine Aufmerksamkeit wieder dem Röhrchen Nr. 23 zu. Wie diese gallertartige Masse wohl unter dem Mikroskop aussah? Er setzte den Behälter in den Plexiglas-Schutzkasten ein und steckte die Hände in die Handschuhe, die an den Rändern der beiden seitlichen Öffnungen befestigt waren. Falls etwas auslaufen sollte, würde aus dem Kasten jedenfalls nichts nach außen dringen. Flüssigkeiten, die sich im schwerelosen Raum frei ausbreiteten, konnten an den elektrischen Leitungen der Station großen Schaden anrichten. Vorsichtig löste er den Verschluss. Er wusste, dass der Inhalt unter Druck stand, die Wölbung des Deckels war deutlich zu sehen. Dennoch war er geschockt, als der Verschluss plötzlich wie ein Sektkorken herausschoss. Er zuckte zurück, als ein blaugrünes Klümpchen gegen die Innenseite des Kastens klatschte. Dort blieb es einen Moment lang zitternd wie ein lebendes Wesen hängen. Es war ja auch lebendig: eine Masse von Mikroorganismen, verbunden zu einer gallertartigen Matrix. »Bill, wir müssen uns unterhalten.« Die Stimme schreckte ihn auf. Rasch verschloss er den Kulturbehälter wieder und drehte sich um. Er sah sich Michael Griggs gegenüber, der soeben hereingekommen war. Direkt hinter ihm schwebte Diana. Die Weltraum-Schickeria, dachte Bill. Beide wirkten perfekt gestylt und athletisch in ihren marineblauen NASA-Hemden und ihren kobaltblauen Shorts. »Diana hat mir gesagt, dass du Probleme hast«, begann Griggs. »Wir haben gerade mit Houston gesprochen, und die sind der Meinung, du solltest es vielleicht mal mit Medikamenten versuchen. Nur damit du die nächsten paar Tage, durchstehst.« »Jetzt habt ihr es geschafft, dass die da unten sich Gedanken machen, was?« »Sie machen sich Sorgen um dich, wie wir alle.« »Hör mal, was ich da über das CRV gesagt habe, war purer Sarkasmus.« »Aber es macht uns nervös.« »Ich brauche kein Valium. Lasst mich einfach nur in Ruhe.« Er zog das Röhrchen aus dem Handschuhschutzkasten heraus und stellte es zurück an seinen Platz in der Zellkulturanlage. Er war jetzt zu aufgebracht, um daran weiterzuarbeiten. »Es ist unbedingt notwendig, dass wir dir vertrauen können, Bill. Wir sind hier oben alle aufeinander angewiesen.« Wütend drehte Bill sich um und sah ihn an. »Siehst du hier vielleicht einen tobsüchtigen Irren vor dir? Glaubst du das wirklich?« »Du denkst jetzt nur an deine Frau. Ich verstehe das. Und …« »Du verstehst das bestimmt nicht. Ich wage doch daran zu zweifeln, dass du zurzeit allzu viele Gedanken an deine Frau verschwendest.« Mit einem viel sagenden Blick in Dianas Richtung stieß er sich ab und schwebte durch die Laborkapsel in den Verbindungsknoten. Er wollte sich gerade in das Wohnmodul begeben, als er Luther erblickte, der dort mit der Vorbereitung für das Mittagessen beschäftigt war. Nirgendwo kann man sich verstecken. Nirgends ist man allein. Plötzlich schossen ihm die Tränen in die Augen, und er zog sich von der Luke in die Kuppel zurück. Er kehrte den anderen den Rücken zu und starrte durch das Fenster zur Erde hinunter. Schon tauchte wieder die amerikanische Pazifikküste auf. Noch ein Sonnenaufgang, noch ein Sonnenuntergang., Noch eine Ewigkeit des Wartens. Kenichi beobachtete, wie Griggs und Diana, angetrieben durch genau bemessene Stöße ihrer Beine, aus der Laborkapsel herausschwebten. Sie bewegten sich mit solcher Anmut, dass sie wie blonde Götter schienen. Er beobachtete sie oft, ohne dass sie es merkten. Besonders gerne schaute er Diana Estes an; diese Frau war von einer so vornehmen Blässe, dass sie fast durchscheinend wirkte. Nachdem sie fort waren, blieb er allein im Labor zurück. Jetzt konnte er sich entspannen. In der Station herrschte so viel Zwietracht. Das machte ihn nervös und beeinträchtigte seine Konzentration. Er war von Natur aus still und ruhig und arbeitete am liebsten allein. Er verstand zwar recht gut Englisch, doch das Sprechen bereitete ihm Mühe, sodass er es sehr anstrengend fand, sich mit den anderen zu unterhalten. Er fühlte sich wesentlich wohler, wenn er sich allein und in aller Stille seiner Arbeit widmen konnte, bei der ihm nur die Labortiere Gesellschaft leisteten. Durch das Sichtfenster warf er einen Blick auf die Mäuse im Versuchstierkomplex und lächelte. Auf der einen Seite des Trenngitters waren zwölf Männchen, auf der anderen zwölf Weibchen. Als kleiner Junge in Japan hatte er Kaninchen gezüchtet, und es hatte ihm Freude gemacht, sie im Schoß zuhalten und zu streicheln. Diese Mäuse waren allerdings keine Schoßtiere, sie waren streng von den Menschen in der Station isoliert. Ihre Atemluft wurde gefiltert und gereinigt, bevor sie sich mit der Luft in der Raumstation mischen konnte. Anfassen durfte man die Tiere nur durch den an ihre Käfige angrenzenden Handschuhkasten, in dem man mit sämtlichen biologischen Forschungsobjekten, angefangen von Bakterien bis hin zu Laborratten, hantieren konnte, ohne dass die Gefahr bestand, die Atemluft zu verunreinigen., Heute war Blutprobentag. Das Blutabnehmen gehörte nicht gerade zu seinen Lieblingsbeschäftigungen; es bereitete ihm Unbehagen, die Haut der Mäuse mit einer Nadel durchbohren zu müssen. Er murmelte auf Japanisch eine Entschuldigung, während er in die Handschuhe fuhr und die erste Maus in den isolierten Arbeitsbereich setzte. Sie zappelte und versuchte, sich seinem Zugriff zu entziehen. Er ließ sie wieder los, und sie schwebte frei umher, während er die Spritze vorbereitete. Es war ein erbarmungswürdiger Anblick, wie die Maus wild mit den Beinchen ruderte und sich vergeblich bemühte, von der Stelle zu kommen. Da sie sich nirgendwo abstoßen konnte, trieb sie hilflos in der Luft. Als die Spritze fertig war, griff er wieder nach der Maus, um sie einzufangen. Erst in diesem Moment bemerkte er das blaugrüne Tröpfchen, das neben der Maus schwebte. So dicht neben ihr, dass sie flugs ihre kleine rosa Zunge hervorschnellen ließ, um probehalber an dem Tröpfchen zu lecken. Kenichi lachte lauthals auf. Die Astronauten machten sich oft einen Spaß daraus, in der Luft schwebende Wassertropfen zu trinken, und genau das schien die Maus jetzt zu tun – sie vergnügte sich mit ihrem neuen Spielzeug. Dann kam ihm ein Gedanke: Wo war die blaugrüne Substanz eigentlich hergekommen? Bill hatte den Handschuhkasten benutzt. Wenn er nun eine toxische Substanz verschüttet hatte? Kenichi schwebte zum Computerarbeitsplatz hinüber und sah sich das Protokoll an, das Bill zuletzt aufgerufen hatte. Es war das Experiment CCU Nr. 23, eine Zellkultur. Das Protokoll gab ihm die Gewissheit, dass das Tröpfchen völlig ungefährlich war. Archäen waren harmlose einzellige Meeresorganismen, die keinerlei infektiöse Eigenschaften aufwiesen. Beruhigt kehrte er zur Handschuhbox zurück und steckte die Hände hinein. Er griff nach der Spritze., 16. Juli Wir haben keinen Empfang. Jack starrte zu der Wolke aus Abgasen empor, die sich über den azurblauen Himmel zog, und blankes Entsetzen bohrte sich wie ein Messer in sein Herz. Die Sonne brannte auf seinem Gesicht, und doch war der Schweiß, der es überzog, kalt wie Eis. Er suchte den Himmel ab. Wo war das Shuttle? Nur wenige Sekunden zuvor hatte er beobachtet, wie es in einem weiten Bogen in den wolkenlosen Himmel aufgestiegen war, hatte gespürt, wie der Boden unter dem Donner des Starts erbebt war. Und er hatte das Gefühl gehabt, dass sein Herz mit dem Raumschiff emporgeschossen war, vorangetrieben vom Tosen der Raketen, und seiner Bahn durch die Atmosphäre folgte, bis es nur noch ein glänzendes Pünktchen reflektierten Sonnenlichts war. Er konnte es nicht sehen. Was vor Sekunden noch eine lang gezogene weiße Wolke gewesen war, hatte sich in eine ausgefranste schwarze Rauchspur verwandelt. Voller Panik suchten seine Augen den Himmel ab und erfassten einen Schwindel erregenden Reigen von Bildern. Ein Feuer hoch oben in der Luft. Ein Teufelsdreizack aus Rauch. Trümmerfetzen, die ins Meer hinabstürzten. Wir haben keinen Empfang. Schweißgebadet und nach Luft ringend erwachte er. Es war taghell, und die Sonne schien brütend heiß durch sein Schlafzimmerfenster., Stöhnend setzte er sich auf die Bettkante und vergrub den Kopf in den Händen. Er hatte am Abend zuvor die Klimaanlage nicht eingeschaltet, und jetzt war das Zimmer wie ein Backofen. Er stand auf und ging hinüber, um sie einzuschalten. Dann ließ er sich wieder aufs Bett fallen und atmete erleichtert auf, als er den kühlen Luftstrom auf seiner Haut spürte. Wieder der alte Albtraum. Er rieb sich das Gesicht und versuchte die Bilder zu vertreiben, doch sie waren zu tief in sein Gedächtnis eingegraben. Es war sein erstes Jahr am College gewesen, als die Challenger explodiert war. Er war gerade durch den Aufenthaltsraum des Wohnheims gegangen, als die ersten Bilder der Katastrophe auf dem Fernsehschirm erschienen waren. An diesem und an den darauf folgenden Tagen hatte er sich die schrecklichen Aufnahmen immer wieder angesehen, hatte sie so tief in sein Unterbewusstsein aufgenommen, dass sie für ihn so wirklich geworden waren, als hätte er an jenem Morgen selbst auf der Zuschauertribüne in Cape Canaveral gestanden. Und jetzt war die Erinnerung in seinen Albträumen wieder lebendig geworden. Es ist wegen Emmas Start. In der Dusche hielt er den Kopf unter den harten, kalten Wasserstrahl und wartete darauf, dass die letzten Spuren seines Traums fortgespült wurden. Ab nächster Woche hatte er drei Wochen Urlaub, aber von Urlaubsstimmung konnte keine Rede sein. Er war seit Monaten nicht mehr mit dem Segelboot draußen gewesen. Vielleicht waren ein paar Wochen auf dem Wasser, weit weg von den grellen Lichtern der Stadt, tatsächlich die beste Therapie. Nur er selbst, das Meer und die Sterne. Wie lange war es her, dass er die Sterne zuletzt wirklich betrachtet hatte! In letzter Zeit schien er es bewusst zu vermeiden, ihnen auch nur einen Blick zu schenken. Als kleiner Junge hatte der Himmel eine magische Anziehungskraft auf ihn, ausgeübt. Seine Mutter hatte ihm einmal erzählt, er habe als kleines Kind eines Abends auf dem Rasen gestanden und beide Arme hoch in die Luft gereckt, weil er den Mond anfassen wollte. Als ihm das nicht gelungen war, hatte er vor Enttäuschung bitterlich geweint. Der Mond, die Sterne, die Schwärze des Weltraums – all das war für ihn jetzt unerreichbar, und er kam sich oft vor wie der kleine Junge, der er einmal gewesen war, die Arme in die Luft gestreckt und vor Enttäuschung weinend, weil seine Füße an den Boden gefesselt waren. Er drehte die Dusche ab, stützte sich mit beiden Händen gegen die Kacheln und hielt den Kopf gesenkt, während das Wasser aus seinen Haaren tropfte. Heute ist der sechzehnte Juli, dachte er. Noch acht Tage bis zu Emmas Flug. Er spürte, wie das Wasser seine Haut abkühlte. Innerhalb von zehn Minuten war er angezogen und saß in seinem Auto. Es war Dienstag. Emma und ihr neues Flugteam schlossen gerade ihre dreitägige integrierte Simulation ab; sie würde erschöpft sein und keine Lust haben, ihn zu sehen. Aber morgen war sie bereits auf dem Weg nach Cape Canaveral. Morgen konnte er sie nicht mehr erreichen. Am Johnson Space Center angekommen, stellte er den Wagen auf dem Parkplatz vor Bau 30 ab, hielt den Sicherheitsleuten seine NASA-Dienstmarke hin und lief die Treppe zum Shuttle- Flugkontrollraum hoch. Er fand eine Atmosphäre angespannter Stille vor. Die dreitägige integrierte Simulation war sowohl für die Astronauten als auch für das Team der Bodenkontrolle so etwas wie die letzte Prüfung – ein mit Zwischenfällen gespickter Durchlauf der gesamten Mission vom Start bis zur Landung. Es wurden die verschiedensten Funktionsstörungen eingebaut, damit jeder Einzelne ständig auf Draht blieb. Das Kontrollpersonal in diesem Raum hatte sich in den letzten drei, Tagen mehrmals in drei Schichten abgewechselt, und die zwei Dutzend Männer und Frauen, die jetzt an den Konsolen saßen, wirkten müde und abgekämpft. Der Abfalleimer quoll über von Kaffeebechern und Coladosen. Einige Controller sahen Jack und nickten ihm zu, doch für eine richtige Begrüßung war keine Zeit. Sie hatten es gerade mit einer ernsthaften Krise zu tun, und alle Aufmerksamkeit richtete sich auf dieses Problem. Es war das erste Mal seit Monaten, dass Jack dem Kontrollraum einen Besuch abstattete, und er spürte die alte Erregung, die elektrische Spannung, die diesen Raum zum Knistern brachte, wenn eine Mission anstand. Er ging zur dritten Konsolenreihe und stellte sich neben Flugdirektor Randy Carpenter, der im Moment zu beschäftigt war, um sich mit ihm zu unterhalten. Carpenter war so etwas wie der Hohepriester unter den Flugdirektoren des Shuttle- Programms. Mit seinen reichlich hundertzwanzig Kilo und dem üppigen Bauch, der über den Gürtel seiner Hose quoll, dominierte er den gesamten Kontrollraum. Breitbeinig saß er da, wie ein Kapitän auf der Brücke eines Schiffes in stürmischer See. In diesem Raum hatte Carpenter das Sagen. »Ich bin das beste Beispiel dafür, wie weit eine fette Brillenschlange es im Leben bringen kann«, pflegte er zu sagen. Anders als der legendäre Flugdirektor Gene Kranz, dessen Ausspruch »Ein Fehlschlag kommt nicht in Frage« ihn zum Medienhelden gemacht hatte, war Carpenter nur in den Reihen der NASA wohl bekannt. Sein wenig fotogenes Äußeres machte es sowieso unwahrscheinlich, dass er je zum Filmstar avancierte. Jack lauschte eine Weile den Gesprächen, die über das interne Kommunikationssystem geführt wurden, und konnte sich schon bald ein Bild von der Krise machen, mit der Carpenter es zu tun hatte. Genau das gleiche Problem war vor zwei Jahren in Jacks eigener integrierter Simulation aufgetaucht, als er noch dem Astronautenkorps angehört und sich auf die Mission STS 145 vorbereitet hatte. Die Shuttle-Crew hatte einen rapiden, Druckabfall in der Kapsel gemeldet, der auf ein Leck hindeutete, durch das die Luft sehr schnell ausströmte. Sie hatten keine Zeit gehabt, die Fehlerquelle ausfindig zu machen, sondern die Umlaufbahn vorzeitig verlassen müssen. Der Flugdynamik-Offizier, der in der vordersten, auch »Schützengraben« genannten Konsolenreihe saß, berechnete eilig verschiedene Flugbahnen, um den besten Landeplatz zu bestimmen. Niemand betrachtete das hier als ein Spiel; zu deutlich war allen bewusst, dass sieben Menschen in Lebensgefahr schweben würden, wäre diese Krise echt. »Kabinendruck auf neunhundertachtundfünfzig Hektopascal gefallen«, meldete die Umgebungskontrolle. »Edwards Air Force Base«, verkündete der Flugdynamik- Offizier. »Zeitpunkt des Aufsetzens voraussichtlich dreizehnhundert.« »Der Kabinendruck wird bei diesem Tempo auf vierhundertachtzig Hektopascal fallen«, sagte der Mann von der Umgebungskontrolle. »Schlage vor, dass sie jetzt gleich ihre Helme aufsetzen, bevor sie die Wiedereintritts-Sequenz einleiten.« Der Capcom, der für die Kommunikation mit der Kapsel zuständige Offizier, gab den Rat an die Atlantis weiter. »Verstanden«, antwortete Commander Vance. »Helme sind aufgesetzt. Wir leiten die Wiedereintritts-Zündung ein.« Gegen seinen Willen wurde Jack in das brisante Spiel hineingezogen. Während die Sekunden verstrichen, hielt er den Blick auf die zentrale Anzeigentafel an der Vorderwand des Kontrollraums geheftet, wo auf einer Weltkarte die Flugbahn des Raumtransporters dargestellt wurde. Auch wenn er wusste, dass alle diese Krisen der niederträchtigen Fantasie eines Simulationsteams entsprangen, hatte die grimmige Ernsthaftigkeit, mit der die Übung absolviert wurde, auf ihn abgefärbt. Er merkte kaum, wie sich seine Muskeln anspannten,, während er verfolgte, wie auf dem Bildschirm immer neue Daten aufleuchteten. Der Kabinendruck war auf vierhundertachtzig Hektopascal gefallen. Die Atlantis trat in die oberste Schicht der Atmosphäre ein. Sie befanden sich jetzt im Funkloch, der zwölfminütigen Phase beim Wiedereintritt, während derer die Luft um den Raumtransporter herum sich durch atmosphärische Reibung so ionisiert, dass jeglicher Funkverkehr abgeschnitten wird. »Atlantis, hören Sie mich?«, fragte der Capcom. Plötzlich war Commander Vance’ Stimme wieder da: »Wir hören Sie laut und deutlich, Houston.« Wenige Sekunden später legte die Kapsel eine perfekte Landung hin. Game over. Im Flugkontrollraum brandete Applaus auf. »Okay, Leute! Gute Arbeit!«, sagte Flugdirektor Carpenter. »Einsatzbesprechung um fünfzehnhundert. Jetzt ist erst mal Mittagspause.« Mit einem zufriedenen Lächeln nahm er den Kopfhörer ab und sah Jack zum ersten Mal an. »He, dich habe ich hier ja schon eine Ewigkeit nicht mehr gesehen.« »Ich hab bei den Zivilisten Doktor gespielt.« »Bist wohl auf die große Kohle aus, was?« Jack lachte. »Ja, ich weiß gar nicht wohin mit all dem Geld.« Er warf einen Blick auf die Controller, die es sich jetzt mit ihren Lunchpaketen an den Konsolen bequem machten. »Ist die Simulation gut gelaufen?« »Ich bin sehr zufrieden. Wir haben alle Klippen umschifft.« »Und die Shuttle-Crew?« »Ist bereit.« Carpenter warf ihm einen viel sagenden Blick zu. »Einschließlich Emma. Sie ist in ihrem Element, Jack, also bring sie bitte nicht durcheinander. Sie braucht jetzt ihre volle, Konzentration.« Das war mehr als nur ein freundlicher Hinweis. Es war eine Warnung: Behalt deine persönlichen Angelegenheiten für dich. Wehe, du kratzt an der Moral meiner Truppe. Jacks Stimmung war gedämpft, ja sogar etwas zerknirscht, als er draußen in der drückenden Hitze vor Bau 5, in dem sich die Flugsimulatoren befanden, auf Emma wartete. Sie kam zusammen mit dem Rest der Crew heraus. Offenbar hatte gerade jemand einen Witz gemacht, denn sie waren am Lachen. Dann fiel ihr Blick auf Jack, und ihr Lächeln verschwand. »Ich wusste nicht, dass du kommen würdest«, sagte sie. Er zuckte mit den Achseln und sagte verlegen: »Ich auch nicht.« »Einsatzbesprechung in zehn Minuten«, sagte Vance. »Ich komme«, erwiderte sie. »Geht schon mal vor.« Sie wartete, bis ihre Teamkollegen außer Hörweite waren, und wandte sich wieder Jack zu. »Ich muss wirklich gleich zu ihnen. Hör mal, ich weiß, dass dieser Start alles noch komplizierter macht. Wenn du wegen der Scheidungspapiere gekommen bist – ich verspreche dir, alles zu unterschreiben, sobald ich zurück bin.« »Ich bin nicht deswegen hier.« »Was gibt es denn?« Er schwieg einen Moment. »Tja, es ist wegen Humphrey. Wie heißt noch mal sein Tierarzt? Falls er ein Haarknäuel verschluckt oder so.« Sie sah ihn fragend an. »Derselbe wie immer. Dr. Goldsmith.« »Ach ja. Klar.« Sie standen eine Weile schweigend da. Die Sonne brannte auf sie herunter, und er spürte, wie ihm der Schweiß den Rücken hinunterlief. Plötzlich kam sie ihm so klein vor, so zerbrechlich. Und doch war diese Frau schon einmal aus einem Flugzeug, abgesprungen. Sie konnte ihn beim Reiten abhängen und ihn schwindlig tanzen. Seine schöne, furchtlose Frau. Sie drehte sich zu Bau 30 um, wo ihr Team auf sie wartete. »Ich muss gehen, Jack.« »Wann geht’s los Richtung Cape?« »Sechs Uhr morgens.« »Werden all deine Vettern und Cousinen zum Start kommen?« »Natürlich.« Sie schwieg einen Moment. »Du wirst nicht da sein, oder?« Der Challenger-Albtraum stand ihm noch klar und deutlich vor Augen – die unheilvollen Rauchfahnen, die sich am tiefblauen Himmel ausgebreitet hatten. Ich kann nicht da sein und zuschauen, dachte er. Ich ertrage es nicht, mir auszumalen, was passieren könnte. Er schüttelte den Kopf. Sie akzeptierte seine Antwort mit einem kühlen Nicken und einem Blick, der sagte: Ich kann genauso distanziert sein wie du. Schon zog sie sich von ihm zurück, wandte sich zum Gehen. »Emma.« Er griff nach ihrem Arm und zog sie sanft zu sich herum. »Du wirst mir fehlen.« Sie seufzte. »Ja, sicher, Jack.« »Ich meine es ernst.« »Wochenlang rufst du mich kein einziges Mal an. Und jetzt sagst du, ich werde dir fehlen.« Sie lachte. Die Bitterkeit in ihrer Stimme traf ihn wie ein Stich. Und die Wahrheit dessen, was sie gesagt hatte. In den letzten Monaten war er ihr tatsächlich aus dem Weg gegangen. Es hatte ihm wehgetan, in ihrer Nähe zu sein, denn ihr Erfolg ließ ihn sein eigenes Versagen nur umso deutlicher empfinden. Es gab keine Hoffnung auf Versöhnung. Das erkannte er schon an dem kalten Blick, mit dem sie ihn jetzt ansah. Es blieb nichts weiter übrig, als sich mit Anstand aus der Affäre zu ziehen., Er wandte sich ab; er brachte es einfach nicht mehr fertig, ihr in die Augen zu schauen. »Ich bin nur gekommen, um dir einen guten Flug zu wünschen. Und viel Spaß da oben. Wink mir zu, wenn du über Houston fliegst. Ich halte nach dir Ausschau.« Die ISS würde aussehen wie ein Stern, der über den Himmel rast, heller als die Venus. »Du winkst aber zurück, okay?« Jetzt brachten beide ein Lächeln zustande. Sie würden also doch wie zivilisierte Menschen auseinander gehen. Er breitete die Arme aus, und sie trat einen Schritt näher, damit er sie an sich drücken konnte. Es war eine kurze und unbeholfene Umarmung, als seien sie Fremde, die sich zum ersten Mal begegneten. Er spürte, wie sich ihr Körper an den seinen presste, so warm, so lebendig. Dann riss sie sich los und ging auf das Bodenkontrollgebäude zu. Sie blieb nur einmal stehen, um ihm zum Abschied zuzuwinken. Die Sonne schien ihm direkt in die Augen, und durch seine halb geschlossenen Lider erkannte er sie nur als dunkle Silhouette. Der heiße Wind spielte in ihren Haaren, und er wusste, dass er sie noch nie so sehr geliebt hatte wie in diesem Moment, als er dastand und ihr nachschaute, bis sie in dem Gebäude verschwunden war. 19. Juli Cape Canaveral Selbst auf diese Entfernung raubte der Anblick Emma den Atem. Dort auf der Startrampe 39B ragte, in grelles Flutlicht getaucht, das Space-Shuttle Atlantis mit seinem riesigen orangefarbenen Treibstofftank und den beiden seitlich montierten Feststoffraketen wie ein mächtiger Leuchtturm in den Nachthimmel. Ganz gleich, wie oft sie es schon erlebt hatte – dieser erste Anblick des hell erleuchteten Shuttle auf seiner Startrampe flößte ihr immer wieder ein Gefühl ehrfürchtiger, Scheu ein. Die anderen Crewmitglieder, die neben ihr auf dem Asphalt standen, waren ebenso schweigsam. Damit sich ihr Schlafrhythmus verschob, waren sie an diesem Morgen um zwei Uhr geweckt worden. Anschließend hatten sie ihr Quartier im oberen Stockwerk des Test- und Montagegebäudes verlassen, um einen Blick auf den Moloch zu werfen, der sie in den Weltraum transportieren würde. Emma hörte den Schrei eines Nachtvogels und spürte die kühle, frische Brise, die vom Golf her wehte und den brackigen Geruch der nahen Feuchtgebiete vertrieb. »Da fühlt man sich irgendwie ganz klein, was?«, meinte Commander Vance in seinem weichen Texaner-Akzent. Zustimmendes Gemurmel war die Antwort. »Klein wie ’ne Ameise«, sagte Chenoweth, das einzige Greenhorn in der Crew Dies würde sein erster Shuttleflug sein, und er war so aufgeregt, dass er ein eigenes elektrisches Feld um sich herum zu erzeugen schien. »Ich vergesse immer wieder, wie riesig es ist, und dann schau ich noch mal hin und denke, Junge, was für eine geballte Kraft. Und ich bin der Glückspilz, der mit dem Ding da fliegen darf.« Alle lachten, doch es war ein unterdrücktes, beklommenes Lachen, wie in einer Kirche. »Ich hätte nie gedacht, dass eine Woche so lang sein könnte«, meinte Chenoweth. »Der Mann hat sein Jungfrauendasein wirklich satt«, bemerkte Vance. »Und ob ich es satt habe. Ich will endlich da rauf.« Sehnsüchtig blickte Chenoweth zum Himmel hinauf. Zu den Sternen. »Ihr kennt das Geheimnis schon, und ich kann es kaum erwarten, eingeweiht zu werden.«, Das Geheimnis. Es war das Privileg der wenigen Auserwählten, die schon einmal oben gewesen waren. Dieses Geheimnis konnte man nicht weitergeben; jeder musste es selbst erleben, musste mit eigenen Augen die Schwärze des Alls erblicken und die blaue Kugel der Erde unten in der Tiefe. Das Gefühl, wenn der Schub der Raketen dich tief in den Sitz hineindrückt. Astronauten, die aus dem Weltraum zurückkehren, sind oft an ihrem wissenden Lächeln zu erkennen, an ihrer Miene, die sagt: Ich habe eine Erfahrung gemacht, die nur wenigen Menschen je zuteil wird. Auch Emma hatte so gelächelt, als sie vor über zwei Jahren aus der Luke der Atlantis ausgestiegen war. Mit zitternden Knien war sie hinaus in den Sonnenschein getreten und hatte in den unglaublich blauen Himmel gestarrt. In den acht Tagen an Bord des Raumtransporters hatte sie hundertdreißig Sonnenaufgänge erlebt, hatte Waldbrände in Brasilien beobachtet und in das Auge eines Wirbelsturms über Samoa geblickt; sie hatte eine Erde gesehen, die ihr ungeheuer zerbrechlich vorgekommen war. Sie war als völlig anderer Mensch zurückgekommen. In fünf Tagen würde Chenoweth das Geheimnis mit ihnen teilen, falls keine Katastrophe dazwischenkam. »Es wird Zeit, dass diese Netzhäute ein bisschen Licht abbekommen«, meinte Chenoweth. »Mein Gehirn ist immer noch der Meinung, es wäre tiefste Nacht.« »Es ist tiefste Nacht«, korrigierte Emma. »Für uns ist es kurz vor Sonnenaufgang, Leute«, sagte Vance. Von allen im Team hatte er seinen Tag-Nacht-Rhythmus am schnellsten an den neuen Zeitplan angepasst. Jetzt schritt er entschlossen auf das Test- und Montagegebäude zu, um einen kompletten Arbeitstag zu beginnen – und das um drei Uhr morgens. Die anderen folgten ihm. Nur Emma blieb noch einen Moment, draußen und blickte zum Shuttle hinüber. Am Tag zuvor waren sie zur Startrampe hinausgefahren, um ein letztes Mal das Vorgehen im Fall einer Evakuierung durchzugehen. Im Sonnenschein und aus der Nähe betrachtet war das Shuttle ihr blendend hell erschienen, viel zu gewaltig, um es voll erfassen zu können. Man konnte sich immer nur auf einen bestimmten Teil konzentrieren. Die Nase. Die Flügel. Die schwarzen Platten der Hülle, die aussahen wie Schuppen auf dem Bauch eines Reptils. Im Tageslicht hatte das Shuttle echt gewirkt, irgendwie handfest. Jetzt, hell erleuchtet vor dem Hintergrund des Nachthimmels, sah es aus, als sei es nicht von dieser Welt. Während der hektischen Vorbereitungszeit hatte Emma einfach keine unguten Gefühle in sich aufkommen lassen. Entschlossen hatte sie sämtliche Bedenken unterdrückt. Sie war bereit zu fliegen. Sie wollte fliegen. Doch jetzt verspürte sie einen Anflug von Angst. Sie blickte zum Himmel empor und sah die Sterne hinter einem vorrückenden Wolkenband verschwinden. Ein Wetterumschwung stand unmittelbar bevor. Es überlief sie kalt, und sie drehte sich um und ging in das Gebäude zurück. Dorthin, wo es hell war. 23. Juli Houston Ein halbes Dutzend Schläuche schlängelten sich in Debbie Hanings Körper. In ihrem Hals steckte eine Tracheotomiekanüle, durch die Sauerstoff in ihre Lungen gepumpt wurde. Ein Schlauch war durch ihr linkes Nasenloch eingeführt und über die Speiseröhre in den Magen geschoben worden. Ein Katheter leitete den Urin ab, und durch zwei intravenöse Katheter sickerten diverse Flüssigkeiten in ihre Venen. An ihrem Handgelenk war ein arterieller Zugang gelegt worden, und über den Oszillographen flimmerten ständig ihre, Blutdruckwerte. Jack warf einen Blick auf die Infusionsbeutel, die über ihrem Bett hingen, und sah, dass sie starke Antibiotika enthielten. Ein schlechtes Zeichen, es bedeutete, dass sie sich eine Infektion zugezogen hatte – nicht ungewöhnlich bei einer Patientin, die seit zwei Wochen im Koma lag. Jede Verletzung der Haut, jeder Plastikschlauch konnte als Einfallstor für Bakterien dienen, und in Debbies Blutbahnen tobte jetzt eine heftige Schlacht. Das alles erfasste Jack mit einem Blick, doch Debbies Mutter, die am Bett saß und die Hand ihrer Tochter hielt, sagte er nichts davon. Debbies Gesichtshaut war schlaff, ihr Unterkiefer hing herab, und ihre Augenlider waren nur halb geschlossen. Sie lag immer noch in einem tiefen Koma, in dem sie nichts wahrnahm, nicht einmal Schmerzen. Margaret blickte auf, als Jack das Abteil betrat, und begrüßte ihn mit einem Nicken. »Sie hatte eine schlimme Nacht«, sagte Margaret. »Sie hat Fieber, und sie wissen nicht, wo es herkommt.« »Die Antibiotika werden ihr helfen.« »Und dann? Wir behandeln die Infektion, aber was passiert danach?« Margaret holte tief Luft. »Sie würde das nicht wollen. All diese Schläuche. All diese Nadeln. Sie würde wollen, dass wir sie loslassen.« »Es ist zu früh, um vom Aufgeben zu sprechen. Ihr EEG ist noch aktiv. Sie ist nicht hirntot.« »Und warum wacht sie dann nicht auf?« »Sie ist jung. Sie hat ihr Leben noch vor sich.« »Das ist doch kein Leben!« Margaret sah auf die Hand ihrer Tochter. Sie war blau geschwollen von den Einstichen und Kanülen. »Als ihr Vater im Sterben lag, hat Debbie mir gesagt, sie würde nie so enden wollen. Ans Bett gefesselt und durch Schläuche ernährt. Ich muss immer wieder daran denken – an das, was sie gesagt hat …« Margaret sah wieder auf. »Was, würden Sie tun, wenn sie Ihre Frau wäre?« »Ich würde nie auf die Idee kommen, aufzugeben.« »Selbst wenn sie Ihnen gesagt hätte, dass sie nicht so enden wollte?« Er dachte einen Augenblick nach. Dann sagte er voller Überzeugung: »Am Ende wäre es doch meine Entscheidung. Egal, was sie oder sonst jemand mir gesagt hätte. Ich würde nie einen Menschen aufgeben, den ich liebe. Niemals. Nicht, solange ich noch die geringste Chance hätte, diesen Menschen zu retten.« Seine Worte waren kein Trost für Margaret. Er hatte nicht das Recht, ihre Überzeugungen in Frage zu stellen, das, was sie instinktiv für richtig hielt. Doch sie hatte ihn nach seiner Meinung gefragt, und er hatte mit dem Herzen und nicht mit dem Kopf geantwortet. Er fühlte sich plötzlich schuldig. Verlegen klopfte er Margaret auf die Schulter und ließ sie mit ihrer Tochter allein. Sehr wahrscheinlich würde die Natur ihnen die Entscheidung abnehmen. Eine komatöse Patientin mit einer systemischen Infektion steht bereits an der Schwelle des Todes. Niedergeschlagen verließ er die Intensivstation und trat in den Aufzug. Was für eine deprimierende Art, seinen Urlaub zu beginnen. Als Erstes, beschloss er, als er im Erdgeschoss ausstieg, würde er sich im Laden an der Ecke ein Sechserpack Bier kaufen. Genau das brauchte er jetzt: ein eisgekühltes Bier, und dann den Nachmittag mit dem Beladen des Segelboots verbringen. Das würde ihn von Debbie Haning ablenken. »Code Blau, chirurgische Intensivstation. Code Blau, chirurgische Intensivstation.« Die Durchsage aus der Lautsprecheranlage ließ ihn auffahren. Debbie, dachte er und rannte zum Treppenhaus. In ihrem Abteil auf der Intensivstation drängte sich bereits das, Personal. Er bahnte sich einen Weg hinein und warf sofort einen Blick auf den Monitor. Kammerflimmern! Ihr Herz war nur noch ein zitterndes Muskelbündel, unfähig zu pumpen, unfähig, ihr Gehirn am Leben zu halten. »Eine Ampulle Adrenalin läuft!«, rief eine der Schwestern. »Alles zurück!«, befahl ein Arzt, während er die Defibrillator- Platten auf Debbies Brust legte. Jack sah, wie der Körper sich aufbäumte, als der Defibrillator sich entlud, und wie das EKG ausschlug, nur um sogleich wieder auf die Grundlinie zurückzufallen. Immer noch Kammerflimmern. Eine Schwester verabreichte der Patientin eine Herzmassage; ihr kurzes blondes Haar wippte im Rhythmus der Pumpbewegungen auf und ab. Debbies Neurologe, Dr. Salomon, stand neben dem Bett und sah auf, als Jack zu ihm trat. »Ist das Amiodaron drin?«, fragte Jack. »Läuft schon, aber es wirkt anscheinend nicht.« Jack sah wieder nach der Herzstromkurve. Die Wellen des Kammerflimmerns wurden immer feiner. Sie näherten sich einer flachen Linie. »Wir haben sie schon viermal geschockt«, sagte Salomon. »Wir bekommen einfach keinen Rhythmus.« »Adrenalin intrakardial?« »Jetzt hilft sowieso nur noch Beten. Machen Sie nur.« Die Schwester bereitete die Adrenalin-Injektion und reichte Jack die Spritze mit der langen Herzkanüle. In dem Moment, als er danach griff, wusste Jack, dass die Schlacht im Grunde verloren war. Diese Maßnahme würde nichts bewirken. Aber er dachte an Bill Haning, der darauf brannte, zu seiner Frau heimzukehren. Und er dachte daran, was er vor wenigen Minuten zu Margaret gesagt hatte. Ich würde nie einen Menschen aufgeben, den ich liebe., Niemals. Nicht, solange ich noch die geringste Chance hätte, diesen Menschen zu retten. Er sah auf Debbie hinunter, und für einen irritierenden Moment zog das Bild von Emmas Gesicht vor seinem geistigen Auge vorüber. Er schluckte schwer und sagte: »Massage unterbrechen.« Die Schwester nahm die Hände von Debbies Brust. Jack desinfizierte rasch die Haut und setzte unterhalb des Schwertfortsatzes am unteren Ende des Brustbeins die Nadel an. Sein eigener Puls jagte, als er die Haut durchbohrte. Mit sanftem Druck führte er die Kanüle in die Brusthöhle ein. Ein Blutschwall verriet ihm, dass er im Herzen war. Mit einem Druck auf den Kolben injizierte er die gesamte Dosis Adrenalin und zog die Spritze heraus. »Herzmassage wieder aufnehmen«, sagte er und sah nach dem EKG-Monitor. Komm jetzt, Debbie. Kämpf schon, verdammt noch mal. Lass uns nicht im Stich. Lass Bill nicht im Stich. Es war still im Raum, alle Blicke waren auf den Monitor gerichtet. Das EKG flatterte, Zelle für Zelle starb das Herzmuskelgewebe ab. Niemand musste ein Wort sagen, das Scheitern stand ihnen allen ins Gesicht geschrieben. Sie ist so jung, dachte Jack. Sechsunddreißig Jahre. Genauso alt wie Emma. Es war Dr. Salomon, der die Entscheidung traf. »Lassen wir es gut sein«, sagte er leise. »Todeszeitpunkt elf Uhr fünfzehn.« Die Schwester, die die Herzmassage durchgeführt hatte, trat mit ernster Miene einen Schritt zurück. Im grellen Licht der Intensivstation sah Debbies blasser Oberkörper aus wie aus Plastik. Wie eine Schaufensterpuppe. Nicht mehr die fröhliche, lebhafte Frau, die Jack fünf Jahre zuvor bei einer NASA-Party unter dem Sternenhimmel kennen gelernt hatte. Margaret trat ein. Einen Augenblick stand sie schweigend da,, als erkenne sie ihre eigene Tochter nicht. Dr. Salomon legte ihr die Hand auf die Schulter und sagte leise: »Es ging alles so schnell. Wir konnten nichts mehr für sie tun.« »Er hätte hier sein sollen«, sagte Margaret mit brechender Stimme. »Wir haben versucht, sie am Leben zu halten«, erwiderte Dr. Salomon. »Es tut mir Leid.« »Mir tut es Leid für Bill«, sagte Margaret. Sie nahm die Hand ihrer Tochter und küsste sie. »Er wollte so gerne hier sein. Das wird er sich nie verzeihen.« Jack verließ das Abteil und ließ sich in der Schwesternstation auf einen Stuhl sinken. Margarets Worte klangen ihm noch in den Ohren. Er hätte hier sein sollen. Das wird er sich nie verzeihen. Sein Blick fiel auf das Telefon. Und was mache ich eigentlich noch hier?, fragte er sich. Er nahm sich die Gelben Seiten vom Schreibtisch der Stationsschwester, hob den Hörer ab und wählte eine Nummer. »Hier Lone Star Travel«, antwortete eine Frauenstimme. »Ich muss nach Cape Canaveral.«, Cape Canaveral Durch das offene Fenster des Mietwagens atmete Jack die feuchte Luft von Merritt Island ein und roch die Dschungeldüfte nach regennasser Erde und Vegetation. Der Zufahrtsweg zum Kennedy Space Center war eine überraschend ländliche Straße, die durch Orangenhaine und vorbei an schäbigen Doughnut- buden und von Unkraut überwucherten Schrottplätzen voller ausrangierter Raketenteile führte. Das Tageslicht wurde schon schwächer, und vor sich erblickte er die Rücklichter von Hunderten von Autos. Der Verkehr staute sich, und schon bald würde er mit seinem Wagen in einer Schlange von Touristen stecken, alle auf der Suche nach einem Parkplatz, von dem aus sie am Morgen den Start beobachten konnten. Es hatte keinen Zweck, sich durch dieses Chaos hindurch- zukämpfen. Er sah auch keinen Sinn darin, es durch Port Canaveral zu versuchen. Um diese Zeit schliefen die Astronauten sowieso. Er war zu spät dran, um auf Wiedersehen zu sagen. Er bog von der Straße ab, wendete und fuhr zurück zum Highway A1A in Richtung Cocoa Beach. Schon seit den Tagen Alan Shepards und der legendären sieben Mercury-Helden war Cocoa Beach die Vergnügungsmeile der Astronauten, eine Ansammlung etwas zwielichtiger Hotels, Bars und T-Shirt-Läden auf einer schmalen Landzunge zwischen dem Banana River im Westen und dem Atlantik im Osten. Jack kannte das Viertel gut, vom Tokyo Steak House bis zur Moon Shot Bar. Einmal war er denselben Strand entlanggejoggt, an dem John Glenn zu laufen pflegte. Es, war erst zwei Jahre her, dass er am Jetty Park gestanden und über den Banana River hinweg zur Startrampe 39A geblickt hatte. Zu seinem Shuttle, dem Vogel, der ihn in den Weltraum tragen sollte. Die Erinnerungen waren immer noch von Schmerzen getrübt. Der Dauerlauf am Strand an einem brütend heißen Nachmittag. Der plötzliche, unerträgliche Schmerz in seiner Seite, so ungeheuer heftig, dass es ihn in die Knie gezwungen hatte. Und dann, durch den Schleier der Narkose, das ernste Gesicht seines Flugarztes, der ihm die Nachricht überbracht hatte. Ein Nierenstein. Man schloss ihn von der Mission aus. Schlimmer noch, seine Zukunft in der Raumfahrt stand auf dem Spiel. Nierensteine gehörten zu den wenigen Leiden, die für einen Astronauten ein permanentes Flugverbot zur Folge haben konnten. Die Mikrogravitation bewirkt physiologische Verschiebungen in den Körperflüssigkeiten, was Dehydration zur Folge hat und dazu führt, dass die Knochen Kalzium ausscheiden. Diese beiden Faktoren zusammen erhöhen das Risiko einer erneuten Nierensteinbildung während eines Aufenthalts im All – ein Risiko, das die NASA nicht eingehen wollte. Obwohl er weiterhin dem Astronautenkorps angehörte, war Jack praktisch zum Bodendienst verdonnert. Er war, in der Hoffnung, noch einmal an einer Mission teilnehmen zu dürfen, noch ein Jahr dabeigeblieben. Doch sein Name war nie mehr auf einer Besatzungsliste erschienen. Er war zu einem Geisterastronauten geworden, dazu verdammt, auf der Suche nach einer Mission ohne Unterlass durch die Flure des JSC zu wandern. Zurück zur Gegenwart. Er war nun wieder in Canaveral, doch nicht als Astronaut, sondern nur als einer der vielen Touristen, die die A1A bevölkerten, hungrig, missgestimmt und ohne Ziel. Alle Hotels in einem Umkreis von sechzig Kilometern waren ausgebucht, und er war müde vom Fahren. Er fuhr auf den Parkplatz des Hilton Hotel und steuerte die Bar, an. Der Laden war gehörig aufgemotzt worden, seit er das letzte Mal hier gewesen war. Neuer Teppich, neue Barhocker, Blumenampeln mit Farnen unter der Decke. Früher war es ein eher schäbiges Lokal gewesen, ein heruntergekommenes Hilton an einer heruntergekommenen Touristenmeile. Am Cocoa Beach gab es keine Vier-Sterne-Hotels. Das hier war die luxuriöseste Unterkunft weit und breit. Er bestellte einen Scotch mit Wasser und richtete den Blick auf den Fernseher über der Bar. Der offizielle NASA-Kanal war eingestellt, und auf dem Bildschirm war das Shuttle Atlantis zu sehen, in gleißendes Flutlicht getaucht und umhüllt von gespenstischen Dunstschwaden. Emmas Taxi ins Weltall. Er starrte das Bild an und dachte an die Millionen von Drähten im Innern dieses Rumpfes, an die zahllosen Schalter und Datenbusse, die Schrauben, Nahtstellen und Dichtungen. Millionen von Dingen, die schief gehen konnten. Es war ein Wunder, dass so selten wirklich etwas schief ging. Dass der Mensch in all seiner Unvollkommenheit ein Raumfahrzeug von solcher Zuverlässigkeit entwerfen und bauen konnte und dass sieben Menschen bereit waren, sich darin festschnallen zu lassen. Bitte, lieber Gott, lass diesen Start einen von der perfekten Sorte sein. Von der Sorte, bei der jeder Einzelne seinen Job ordentlich erledigt hat und keine Schraube locker ist. Es muss ein perfekter Start sein, denn meine Emma wird an Bord sein. Eine Frau setzte sich neben ihn auf den Hocker und sagte: »Ich wüsste zu gerne, was die jetzt gerade denken.« Er sah sie an, und ein flüchtiger Blick auf ein Stück nackten Oberschenkel weckte für einen Moment sein Interesse. Sie war eine geschmeidige, sonnengebräunte Blondine mit einem dieser nichts sagenden Schaufensterpuppengesichter, die man nach einer Stunde schon wieder vergessen hat. »Was wer gerade, denkt?«, fragte er. »Die Astronauten. Ich frage mich, ob sie denken: ›O Scheiße, worauf habe ich mich da bloß eingelassen?‹« Er zuckte mit den Achseln und nippte an seinem Scotch. »Im Moment denken sie gar nichts. Sie schlafen nämlich.« »An ihrer Stelle könnte ich jetzt gar nicht schlafen.« »Ihr Tag-Nacht-Rhythmus ist total umgestellt. Sie sind wahrscheinlich vor zwei Stunden zu Bett gegangen.« »Nein, ich meine, ich würde überhaupt nicht schlafen. Ich würde wach liegen und mir überlegen, wie ich da wieder rauskäme.« Er lachte. »Ich schwöre Ihnen, wenn die wach sind, dann nur, weil sie es nicht abwarten können, in dieses Ding zu steigen und loszudüsen.« Sie beäugte ihn neugierig. »Sie gehören zum Programm, nicht wahr?« »Früher mal. Astronautenkorps.« »Jetzt nicht mehr?« Er hob das Glas an die Lippen und spürte, wie die Eiswürfel an seine Schneidezähne stießen. »Ich bin im Ruhestand.« Er stellte das leere Glas ab, und beim Aufstehen sah er einen Funken Enttäuschung in den Augen der Frau aufblitzen. Er erlaubte sich, ein paar kurze Gedanken daran zu verschwenden, wie der Rest des Abends aussehen könnte, wenn er blieb und die Unterhaltung fortsetzte. Angenehme Gesellschaft. Die Aussicht auf mehr. Stattdessen zahlte er und verließ das Hilton. Um Mitternacht stand er am Strand von Jetty Park und starrte über das Wasser auf die Startrampe 39B. Ich bin hier, dachte er. Auch wenn du es nicht weißt – ich bin bei dir. Er setzte sich in den Sand und wartete auf die Morgendämmerung., 24. Juli Houston »Über dem Golf liegt ein Hochdrucksystem, das voraussichtlich für klaren Himmel über Cape Canaveral sorgen wird. Eine RTLS-Landung ist also drin. Edwards Air Force Base meldet leichte Bewölkung, die sich aber bis zum Start verzogen haben dürfte. Der TAL in Saragossa, Spanien, ist bereit und voraussichtlich klar, ebenso der TAL in Morón, Spanien. Ben Guerir in Marokko meldet starke Windböen und Sandstürme und kommt derzeit nicht als TAL in Frage.« Der erste Wetterbericht des Tages, der zeitgleich nach Cape Canaveral übertragen wurde, brachte gute Neuigkeiten. Flugdirektor Carpenter war zufrieden. Der Start war nicht gefährdet. Die schlechten Landebedingungen am Flughafen Ben Guerir war kein Anlass zu großer Besorgnis, da die beiden anderen transatlantischen Landeplätze in Spanien klar waren. Es waren sowieso nur Alternativen für den Fall, dass andere Alternativen nicht machbar sein sollten; man würde die Landeplätze nur bei einem schwerwiegenden technischen Versagen benötigen. Er warf einen Blick in die Runde seiner Teamkollegen, um zu sehen, ob es irgendwelche neuen Schwierigkeiten gab. Die nervöse Anspannung im Flugkontrollraum war mit Händen zu greifen, und sie stieg weiter an, wie stets vor einem Start – und das war gut so. Der Tag, an dem sie nicht angespannt waren, war der Tag, an dem sie Fehler machten. Carpenter wollte seine Leute so auf Draht sehen, dass die Synapsen nur so glühten – ein Grad von Wachsamkeit, der um diese mitternächtliche Stunde eine Extradosis Adrenalin erforderte. Carpenters Nerven waren ebenso gespannt wie die der anderen, ungeachtet der Tatsache, dass der Countdown genau nach Plan verlief. Das Inspektionsteam in Kennedy hatte seine Kontrollen abgeschlossen. Das Team der Flugdynamik hatte die, Startzeit auf die Sekunde bestätigt. Inzwischen beobachteten Tausende von Beteiligten an weit voneinander entfernten Orten die gleiche Countdown-Uhr. In Cape Canaveral, wo das Shuttle startbereit auf der Rampe stand, baute sich im Startkontrollzentrum derweil eine ähnliche Spannung auf. Ein Parallelteam saß hier im so genannten Firing Room an den Konsolen und bereitete den Start vor. Sobald die Feststoffraketen gezündet waren, würde die Bodenkontrolle in Houston übernehmen. Obwohl Tausende von Kilometern dazwischen lagen, verband die beiden Kontrollräume in Houston und in Canaveral ein so dichtes Kommunikationsnetz, dass sie sich ebenso gut im selben Gebäude hätten befinden können. Im Marshall Space Flight Center in Huntsville, Alabama, warteten die Forschungsteams darauf, dass ihre Experimente in den Weltraum geschossen wurden. Zweihundertfünfzig Kilometer nord-nordöstlich von Cape Canaveral kreuzten Schiffe der Navy im Atlantik und bereiteten sich darauf vor, die Feststoffraketen, die sich nach dem Ausbrennen vom Shuttle lösen würden, aus dem Wasser zu fischen. An den Notlandeplätzen und Beobachtungsstationen in aller Welt, vom Luftwaffenstützpunkt NORAD in Colorado bis zum Internationalen Flughafen Banjul in Gambia, waren die Blicke von Männern und Frauen auf die Uhr gerichtet. Und in diesem Augenblick schicken sich sieben Menschen an, uns ihr Leben anzuvertrauen. Jetzt sah Carpenter die Astronauten auf dem internen Fernsehmonitor. Mitarbeiter des Bodenteams halfen ihnen gerade in ihre orangefarbenen Druckanzüge. Die Bilder kamen live aus Florida, jedoch ohne Ton. Carpenter hielt einen Moment inne und versuchte, in ihren Gesichtern zu lesen. Obwohl keiner von ihnen die geringste Spur von Angst erkennen ließ, wusste, er, dass die Angst da war, irgendwo hinter den strahlenden Mienen. Der rasende Puls, der Kick der Nervosität. Sie kannten die Risiken, und sie mussten einfach Angst haben. Sie auf dem Bildschirm zu sehen brachte dem Bodenpersonal noch einmal mit aller Deutlichkeit zu Bewusstsein, dass hier sieben Menschen waren, die sich hundertprozentig auf sie verließen. Carpenter riss sich vom Bildschirm los und richtete seine Aufmerksamkeit wieder auf sein Team von Controllern, das die sechzehn Konsolen besetzte. Obwohl er alle Mitglieder des Teams beim Namen kannte, redete er sie mit ihren Funktionsbezeichnungen an, wobei er die Titel wie im NASA- Jargon üblich zu griffigen Rufnamen abkürzte. So hörte der Führungsoffizier oder Guidance Officer auf das Kürzel »GDO«, der für die Kommunikation mit der Raumkapsel zuständige Offizier war »Capcom«, und der Ingenieur für die Antriebs- systeme hieß »Prop«. Die Flugbahn berechnete der Offizier mit dem hübschen Spitznamen »Traj«, und der Flugarzt hieß einfach »Surgeon«. Carpenter selbst wurde von seinen Leuten »Flight« gerufen. Wie vorgesehen wurde der Countdown bei T minus drei Stunden unterbrochen. Die Mission war immer noch klar zum Start. Carpenter steckte die Hand in die Hosentasche und klimperte einmal kurz mit seinem Kleeblatt-Schlüsselanhänger. Es war sein heimlicher Glücksbringer. Selbst Ingenieure sind manchmal abergläubisch. Dass mir nur ja nichts schief geht, dachte er. Nicht während ich Dienst habe. Cape Canaveral Die Fahrt im Astrovan vom Test- und Montagegebäude zur Startrampe 39B dauerte fünfzehn Minuten. Im Bus herrschte, eine auffallende Stille; der ganzen Crew schien es die Sprache verschlagen zu haben. Eine halbe Stunde zuvor, beim Anlegen der Anzüge, hatten sie noch Witze gerissen und gelacht, alles in dem scharfen, elektrisierten Ton, der charakteristisch ist für solche Momente, in denen die Nerven vor Aufregung bloß liegen. Die Spannung war kontinuierlich angestiegen, seit sie um zwei Uhr dreißig geweckt worden waren und das traditionelle Frühstück aus Steak und Eiern verzehrt hatten. Während der gesamten Vorbereitungen hindurch, vom Wetterbericht über das Anlegen der Druckanzüge bis hin zum rituellen Pokerspiel kurz vor dem Start, waren sie alle ein wenig zu aufgedreht gewesen und hatten vor Zuversicht strotzend mit den Hufen gescharrt. Jetzt aber schwiegen sie. Der Bus hielt an. Chenoweth, der Neuling, der neben Emma saß, murmelte: »Ich hätte nie gedacht, dass Windelausschlag zu den Berufsrisiken eines Astronauten gehört.« Sie musste lachen. Unter ihren unförmigen Raumanzügen trugen sie allesamt Windeln; schließlich waren es noch drei lange Stunden bis zum Abheben. Die Techniker an der Startrampe halfen Emma und den anderen aus dem Bus. Einen Augenblick blieb sie auf der Rampe stehen und blickte staunend zu dem dreißig Stockwerke hohen, von Scheinwerfern hell erleuchteten Shuttle empor. Als sie vor fünf Tagen das letzte Mal an der Rampe gewesen war, hatte sie nur den Seewind und die Vögel hören können. Jetzt war das Raumschiff selbst lebendig geworden; der brodelnde Flüssigtreibstoff im Bauch des riesigen Tanks ließ es grollen und rauchen wie ein erwachendes Ungeheuer. Mit dem Lift fuhren sie hinauf zur Ebene 195 und schritten über den Gitterrost des Verbindungsstegs. Es war immer noch Nacht, doch die Rampenbeleuchtung war so stark, dass Emma kaum die Sterne über sich erkennen konnte. Die Finsternis des, Alls wartete auf sie. In dem sterilen Weißraum halfen Techniker in flusenfreien »Häschenanzügen« einem Crewmitglied nach dem anderen durch die Luke in den Raumtransporter. Der Commander und der Pilot nahmen zuerst Platz. Emma, die für das Mitteldeck eingeteilt war, stieg als Letzte ein. Sie machte es sich auf ihrem gepolsterten Sitz bequem. Die Gurte wurden befestigt, die Helme aufgesetzt, und Emma reckte den Daumen hoch zum Zeichen, dass alles okay war. Die Luke schloss sich, und die Crew war von der Außenwelt abgeschnitten. Emma konnte ihr eigenes Herz klopfen hören. Trotz der diversen Stimmen in ihrem Kopfhörer – die Funkverbindung von der Kapsel zum Boden musste gründlich durchgecheckt werden – und trotz des Gluckerns und Ächzens des erwachenden Shuttles drang das dumpfe Hämmern ihres Herzens an ihr Ohr wie das stete Schlagen einer Trommel. Als Passagier im Mitteldeck würde sie in den nächsten zwei Stunden nicht viel mehr zu tun haben als dazusitzen und nachzudenken. Die Besatzung des Oberdecks erledigte sämtliche Checks vor dem Start. Sie konnte nicht nach draußen schauen; alles, was sie sah, waren der Stauraum und der Küchenbereich. Draußen würde bald der Morgen hereinbrechen, und am Strand von Playalinda würden die Pelikane über die Brandung fliegen. Sie holte tief Luft, lehnte sich in den Sitz zurück und wartete. Jack saß am Strand und wartete auf den Sonnenaufgang. Er war nicht allein im Jetty Park. Schon seit den späten Abendstunden strömten Schaulustige heran, und die ankommenden Autos bildeten eine endlose Schlange aus Scheinwerferlichtern, die über den Bee Line Expressway herangekrochen kam. Manche scherten nach Norden in Richtung, des Merritt-Island-Wildreservats aus, die anderen fuhren geradeaus über den Banana River in die Stadt Cape Canaveral hinein. Von beiden Orten aus würde man eine gute Sicht haben. Um ihn herum herrschte regelrecht Ferienstimmung. Strandtücher und Picknickkörbe wurden ausgepackt; er hörte Lachen und laute Radiomusik, das Plärren übermüdeter Kinder. Inmitten dieses ausgelassenen Trubels saß er schweigend da, allein mit seinen Gedanken und Befürchtungen. Als die Sonne sich vom Horizont löste, blickte er nach Norden, wo die Startrampe lag. Emma war jetzt an Bord der Atlantis, wo sie fertig angeschnallt auf den Start wartete. Aufgeregt und glücklich und ein wenig ängstlich. Er hörte, wie ein Kind sagte: »Das da ist ein böser Mann, Mom«, und drehte sich zu dem Mädchen um. Für eine Sekunde trafen sich die Blicke der kleinen, blonden Prinzessin und des unrasierten, ziemlich abgerissen wirkenden Mannes. Die Mutter schnappte sich das Mädchen und ging rasch ein paar Schritte weiter, um es vor dem bösen Mann in Sicherheit zu bringen. Mit einem müden Lächeln schüttelte Jack den Kopf und wandte den Blick wieder nach Norden. Dorthin, wo Emma war. Houston Im Flugkontrollraum war es verdächtig still geworden. Noch zwanzig Minuten bis zum Start – Zeit zu überprüfen, ob noch alles klar war. Die hinteren Reihen hatten ihre Systeme bereits durchgecheckt, jetzt war es an den vorderen Reihen, ihr grünes Licht zu geben. Mit ruhiger Stimme ging Carpenter die Liste durch und ließ sich von jedem Kontrolleur eine Bestätigung durchgeben. »Fido?«, fragte Carpenter. »Fido ist Go«, antwortete der Flugdynamik-Offizier., »Guido?« »Steuerung ist Go.« »Surgeon?« »Surgeon ist Go.« »DPS?« »Datenverarbeitung ist Go.« Nachdem Carpenter sie alle gefragt und von allen die Bestätigung erhalten hatte, nickte er einmal kurz in die Runde. »Houston, sind Sie klar zum Start?«, fragte der Startdirektor in Cape Canaveral. »Mission Control ist Go«, bestätigte Carpenter. Im Kontrollzentrum in Houston hörten alle die traditionelle Botschaft des Startdirektors an die Shuttle-Crew »Atlantis, Sie sind Go. Wir alle hier am Cape wünschen Ihnen viel Glück und Gottes Segen.« »Launch Control, hier Atlantis«, hörten sie Commander Vance antworten. »Danke, dass ihr den Vogel hier klar zum Fliegen gemacht habt.« Cape Canaveral Emma verschloss und verriegelte das Visier ihres Helms und aktivierte ihre Sauerstoffversorgung. Zwei Minuten bis zur Zündung. Eingehüllt in den Kokon ihres Raumanzugs hatte sie nichts weiter zu tun, als die Sekunden zu zählen. Sie spürte, wie die Haupttriebwerke erbebten, als sie in Startposition geschwenkt wurden. T minus dreißig Sekunden. Die elektrische Verbindung zum Boden war gekappt, jetzt übernahmen die Bordcomputer die Steuerung. Ihr Herzschlag beschleunigte sich, und das Adrenalin schoss, durch ihre Adern. Sie hörte den Countdown und wusste genau, was sie erwartete, Sekunde für Sekunde; vor ihrem geistigen Auge sah sie die Folge von Ereignissen, die sich jetzt abspielten. Bei T minus acht ergossen sich Tausende Liter Wasser über die Startrampe, um das Dröhnen der Triebwerke zu dämpfen. Bei T minus fünf öffneten die Bordcomputer die Ventile, durch die Flüssigsauerstoff und Wasserstoff in die Haupttriebwerke geleitet wurden. Als die drei Triebwerke gezündet wurden, spürte sie, wie das Shuttle sich gegen die Bolzen bäumte, die es immer noch mit der Startrampe verbanden, und unter dem nicht axialen Schub einen Ruck zur Seite machte, um sich gleich darauf wieder senkrecht zu stellen. Vier. Drei. Zwei … Jetzt gab es kein Zurück mehr. Als die beiden Feststoffraketen zündeten, hielt sie den Atem an und ballte die Fäuste. Jetzt wurde sie bis auf die Knochen durchgerüttelt, und das Getöse war so schmerzhaft laut, dass sie in ihrem Kopfhörer kein Wort mehr verstehen konnte. Sie musste die Zähne zusammenbeißen, damit sie nicht gegeneinander schlugen. Dann spürte sie, wie das Shuttle sich in seine vorgesehene Flugbahn über den Atlantik drehte. Ihr Körper wurde durch die Beschleunigung auf3gin den Sitz gedrückt. Ihre Glieder waren plötzlich so schwer, dass sie sie kaum bewegen konnte, und der Raumtransporter vibrierte so heftig, dass es schien, als müsse er unweigerlich in tausend Stücke zerspringen. Sie waren jetzt bei Max Q angelangt, dem Punkt der stärksten Turbulenzen, und Commander Vance kündigte an, er werde die Haupttriebwerke drosseln. Weniger als eine Minute später würde er sie wieder auf vollen Schub hochfahren. Die Sekunden verstrichen, und während ihr Helm um ihren Kopf herum ratterte und die Kraft der Beschleunigung ihr wie eine erbarmungslose Faust gegen die Brust drückte, fühlte, Emma erneut einen kalten Hauch von Angst. Genau in diesem Moment des Starts war die Challenger explodiert. Sie schloss die Augen und erinnerte sich an die Übung mit Hazel vor zwei Wochen. Sie näherten sich jetzt dem Zeitpunkt, als während der Simulation alles drunter und drüber gegangen war, als sie zum RTLS-Abbruch gezwungen worden waren und Kittredge anschließend die Kontrolle über den Raumtransporter verloren hatte. Dies war nun einmal ein kritischer Augenblick im Verlauf des Starts, und sie konnte nichts weiter tun als sich zurücklehnen und darauf hoffen, dass das wirkliche Leben gnädiger war als die Simulation. Im Kopfhörer war Vance’ Stimme zu hören: »Bodenkontrolle, hier Atlantis. Gehen auf vollen Schub.« »Roger, Atlantis. Gehen Sie auf vollen Schub.« Jacks Herz schlug ihm bis zum Hals, als das Space Shuttle sich vom Boden löste und in den Morgenhimmel schoss. Er hörte das Zischen der Feststoffraketen und sah die feurige Doppelfontäne hervorschießen. Die Rauchspur wurde immer länger, während der glitzernde Stecknadelkopf des Shuttle immer höher in den Himmel stieg. Um ihn herum begann die Menge begeistert zu applaudieren. Aber Jack wusste, dass immer noch viel zu viel schief gehen konnte. Plötzlich wurde er von Panik ergriffen – er hatte vergessen, die Sekunden mitzuzählen. Wie viel Zeit war verstrichen? Hatten sie Max Q schon überschritten? Er schirmte die Augen gegen die grelle Morgensonne ab und versuchte angestrengt die Atlantis auszumachen, doch alles, was er sah, war die lang gezogene Abgaswolke. Die Menschenmenge fing schon an, sich zu zerstreuen. Er blieb wie angewurzelt stehen, starr vor Angst. Doch er sah, keine fürchterliche Explosion. Keinen schwarzen Rauch. Keinen Albtraum. Die Atlantis hatte die Erde sicher hinter sich gelassen und raste jetzt auf ihrer Umlaufbahn durchs All. Er spürte, dass ihm Tränen über die Wangen rannen, doch er machte sich nicht die Mühe, sie wegzuwischen. Er ließ sie einfach laufen, während er immer noch in den Himmel starrte, die dünner werdende Rauchspur des Raumschiffs betrachtete, mit dem seine Frau in den Weltraum aufgestiegen war., DIE STATION, 25. Juli Beatty, Nevada Sullivan Obie erwachte mit einem Stöhnen. Das Telefon klingelte. Sein Kopf fühlte sich an, als würde jemand mit einem Becken darauf einschlagen, und im Mund hatte er einen Geschmack wie von einem seit Tagen nicht mehr geleerten Aschenbecher. Er griff nach dem Telefon und stieß dabei den Hörer von der Gabel. Ach, scheiß drauf, dachte er. Er drehte sich um und vergrub sein Gesicht in einem wirren Nest aus Haaren. Eine Frau? Er schlug die Augen auf und blinzelte, als das grelle Morgenlicht seine Netzhaut traf. Da lag tatsächlich eine Frau neben ihm im Bett. Eine Blondine. Sie schnarchte. Er schloss die Augen und versuchte wieder einzuschlafen, in der Hoffnung, sie wäre verschwunden, wenn er wieder aufwachte. Aber er konnte jetzt nicht schlafen. Nicht solange diese quäkende Stimme aus dem heruntergefallenen Hörer drang. Er tastete blind umher und fand ihn schließlich. »Wie? Bridget?«, fragte er. »Was?« »Warum bist du nicht hier?«, wollte Bridget wissen. »Weil ich im Bett liege.« »Es ist halb elf! Hallo-ho! Das Treffen mit den neuen Investoren? Ich sollte dich vielleicht vorwarnen – Casper schwankt noch zwischen Kreuzigung und Erwürgen.« Die Investoren. Mist. Sullivan setzte sich auf, hielt sich den Kopf und wartete darauf, dass das Schwindelgefühl nachließ., »Jetzt lass die Tussi liegen und sieh zu, dass du hierher kommst«, sagte Bridget. »Caspar ist schon auf dem Weg zum Hangar mit ihnen.« »Zehn Minuten«, antwortete er. Er legte auf und hievte sich mühsam hoch. Die Tussi rührte sich nicht. Er hatte keine Ahnung, wer sie war, aber er ließ sie weiterschlafen. Er besaß ohnehin nichts, was zu stehlen sich gelohnt hätte. Zum Duschen oder Rasieren blieb keine Zeit. Er warf drei Aspirin ein und kippte eine Tasse Mikrowellen-Kaffee hinterher, dann brauste er auf seiner Harley davon. Bridget wartete vor dem Hangar auf ihn. Sie sah wirklich aus wie eine Bridget – ein stämmiges, rothaariges keltisches Weibsbild –, und das passende ungestüme Temperament besaß sie ebenfalls. Manchmal haben Klischees leider einen Beigeschmack von Wahrheit. »Sie sind drauf und dran, wieder zu gehen«, zischte sie. »Mach, dass du da reinkommst.« »Was sind das noch mal für Burschen?« »Ein Mr. Lucas und ein Mr. Rashad. Sie vertreten ein Konsortium von zwölf Investoren. Wenn du diese Sache verbockst, sind wir erledigt.« Sie brach ab und musterte ihn mit angewiderter Miene. »Ach, verdammt, wir sind eh geliefert. Sieh dich doch bloß an. Hättest du dich nicht wenigstens rasieren können?« »Willst du, dass ich noch mal nach Hause fahre? Ich kann mir ja unterwegs einen Smoking mieten.« »Vergiss es.« Sie drückte ihm eine zusammengefaltete Zeitung in die Hand. »Was ist das denn?« »Caspar hat danach gefragt. Gib sie ihm einfach. Und jetzt gehst du da rein und bringst sie dazu, uns einen Scheck auszustellen. Einen dicken Scheck.«, Mit einem Seufzer betrat er den Hangar. Nach dem grellen Flimmern der Wüstensonne war die relative Dunkelheit hier drinnen Balsam für seine Augen. Es dauerte eine Weile, bis er die drei Männer ausmachen konnte, die vor den schwarzen Hitzeschutzkacheln des Raumtransporters Apogee II standen. Mit ihren Anzügen und Krawatten wirkten die beiden Besucher zwischen dem ganzen Werkzeug und den Maschinen und Flugzeugteilen irgendwie fehl am Platz. »Guten Morgen, die Herren«, rief er. »Tut mir Leid, dass ich mich verspätet habe, aber ich hatte noch eine Konferenzschaltung, die sich etwas länger hingezogen hat. Sie wissen ja, wie das ist …« Aus dem Augenwinkel sah er Casper Mulhollands warnenden Blick. Treib es nicht zu weit, du Arschloch, sollte das heißen. Sullivan schluckte krampfhaft. »Ich bin Sullivan Obie«, sagte er. »Mr. Mulhollands Partner.« »Mr. Obie kennt jede einzelne Schraube an diesem wiederverwendbaren Raumfahrzeug«, erklärte Casper. »Er hat früher mit dem Altmeister höchstpersönlich zusammenge- arbeitet, mit Bob Truax drüben in Kalifornien. Sicherlich kann er Ihnen das System besser erklären als ich. Wir nennen ihn hier nur unseren Obie-Wan.« Die beiden Besucher blinzelten nur verständnislos. Kein gutes Zeichen, dass der universelle Star-Wars-Jargon ihnen nicht einmal ein Lächeln entlockte. Sullivan schüttelte zuerst Lucas und dann Rashad die Hand und strahlte über das ganze Gesicht, ungeachtet der Tatsache, dass seine Hoffnungen bereits schwanden. Gleichzeitig spürte er einen heftigen Widerwillen gegen diese elegant gekleideten Herren in sich aufsteigen, deren Geld er und Casper so dringend brauchten. Apogee Engineering, ihr Baby, der Traum, den sie die letzten dreizehn Jahre über gehegt hatten, stand kurz vor dem Scheitern, und nur eine kräftige Geldspritze von einer neuen Investorengruppe konnte das Unternehmen retten. Er und Casper mussten das Verkaufsgespräch ihres Lebens hinlegen., Sollte es nicht klappen, konnten sie ihr Werkzeug einpacken und den Raumtransporter als Jahrmarktsattraktion verscherbeln. Mit einer ausladenden Bewegung wies Sullivan auf die Apogee II, die eher einem überdimensionalen Hydranten mit Fenstern glich als einem Flugzeug mit Raketenantrieb. »Ich weiß, es sieht vielleicht nicht besonders beeindruckend aus, aber was wir hier gebaut haben, ist das kostengünstigste und praktischste wiederverwendbare Raumfahrzeug, das derzeit auf dem Markt ist. Beim Start, der in der Vertikalen erfolgt, wird ein verstärktes SSTO-System verwendet. In einer Höhe von zwölf Kilometern beschleunigen dann Raketen mit Verdrängungszuführung das Fahrzeug bei niedrigen dynamischen Druckverhältnissen auf einen Stufentrennungs- punkt bei Mach 4. Dieser Raumtransporter ist hundertprozentig wiederverwendbar und wiegt nur acht Tonnen. Er folgt den Prinzipien, auf denen unserer Überzeugung nach die Zukunft der Raumfahrt ruht: kleiner, schneller, billiger.« »Welche Art Triebwerk benutzen Sie für den Start?«, fragte Rashad. »Luftatmende Rybinsk-RD-38-Triebwerke, importiert aus Russland.« »Warum aus Russland?« »Nun, Mr. Rashad, das hängt damit zusammen, dass die Russen, ganz unter uns gesagt, mehr von Raketentechnik verstehen als irgendjemand auf der Welt. Sie haben Dutzende von Flüssigtreibstoff-Raketentriebwerken entwickelt und dabei neue Materialien verwendet, die bei höherem Druck eingesetzt werden können. Es tut mir Leid, das sagen zu müssen, aber unser Land hat seit der Apollo nur einen einzigen neuen Flüssigtreibstoff-Raketenantrieb entwickelt. Wir handeln nach der Devise, dass für unser Produkt nur die besten Komponenten gut genug sind – egal, wo sie herkommen.« »Und wie landet dieses … Ding?«, fragte Mr. Lucas, der den, Hydranten-Raumtransporter skeptisch beäugte. »Tja, das ist das Schöne an der Apogee II. Wie Sie sicher bemerkt haben, hat sie keine Flügel. Sie braucht kein Rollfeld. Stattdessen fällt sie einfach auf die Erde, von Fallschirmen abgebremst und bei der Landung von Luftkissen abgefedert. Sie kann überall landen, auch im Meer. Auch hier müssen wir vor den Russen den Hut ziehen, denn wir haben gewisse Elemente ihrer alten Sojus-Kapsel abgekupfert. Die hat ihnen über Jahrzehnte als zuverlässiges Arbeitspferd gedient.« »Diese alte Iwan-Technologie hat es Ihnen wohl angetan, was?«, meinte Lucas. Sullivans Miene wurde starr. »Was es mir angetan hat, ist Technologie, die funktioniert. Sie können über die Russen sagen, was Sie wollen, jedenfalls wussten sie, was sie taten.« »Was wir hier vor uns haben«, sagte Lucas, »ist also eine Art Zwitter. Eine Kreuzung zwischen einer Sojus und einem Space Shuttle.« »Einem sehr kleinen Space Shuttle. Wir haben dreizehn Jahre Entwicklungszeit und nur fünfundsechzig Millionen Dollar gebraucht, bis wir an diesem Punkt waren. Das ist erstaunlich günstig, wenn Sie bedenken, was das Shuttle gekostet hat. Wir gehen davon aus, dass Sie mit mehreren Fahrzeugen dieser Art eine jährliche Rendite von dreißig Prozent erzielen werden, ausgehend von zwölfhundert Starts im Jahr. Die Kosten pro Flug würden sich auf achtzigtausend Dollar belaufen, und der Preis pro Kilo wäre mit zweihundertsiebzig geradezu lächerlich niedrig. Kleiner, schneller, billiger. Das ist unser Mantra.« »Was verstehen Sie unter klein, Mr. Obie? Wie groß ist Ihre Nutzlastkapazität?« Sullivan zögerte. Das war der Punkt, an dem sie das Geschäft zu verlieren drohten. »Wir können eine Nutzlast von dreihundert Kilogramm plus einen Piloten in eine niedrige Erdumlaufbahn bringen.«, Es war eine ganze Weile still. Dann sagte Mr. Rashad: »Das ist alles?« »Das sind sechshundert Pfund. Da können Sie eine ganze Menge Forschungsexperimente unter …« »Ich weiß, wie viel dreihundert Kilogramm sind. Das ist ziemlich wenig.« »Das kompensieren wir mit einer größeren Anzahl von Flügen. Sie können sich die Apogee II fast als eine Art Weltraumflugzeug vorstellen.« »Wir … wir haben sogar schon das Interesse der NASA geweckt!«, warf Casper mit dem Mut der Verzweiflung ein. »Das ist nämlich genau das System, das man brauchen könnte, um mal auf einen Sprung in der Raumstation vorbeizuschauen.« Lucas zog überrascht die Augenbrauen hoch. »Die NASA ist interessiert?« »Nun ja, wir haben da gewisse Beziehungen.« Au Mann, Casper, dachte Sullivan. Fang jetzt bloß nicht damit an. »Zeig ihnen die Zeitung, Sullie.« »Was?« »Die Los Angeles Times. Seite zwei.« Endlich fiel Sullivan die Zeitung ein, die Bridget ihm in die Hand gedrückt hatte. Er schlug die zweite Seite auf und sah den Artikel: »NASA löst Astronauten ab.« Daneben war ein Foto mehrerer hoher Tiere des JSC bei einer Pressekonferenz. Er erkannte den unscheinbaren Typen mit den großen Ohren und dem unvorteilhaften Haarschnitt. Es war Gordon Obie. Casper schnappte sich die Zeitung und zeigte sie ihren Besuchern. »Sehen Sie diesen Mann hier, der neben Leroy Connell steht? Das ist der Leiter der Flugeinsatzabteilung. Mr. Obies Bruder.«, Die beiden Herren waren sichtlich beeindruckt. Sie starrten Sullivan an. »Nun«, meinte Casper, »wären die Gentlemen jetzt bereit, zum Geschäft zu kommen?« »Wir sollten offen mit Ihnen reden«, begann Lucas. »Mr. Rashad und ich haben uns auch bei anderen Raumfahrtunternehmen nach den neuesten Entwicklungen umgeschaut. Wir haben den Kelly Astroliner in Augenschein genommen, die Roton und die Kistler K-1. Wir waren durchweg beeindruckt, besonders von der K-1. Aber wir haben uns gedacht, wir sollten auch Ihrer kleinen Firma die Chance geben, ihr Produkt vorzustellen.« Ihrer kleinen Firma. Scheiß drauf, dachte Sullivan. Er hasste es, um Geld zu betteln, er hasste es, vor aufgeblasenen Wichtigtuern in die Knie zu gehen. Das Ganze war ein hoffnungsloses Unterfangen. Sein Kopf tat ihm weh, sein Magen grummelte, und mit diesen zwei Lackaffen hatte er nur seine Zeit vergeudet. »Sagen Sie uns, warum wir auf Ihr Pferd setzen sollten«, sagte Lucas. »Warum ist Apogee für uns die bessere Wahl?« »Um ehrlich zu sein, meine Herren, ich glaube nicht, dass wir die bessere Wahl für Sie sind«, antwortete Sullivan geradeheraus. Und dann drehte er sich um und ging. »Äh … entschuldigen Sie mich bitte«, sagte Casper hastig und lief hinter seinem Partner her. »Sully«, flüsterte er. »Was ist in dich gefahren?« »Diese Typen sind nicht an uns interessiert. Du hast sie doch gehört. Sie lieben die K-1. Sie wollen nur große Raketen. Die passen besser zu ihren Schwänzen.« »Mach jetzt nicht alles kaputt! Geh zu ihnen und rede mit ihnen.« »Warum denn? Sie stellen uns ja doch keine Schecks aus.«, »Wenn wir die verlieren, verlieren wir alles!« »Wir haben schon verloren.« »Nein. Nein, du kannst ihnen das Ding verkaufen! Du musst ganz einfach nur die Wahrheit sagen. Sag ihnen, woran wir wirklich glauben. Du weißt genauso gut wie ich, dass wir das Beste von allen haben.« Sullivan rieb sich die Augen. Die Wirkung des Aspirins ließ nach, und sein Kopf dröhnte. Er hatte es satt, zu betteln. Er war Ingenieur und Pilot, und er wäre glücklich gewesen, den Rest seines Lebens mit ölverschmierten Händen herumzulaufen. Aber das würde nicht passieren – nicht ohne neue Investoren. Nicht ohne neue Mittel. Er drehte sich um und ging wieder auf die Besucher zu. Zu seiner Überraschung schienen ihn die beiden Männer mit argwöhnischem Respekt zu betrachten. Vielleicht weil er die Wahrheit gesagt hatte. »Okay«, begann Sullivan. Die Tatsache, dass er nichts zu verlieren hatte, gab ihm Mut. Warum nicht erhobenen Hauptes in sein Verderben gehen? »Hier ist mein Angebot: Wir können alles, was wir gesagt haben, mit einer einfachen Demonstration untermauern. Sind die anderen Firmen in der Lage, auf der Stelle einen Start zu organisieren? Nein, sind sie nicht. Sie brauchen ›Vorlaufzeit‹«, höhnte er. »Monate. Wir können jederzeit starten. Wir brauchen nichts weiter zu tun, als dieses Prachtstück auf seinen Booster zu packen, und schon können wir es in eine niedrige Umlaufbahn schießen. Was sage ich, wir können sogar zur Raumstation rauffliegen und denen ein bisschen vor der Nase herumtanzen. Also, geben Sie uns einen Termin. Sagen Sie uns, wann Sie den Start haben wollen, und wir machen es.« Casper war inzwischen so weiß wie – nun ja, wie ein Gespenst. Und zwar kein sehr freundliches. Sullivan hatte sich so weit aus dem Fenster gelehnt, dass sie jetzt nur noch mit den, Fingerspitzen am Sims hingen. Die Apogee II war noch nicht getestet. Sie stand seit über vierzehn Monaten in diesem Hangar und verstaubte, während sie beide in der Gegend herumschnorrten. Und bei ihrem Jungfernflug wollte Sully sie gleich in den Orbit schicken? »Mehr noch, ich bin so überzeugt davon, dass die Apogee II die Prüfung besteht«, sagte Sullivan, dem der Einsatz noch nicht hoch genug zu sein schien, »dass ich mich persönlich in den Pilotensitz setzen werde.« Casper hielt sich den Bauch. »Äh … das dürfen Sie nicht so wörtlich nehmen, meine Herren. Der Raumtransporter kann durchaus auch unbemannt eingesetzt werden …« »Aber da ist doch nichts dabei«, sagte Sullivan. »Warum sollte ich nicht mit unserem Schätzchen fliegen? Das macht es doch für alle interessanter. Was sagen Sie dazu?« Ich sage, du hast deinen beschissenen Verstand verloren, ließen Caspers Augen ihn wissen. Die beiden Geschäftsleute tauschten fragende Blicke und flüsterten einander ein paar Worte zu. Dann sagte Lucas: »Wir wären sehr an einer Demonstration interessiert. Allerdings brauchen wir etwas Zeit, um unseren Partnern Bescheid zu sagen. Die Reisepläne müssen koordiniert werden. Also sagen wir … in einem Monat. Schaffen Sie das?« Sie wollten ihn auf die Probe stellen. Sullivan lachte nur. »In einem Monat? Kein Problem.« Er sah Casper an, der jetzt die Augen geschlossen hatte und große Schmerzen zu haben schien. »Wir hören voneinander«, sagte Lucas und wandte sich zum Gehen. »Noch eine letzte Frage«, sagte Mr. Rashad. Er wies auf den Raumtransporter. »Mir ist aufgefallen, dass Ihr Prototyp den Namen Apogee II trägt. Gibt es auch eine Apogee I?« Casper und Sullivan sahen einander an., »Äh, ja«, sagte Casper. »Es gab mal eine …« »Und was ist damit passiert?« Casper schwieg verlegen. Ach, was soll’s, dachte Sullivan. Mit der Wahrheit schien man bei diesen Typen nicht schlecht zu fahren, warum sollte er es also nicht noch einmal versuchen? »Sie ist abgestürzt und verbrannt«, sagte er. Und ging seiner Wege. Abgestürzt und verbrannt. Anders konnte man es nicht beschreiben, was an diesem kalten, klaren Morgen vor anderthalb Jahren passiert war. An dem Morgen, an dem auch all seine Träume abgestürzt und verbrannt waren. Während er an seinem ramponierten Schreibtisch im Büro der Firma saß und seinen Kater mit einem Becher Kaffee zu ertränken suchte, kamen ihm unwillkürlich die schmerzlichen Einzelheiten jenes Tages wieder in den Sinn. Wie der Bus mit den ganzen NASA- Vertretern am Startplatz angekommen war. Das stolze Lächeln seines Bruders Gordie. Die Festtagsstimmung unter dem Häuflein von Apogee-Angestellten und den etwa zwanzig Investoren, die sich vor dem Start unter der Markise zu Kaffee und Doughnuts versammelt hatten. Der Countdown. Der Start. Alle Augen waren gen Himmel gerichtet, als die Apogee I wie ein Pfeil durch die Lüfte geschossen und bald nur noch als glitzernder Stecknadelkopf zu erkennen gewesen war. Und dann der Lichtblitz, und alles war vorbei gewesen. Hinterher hatte sein Bruder nicht viel gesagt, hatte nur ein paar knappe Worte der Anteilnahme gemurmelt. Aber so war Gordon nun einmal. Ihr ganzes Leben lang war es so gewesen: Wann immer Sullivan etwas verbockt hatte – und das schien nur allzu oft vorzukommen –, reagierte Gordon mit diesem traurigen, enttäuschten Kopfschütteln. Gordon war der ältere Bruder, der vernünftige und zuverlässige Sohn, der sich als Shuttle-, Commander ausgezeichnet hatte. Sullivan war dagegen nicht einmal bis ins Astronautenkorps vorgedrungen. Zwar war auch er Pilot und Raumfahrtingenieur, aber irgendwie schien sich alles gegen ihn verschworen zu haben. Wenn er ins Cockpit kletterte, konnte man sicher sein, dass just in diesem Moment irgendein Kurzschluss auftrat oder ein Kabel riss. Oft hatte er das Gefühl, er sollte sich die Worte Ich kann nichts dafür auf die Stirn tätowieren lassen, denn in den allermeisten Fällen konnte er wirklich nichts dafür, wenn etwas schief ging. Aber Gordon sah das anders. Bei ihm ging nie etwas schief. »Pech« war für ihn nur eine Ausrede, hinter der sich in Wirklichkeit Inkompetenz versteckte. »Warum rufst du ihn nicht an?«, meinte Bridget. Er sah auf. Sie stand an seinem Schreibtisch, die Arme vor der Brust verschränkt wie eine strenge Lehrerin. »Wen denn?«, fragte er. »Deinen Bruder, wen sonst? Sag ihm, dass wir den zweiten Prototyp vom Stapel lassen. Lad ihn ein, dabei zu sein. Vielleicht bringt er ja die anderen von der NASA wieder mit.« »Ich will niemand von der NASA dabei haben.« »Sully, wenn es uns gelingt, sie zu beeindrucken, ist das die Wende für diese Firma.« »Wie letztes Mal, was?« »Das Ding hatte eben eine kleine Macke. Wir haben das Problem beseitigt.« »Und diesmal ist vielleicht wieder eine kleine Macke dran.« »Du stürzt uns noch ins Unglück mit deinem Gerede, weißt du das?« Sie schob ihm das Telefon vor die Nase. »Ruf Gordon an. Wenn wir schon die Würfel rollen lassen, können wir auch gleich das ganze Haus verwetten.« Er betrachtete das Telefon und dachte an die Apogee I. Daran, wie der Traum eines Lebens in einem Sekundenbruchteil in, Rauch aufgehen konnte. »Sully?« »Vergiss es«, sagte er. »Mein Bruder hat Besseres zu tun, als seine Zeit mit Verlieren zu vergeuden.« Und warf die Zeitung in den Papierkorb. 26. Juli An Bord der Atlantis »He, Watson«, rief Commander Vance zum Mitteldeck herunter. »Kommen Sie doch mal hoch und schauen Sie sich Ihr neues Zuhause an.« Emma glitt die Verbindungsleiter empor und kam auf dem Oberdeck heraus, direkt hinter Vance’ Sitz. Beim ersten Blick aus dem Fenster stockte ihr fast der Atem vor Staunen. So nah war sie noch nie an die Station herangekommen. Während ihrer ersten Mission vor zweieinhalb Jahren hatten sie nicht an der ISS angedockt, sondern sie nur aus der Ferne beobachtet. »Ein Prachtstück, was?«, meinte Vance. »So etwas Schönes habe ich noch nie gesehen«, sagte Emma. Und so war es. Mit den gewaltigen Sonnensegeln, die fächerförmig an dem massiven Rumpfteil befestigt waren, glich die ISS einem majestätischen Segelschiff, das durch den Himmel glitt. Die einzelnen, in sechzehn verschiedenen Ländern produzierten Bauteile waren mit fünfundvierzig verschiedenen Flügen in den Weltraum transportiert worden. Stück für Stück war die Station dann im All fertig gestellt worden. Die Arbeiten hatten fünf Jahre gedauert. Weit mehr als nur ein Triumph der Technik, war die ISS ein Symbol für all das, was der Mensch erreichen konnte, wenn er seine Waffen niederlegte und den Blick zum Himmel richtete. »Na, wenn das keine nette Zweitwohnung ist«, sagte Vance., »Ein richtiges Vorzeigeobjekt, wenn Sie mich fragen.« »Wir sind genau auf der R-Kurve«, warf der Shuttle-Pilot DeWitt ein. »Nicht schlecht geflogen.« Vance verließ den Kommandositz und postierte sich am oberen Fenster des Oberdecks. Sie näherten sich jetzt dem Andockmodul der ISS im Sichtflug. Dies war die heikelste Phase des gesamten hoch komplizierten Rendezvous-Manövers. Die Atlantis war in eine erdnähere Umlaufbahn als die der ISS gebracht worden, und die letzten beiden Tage hatten sie mit der dahinsausenden Raumstation Fangen gespielt. Sie würden sich ihr von unten nähern und mit Hilfe der Düsen des RCS, des Reaction Control System zur Feinsteuerung im All, das Shuttle in die genaue Andockposition bringen. Emma hörte, wie die Feinsteuerraketen mit einem dumpfen Krachen zündeten, und spürte, wie der Raumtransporter erzitterte. »Schauen Sie mal«, sagte DeWitt. »Dort ist das Sonnensegel, das vorigen Monat was abbekommen hat.« Er zeigte auf einen der Sonnenkollektoren, der von einem klaffenden Loch verunstaltet war. Eine der unausweichlichen Gefahren des Weltalls ist der permanente Regen aus Meteoriten und Weltraumschrott. Selbst ein winziger Gegenstand wird bei einer Geschwindigkeit von mehreren Tausend Stundenkilometern zu einem Geschoss mit verheerender Wirkung. Als sie so nahe kamen, dass die Station das ganze Fenster ausfüllte, verspürte Emma ein derart überwältigendes Gefühl von Ehrfurcht und Stolz, dass ihr plötzlich Tränen in die Augen schossen. Mein neues Zuhause, dachte sie. Ich komme nach Hause. Die Luke der Druckschleuse ging auf, und vom anderen Ende des Verbindungstunnels, der die Atlantis mit der ISS verband, strahlte ihnen ein rundes braunes Gesicht entgegen. »Sie haben Orangen mitgebracht!«, rief Luther Arnes seinen Kollegen in, der Station zu. »Ich kann sie riechen!« »Hier ist der NASA-Lieferdienst«, sagte Commander Vance trocken. »Ihre Lebensmittel sind eingetroffen.« Mit einer Plastiktüte voll frischem Obst in der Hand schwebte er durch die Druckschleuse der Atlantis in die Raumstation. Es war ein perfektes Andockmanöver gewesen. Während beide Raumschiffe mit 28.000 Stundenkilometern die Erde umkreisten, hatte Vance das Shuttle ganz behutsam mit einer Geschwindigkeit von fünf Zentimetern pro Sekunde an die ISS herangeführt, bis das Andockmodul der Atlantis fest in der Anschlussstelle der ISS eingerastet war. Jetzt waren die Luken geöffnet, und die Crew der Atlantis schwebte in die Raumstation hinüber, wo sie mit Händeschütteln, Umarmungen und dem freudigen Lächeln von Menschen begrüßt wurden, die seit Monaten keine neuen Gesichter mehr gesehen haben. Emma wechselte als Fünfte in die Station hinüber. Sie tauchte aus dem Verbindungstunnel auf und atmete sogleich eine merkwürdige Mischung von Düften ein, überlagert von dem leicht säuerlichen Geruch von Menschen, die zu lange in einem geschlossenen Raum eingesperrt waren. Luther Arnes, ein alter Freund aus der Zeit ihrer Astronautenausbildung, begrüßte sie zuerst. »Dr. Watson, nehme ich an!«, rief er mit seinem dröhnenden Bass und drückte sie an seine Brust. »Willkommen an Bord. Je mehr Ladys, desto lustiger wird’s.« »He, du weißt doch, dass ich keine Lady bin.« Er blinzelte ihr zu. »Das bleibt aber unter uns.« Luthers gute Laune hatte schon immer einen ganzen Raum füllen können. Alle mochten Luther, weil Luther jeden mochte. Emma war froh, ihn an Bord zu haben. Besonders wenn sie sich unter ihren anderen Stationskollegen umschaute. Sie gab zuerst Michael Griggs die Hand und fand, seine Begrüßung höflich, aber fast militärisch. Diana Estes, die Engländerin, die von der europäischen Raumfahrtagentur ESA geschickt worden war, schien ihr kaum herzlicher. Sie lächelte, doch ihre Augen waren von einem seltsamen Gletscherblau. Kalt und distanziert. Anschließend wandte Emma sich dem Russen Nikolai Rudenko zu, der schon am längsten an Bord der ISS war, fast fünf Monate. Die Beleuchtung der Kapsel machte sein Gesicht noch blasser, als es ohnehin schon war; es hatte die gleiche matte Farbe wie seine angegrauten Bartstoppeln. Als sie einander die Hand schüttelten, schien er ihrem Blick auszuweichen. Dieser Mann muss dringend nach Hause, dachte sie. Er ist depressiv. Ausgelaugt. Kenichi Hirai, der Astronaut der japanischen NASDA, kam als Nächster auf sie zugeschwebt. Er lächelte sie immerhin an und drückte ihr kräftig die Hand. Nachdem er eine Begrüßung gestottert hatte, zog er sich rasch wieder zurück. Das Modul hatte sich inzwischen fast geleert; der Rest der Gruppe hatte sich auf die anderen Abschnitte der Station verteilt. Sie blieb allein mit Bill Haning zurück. Debbie Haning war drei Tage zuvor gestorben. Die Atlantis würde Bill nach Hause bringen, nicht an Debbies Bett, sondern an ihr Grab. Emma schwebte auf ihn zu. »Es tut mir Leid«, sagte sie leise. »Es tut mir so furchtbar Leid.« Er nickte nur und wandte sich ab. »Es ist merkwürdig«, sagte er. »Wir dachten immer – wenn irgendetwas passieren würde – dann würde es mir passieren. Ich bin schließlich der große Held in der Familie. Der diese ganzen Risiken auf sich nimmt. Es wäre uns nie in den Sinn gekommen, sie könnte diejenige sein …« Er holte tief Luft. Sie sah, dass er sich krampfhaft bemühte, die Fassung zu wahren, und sie wusste, dass dies nicht der richtige Zeitpunkt für Sympathiebekundungen war. Selbst eine leise Berührung könnte seine mühsam im Zaum gehaltenen, Emotionen zum Ausbruch bringen. »Nun, Watson«, sagte er schließlich. »Ich denke, ich sollte Sie ein wenig einweisen, schließlich übernehmen Sie meine Aufgaben.« Sie nickte. »Wann immer Sie Zeit haben, Bill.« »Machen wir es gleich. Es gibt eine Menge zu erklären, und wir haben nicht allzu viel Zeit für die Wachablösung.« Obwohl Emma mit dem Aufbau der Raumstation durchaus vertraut war, drehte sich ihr nach ihrer ersten Tour durch das Raumschiff der Kopf. Die Schwerelosigkeit im Orbit hatte zur Folge, dass es kein Oben und Unten gab, weder Decke noch Fußboden. Es gab auch keine Wände im herkömmlichen Sinn, sondern nur funktionale Arbeitsflächen. Sobald sie sich zu schnell in der Luft drehte, verlor sie jegliche Orientierung. Zusammen mit den leichten Anwandlungen von Übelkeit veranlasste sie diese Erfahrung, sich möglichst langsam zu bewegen und die Augen beim Umdrehen immer fest auf einen Punkt zu richten. Sie wusste, dass der Lebens- und Arbeitsraum der ISS das Volumen von zwei Flugzeugen des Typs Boeing 747 umfasste, doch dieser Raum war auf ein Dutzend Module von der Größe eines Busses aufgeteilt, die an so genannten »Nodes« oder Verbindungsknoten wie Legosteine zusammengesteckt waren. Das Shuttle hatte an Node 2 angedockt. An diesem Element hingen auch die Labormodule der ESA, Japans und der USA. Durch Letzteres gelangte man in die übrigen Abteilungen der Station. Bill führte sie aus dem US-Labor in den nächsten Verbindungsknoten, Node 1. Hier verharrte er einen Moment, um einen Blick aus der Beobachtungskuppel zu werfen. Unter ihnen drehte sich majestätisch die Erde; milchige Wolken wirbelten über die Ozeane. »Hier verbringe ich jede freie Minute«, sagte Bill. »Ich schaue, einfach nur aus diesen Fenstern. Das hat für mich fast etwas Heiliges. Ich nenne das hier die Kirche der Mutter Erde.« Er riss sich von der Aussicht los und drehte sich vom Fenster weg, um Emma die verschiedenen Luken zu zeigen, die von dem Verbindungselement abzweigten. »Direkt gegenüber ist die Druckschleuse für die Außenbordarbeiten«, sagte er. »Und die Luke unter uns führt in das Wohnmodul. Dort ist Ihre Schlafstation. Das CRV ist am anderen Ende des Wohnmoduls angedockt, damit es bei einer eiligen Evakuierung sofort zugänglich ist.« »Und in diesem Modul schlafen drei Crewmitglieder?« Er nickte. »Die anderen drei schlafen im russischen Servicemodul. Das ist hinter dieser Luke hier. Schauen wir doch mal rein.« Sie verließen Node 1, und wie Fische in einem Labyrinth von Tunneln ließen sie sich in die russische Hälfte der Station treiben. Dies war der älteste Teil der ISS, die Sektion, die bereits die längste Zeit in der Umlaufbahn war – und das war auch nicht zu übersehen. Während sie Zarya, das russische Funktionsmodul, durchquerten, fielen ihr Schmutzflecken an den Wänden und diverse Kratzer und Beulen an der Einrichtung auf. Was zuvor nur ein Bauplan in ihrem Kopf gewesen war, wurde nun mit einem Mal sinnlich greifbar. Diese Station war mehr als nur eine Reihe von High-Tech-Labors, sie war auch ein Ort, an dem Menschen wohnten, und die Spuren der ständigen Nutzung waren überall deutlich zu erkennen. Sie schwebten in das russische Servicemodul, und Emma bot sich ein verwirrender Anblick: Griggs und Vance, beide auf dem Kopf stehend. Oder bin ich diejenige, die auf dem Kopf steht?, dachte Emma. Die verkehrte Welt der Schwerelosigkeit amüsierte sie. Wie das US-Wohnmodul enthielt das RSM eine Kombüse, eine Toilette und Schlafstationen für drei, Besatzungsmitglieder. Am anderen Ende entdeckte sie eine weitere Luke. »Geht es dort drüben zur alten Sojus?«, fragte sie. Bill nickte. »Wir nutzen sie jetzt als Stauraum für allerhand Krempel. Mehr können wir nicht damit anfangen.« Die Sojus- Kapsel, die früher als »Rettungsboot« gedient hatte, war inzwischen veraltet, ihre Batterien waren längst erschöpft. Luther Arnes steckte den Kopf durch die Einstiegsluke des RSM. »He Leute, Zeit für den großen Auftritt! Allgemeines Händchenhalten im Konferenzraum. Die NASA will den Steuerzahlern unsere internationale Love Parade hier oben vorführen.« Bill seufzte müde. »Wir sind wie Tiere im Zoo. Jeden Tag ›Bitte recht freundlich‹ für die verdammten Kameras.« Emma war die Letzte, die sich der Karawane in Richtung Wohnmodul anschloss. Als sie dort ankam, drängten sich bereits ein Dutzend Menschen in dem kleinen Raum. Sie sah nur ein Gewirr von Armen und Beinen; alle trieben hin und her und auf und ab und waren bemüht, nicht miteinander zu kollidieren. Während Griggs Ordnung in das Chaos zu bringen versuchte, blieb Emma in Node 1 zurück. Sie schwebte dort eine Weile in der Luft, und dann drehte sie sich unwillkürlich langsam zur Kuppel hin. Der Blick aus diesen Fenstern verschlug ihr den Atem. Ausgebreitet in all ihrer Pracht lag unter ihr die Erde. Ein Kranz von Sternen krönte die sanfte Biegung des Horizonts. Sie traten jetzt in die Nachtzone ein, und Emma sah vertraute Orte, die einer nach dem anderen in die Dunkelheit tauchten. Dort war Houston. Es war ihr erster Überflug für diese Nacht. Sie glitt ganz nahe an das Fenster heran und drückte die Handfläche gegen die Scheibe. Ach Jack, dachte sie. Ich wünschte, du wärst hier. Ich wünschte, du könntest das hier sehen., Dann winkte sie. Und hatte nicht den geringsten Zweifel, dass irgendwo dort unten in der Dunkelheit Jack stand und zurückwinkte., 29. Juli Persönliche E-Mail an: Dr. Emma Watson (ISS) Absender: Jack McCallum Wie ein Diamant am Himmel. So siehst du von hier unten aus. Letzte Nacht bin ich aufgeblieben, um dich vorbeifliegen zu sehen. Hab dir kräftig zugewunken. Heute Morgen haben sie dich auf CNN regelrecht in den Himmel gehoben – wenn du nicht schon dort wärst … So nach dem Motto »Miss NASA hebt ab – Holt sich nicht mal eine Laufmasche« – oder irgendein Mumpitz in der Art. Sie haben Leroy Cornell und Woody Ellis interviewt, und die beiden haben vor Stolz gestrahlt wie frisch gebackene Daddys. Herzlichen Glückwunsch – du bist Amerikas Liebling! Vance und die Crew haben eine Bilderbuchlandung hingelegt. Diese blutgierigen Reporter haben sich auf den armen Bill gestürzt, sobald er in Houston ankam. Ich habe ihn kurz im Fernsehen gesehen – er sieht zwanzig Jahre älter aus. Debbies Beerdigung ist heute Nachmittag. Ich werde hingehen. Morgen gehe ich auf dem Golf segeln. Em, ich habe heute die Scheidungspapiere bekommen, und ich sage dir ganz ehrlich, ich habe kein gutes Gefühl dabei. Aber das ist ja auch nicht der Sinn dei Sache, dass man sich dabei gut fühlt, oder? Jedenfalls ist alles fertig zum Unterschreiben. Vielleicht können wir ja jetzt, wo alles vorbei ist, wieder gute Freunde sein. So wie früher., Jack P.S.: Humphrey ist ein kleiner Mistkerl. Du schuldest mir eine neue Couch. Persönliche E-Mail an: Jack McCallum Absender: Emma Watson Amerikas Liebling? Jetzt hör aber auf! Das hier ist eher wie ein Drahtseilakt, bei dem die ganze Erde gebannt zuguckt und darauf wartet, dass ich irgendeinen Fehler mache. Und wenn das passiert, stellen sie mich an den Pranger und schreiben drunter: »Hätten sie bloß einen Mann geschickt.« Ich hasse so was. Andererseits finde ich es ganz fantastisch hier oben. Wenn du doch nur diese Aussicht sehen könntest! Wenn ich auf die Erde runterschaue und sehe, wie unglaublich schön sie ist, würde ich am liebsten die ganzen Leute da unten schütteln, bis sie endlich zur Vernunft kommen. Könnten sie doch nur erkennen, wie klein und zerbrechlich die Erde ist, und wie allein in dieser kalten, schwarzen Unendlichkeit. Dann würden sie sicher viel besser auf sie Acht geben. (Ach ja, das ist mal wieder typisch für die Alte, diese Gefühlsduselei über den alten Heimatplaneten. Hätten sie bloß einen Mann geschickt.) Die gute Nachricht ist, dass meine Übelkeit verschwunden ist. Ich kann jetzt von Modul zu Modul düsen und spüre kaum was dabei. Nur dass mir immer noch etwas schwummrig wird, wenn ich plötzlich durch ein Fenster die Erde sehe. Das bringt meinen Gleichgewichtssinn durcheinander, und dann brauche ich immer ein paar Sekunden, um mich zu orientieren. Ich versuche regelmäßig weiter zu trainieren, aber zwei Stunden pro Tag sind eine Menge Zeit, vor allem wenn man bedenkt, was ich alles zu tun habe. Dutzende von Experimenten wollen überwacht werden, und dann sind da die Millionen E-Mails aus der Nutzlastzentrale. Jeder Wissenschaftler beansprucht natürlich oberste Priorität für seine Lieblingsprojekte. Na, ich werde, schon noch alles in den Griff kriegen. Aber heute Morgen war ich so müde, dass ich die Weckmusik aus Houston überhaupt nicht gehört habe. (Und Luther sagt, sie hätten uns mit Wagners »Walkürenritt« beschallt!) Was die Scheidung betrifft – ich habe auch kein gutes Gefühl bei dem Gedanken, dass es jetzt endgültig sein soll. Aber wir haben doch immerhin sieben gute Jahre gehabt, Jack. Das können nicht viele Paare von sich behaupten. Ich weiß, du willst die Sache sicher möglichst schnell hinter dich bringen. Ich verspreche dir, dass ich die Papiere unterschreibe, sobald ich wieder zu Hause bin. Wink nur immer schön! Em P.S.: Bei mir ist Humphrey nie an die Möbel gegangen. Was hast du nur mit ihm gemacht, dass er sich so auffuhrt? Emma schaltete ihren Laptop aus und klappte ihn zusammen. Das Beantworten ihrer persönlichen E-Mails war der letzte Job des Tages. Sie hatte sich auf Nachrichten von zu Hause gefreut, aber dass Jack die Scheidung erwähnt hatte, hatte ihr einen Stich versetzt. Er ist also bereit, den nächsten Schritt zu machen, dachte sie. Er will, dass wir wieder »gute Freunde« sind. Als sie den Reißverschluss ihres Schlafsacks hochzog, stellte sie fest, dass sie wütend auf ihn war, weil er so bereitwillig akzeptierte, dass ihre Ehe zu Ende war. Zu Beginn des Scheidungsverfahrens hatte ihr jede lautstarke Auseinandersetzung ein merkwürdiges Gefühl der Bestätigung gegeben. Aber jetzt waren die Konflikte beigelegt, und Jack hatte das Stadium erreicht, in dem er sich gelassen mit allem abfand. Ohne Qualen, ohne Bedauern. Und ich? Ich vermisse dich immer noch. Und hasse mich selbst deswegen., Kenichi wusste nicht, ob er sie wecken sollte oder nicht. Er zögerte vor dem Vorhang ihrer Schlafkoje und überlegte, ob er noch einmal rufen sollte. Es war so eine unwichtige Sache, und er wollte sie nur ungern stören. Beim Abendessen hatte sie so müde ausgesehen; sie war sogar mit der Gabel in der Hand eingenickt. Wenn die Erdanziehungskraft wegfällt, sinkt der Körper nicht in sich zusammen, wenn man einschläft oder das Bewusstsein verliert, und so wird man auch nicht wie auf der Erde mit einem Ruck wach, weil einem der Kopf nach vorne fällt. Es war schon vorgekommen, dass übermüdete Astronauten während einer Reparatur einfach mit dem Werkzeug in der Hand eingeschlafen waren. Er beschloss, sie nicht zu wecken, und kehrte allein in das US- Labor zurück. Kenichi hatte noch nie mehr als fünf Stunden Schlaf gebraucht, und wenn die anderen in ihren Kojen lagen, streifte er oft durch das Labyrinth der Raumstation und sah bei seinen verschiedenen Experimenten nach dem Rechten. Alles überprüfte und erkundete er. Es schien, als ob der eigene geheimnisvolle Charakter der Station sich erst offenbarte, wenn die Menschen an Bord schliefen. Dann war sie ein eigenständiges Wesen, das summte, knisterte und knackte, ein elektronischer Organismus, durch dessen Nervenbahnen und Adern aus Draht Befehle hin und her zischten, die Tausende von verschiedenen Funktionen steuerten. Während Kenichi durch das Labyrinth von Tunneln und Röhren schwebte, musste er an all die Menschenhände denken, deren Arbeit in jedem einzelnen Quadratzentimeter dieser Konstruktion steckte. Die Elektriker und Metallarbeiter, die Kunststoffformer. Die Glaser. Ihrer Mühe war es zu verdanken, dass ein in einem abgelegenen japanischen Bergdorf aufgewachsener Bauernsohn jetzt dreihundertfünfzig Kilometer über der Erde schwebte. Kenichi war inzwischen einen Monat an Bord der Station,, doch immer noch versetzten ihn all diese Dinge in ehrfürchtiges Staunen. Er wusste, dass sein Aufenthalt hier begrenzt war. Er kannte den Tribut, der von seinem Körper gefordert wurde: der stetige Kalziumverlust in den Knochen, das Verkümmern der Muskeln, die Schwächung von Herz und Arterien wegen der fehlenden Belastung durch die Schwerkraft. Jeder Moment an Bord der ISS war kostbar, und er wollte keine Minute vergeuden. Und so war er während der Stunden der Nachtruhe immer auf Achse, warf hier und da einen Blick durch ein Fenster oder stattete den Tieren im Labor einen Besuch ab. Dabei hatte er auch die tote Maus entdeckt. Sie hatte mit starr von sich gestreckten Beinen in der Luft geschwebt, das kleine rosa Maul weit aufgerissen. Wieder eins von den Männchen. Es war die vierte tote Maus in sechzehn Tagen. Er vergewisserte sich, dass das Habitat richtig funktionierte, dass die Temperatureinstellungen nicht verändert worden waren und die Luftzuführung immer noch bei den regulären zwölf Umwälzungen pro Stunde lag. Weshalb starben die Mäuse? Konnte es sich um eine Verunreinigung des Wassers oder des Futters handeln? Vor einigen Monaten hatte die Station ein Dutzend Ratten verloren, weil giftige Chemikalien in die Wasserversorgung des Tierhabitats eingedrungen waren. Die Maus schwebte in einer Ecke des Käfigs. Die übrigen Männchen drängten sich am anderen Ende, als ekelten sie sich vor dem Kadaver ihres Käfiggenossen. Fieberhaft suchten sie zu entkommen, klammerten sich mit ihren Pfoten an das Käfiggitter. Auf der anderen Seite der Drahtsperre hockten die weiblichen Mäuse ebenfalls auf einem Haufen zusammen. Bis auf eine. Sie hing in der Luft und drehte sich langsam im Kreis, wobei sie zuckte und krampfartig mit den Beinen strampelte. Wieder war eine krank geworden., Und dann musste er zusehen, wie das Weibchen ein letztes Mal qualvoll nach Luft schnappte und der kleine Körper plötzlich schlaff wurde. Die anderen Weibchen drängten sich noch dichter zusammen, ein verschrecktes Häufchen aus zappelndem weißem Fell. Er musste die Kadaver entfernen, bevor sie die übrigen Mäuse ansteckten – falls es sich tatsächlich um etwas Ansteckendes handelte. Er koppelte das Habitat mit dem biowissenschaftlichen Handschuhkasten, zog sich Latexhandschuhe über und schob die Hände durch die Gummiabdichtungen. Zuerst fischte er aus der Seite für die Männchen den Kadaver heraus und steckte ihn in einen Plastikbeutel. Dann öffnete er den Käfig der Weibchen und streckte die Hand nach der zweiten toten Maus aus. Während er sie herauszog, schoss plötzlich ein weißes Fellknäuel an seiner Hand vorbei. Eine der Mäuse war in die Handschuhbox entkommen. Er schnappte sie aus der Luft. Und ließ sie sofort wieder los, als er den stechenden Schmerz spürte. Sie hatte ihn durch den Handschuh in den Finger gebissen. Er zog sofort die Hände aus dem Kasten, rollte rasch die Handschuhe ab und inspizierte seinen Finger. Ein Tropfen Blut quoll hervor; der unerwartete Anblick verursachte ihm Übelkeit. Er schloss die Augen und schalt sich innerlich. Das hier war gar nichts – kaum mehr als ein Nadelstich. Nichts weiter als die verständliche Rache einer Maus für all die Spritzen, mit denen er sie und ihre Artgenossen gepiesackt hatte. Er schlug die Augen wieder auf, doch die Übelkeit hielt an. Ich brauche Ruhe, dachte er. Er fing die sich sträubende Maus wieder ein und verfrachtete sie in den Käfig. Dann nahm er die beiden Beutel mit den Kadavern heraus und legte sie in den Kühlschrank. Morgen würde er sich um das Problem kümmern. Morgen, wenn es ihm, wieder besser ging. 30. Juli »Diese hier habe ich heute Morgen tot gefunden«, sagte Kenichi. »Das ist schon die Sechste.« Emma betrachtete skeptisch die Mäuse im Tierhabitat. Sie waren in einem unterteilten Käfig untergebracht, Männchen und Weibchen nur durch ein Drahtgitter voneinander getrennt. Sie atmeten dieselbe Luft, fraßen dasselbe Futter und tranken von demselben Wasser. Auf der Seite der Männchen schwebte eine tote Maus regungslos in der Luft, die Beine steif vom Körper weggestreckt. Die anderen Männchen hingen alle am anderen Ende des Käfigs aufeinander und kratzten am Gitter, als versuchten sie in Panik zu entkommen. »Sie haben in siebzehn Tagen sechs Mäuse verloren?« »Fünf Männchen. Ein Weibchen.« Emma suchte die übrigen Tiere nach Anzeichen von Erkrankungen ab. Sie schienen alle munter zu sein; ihre Augen glänzten, ihre Nasenlöcher waren frei von Schleim. »Holen wir zuerst diese tote Maus heraus«, sagte sie. »Anschließend können wir uns die anderen genauer ansehen.« Mit Hilfe der Handschuhbox entfernte sie den Kadaver. Die Totenstarre war bereits eingetreten; die Beine waren steif, das Rückgrat ließ sich nicht biegen. Das Maul stand halb offen, und die rosafarbene Zungenspitze lugte hervor. Es war keineswegs ungewöhnlich, dass Versuchstiere im Weltraum verendeten. Bei einem Shuttleflug im Jahre 1998 hatte die Sterblichkeit unter den neugeborenen Ratten fast hundert Prozent betragen. Die Mikrogravitation war ein fremder Lebensraum, an den nicht alle Arten sich ohne weiteres anpassen konnten. Diese Mäuse waren vor dem Flug auf eine ganze Reihe von, Bakterien, Pilzen und Viren durchgecheckt worden. Falls es sich um eine Infektion handelte, mussten sie sich an Bord der ISS angesteckt haben. Sie legte die tote Maus in einen Plastikbeutel, wechselte die Handschuhe und steckte die Hände wieder in den Käfig, um eine der lebenden Mäuse einzufangen. So heftig, wie das Tier sich sträubte und wand, war es vermutlich bei guter Gesundheit. Das einzig Auffallende war ein zerfetztes Ohr, das wohl von den Käfiggenossen angeknabbert worden war. Sie drehte die Maus um, damit sie ihren Bauch untersuchen konnte, und stieß einen überraschten Laut aus. »Es ist ein Weibchen«, sagte sie. »Was?« »Sie hatten ein Weibchen im Käfig der Männchen.« Kenichi trat näher und warf durch das Sichtfenster des Handschuhkastens einen Blick auf die Genitalien der Maus. Es war nicht zu übersehen. Sein Gesicht lief vor Scham dunkelrot an. »Das war letzte Nacht«, erklärte er. »Sie hat mich gebissen. Ich habe sie dann schnell wieder reingesetzt.« Emma lächelte ihn verständnisvoll an. »Nun ja, das Schlimmste, was uns passieren kann, ist ein unerwarteter Babyboom.« Kenichi zog sich Handschuhe über und steckte die Hände durch das zweite Paar Armlöcher in die Handschuhbox. »Ich habe Fehler gemacht«, sagte er. »Ich mache es wieder gut.« Zusammen untersuchten sie die restlichen Mäuse in dem Käfig, fanden aber keine weiteren verirrten Exemplare. Alle schienen gesund. »Das ist äußerst merkwürdig«, sagte Emma. »Wenn wir es mit einer ansteckenden Krankheit zu tun hätten, müssten doch irgendwelche Anzeichen für eine Infektion zu erkennen sein …«, »Watson?«, rief eine Stimme über die Lautsprecheranlage des Moduls. »Im Labor, Griggs«, antwortete sie. »Sie haben eine dringende E-Mail von der Nutzlastzentrale.« »Ich seh sie mir gleich an.« Sie verschloss das Terrarium und sagte zu Kenichi: »Lassen Sie mich rasch meine E-Mail lesen. Sie können ja inzwischen die Mäusekadaver herausnehmen, die Sie im Kühlschrank gelagert haben. Wir sehen sie uns dann gemeinsam an.« Er nickte und machte sich auf den Weg zum Kühlschrank. Am Computerarbeitsplatz des Labors rief sie ihre E-Mail auf. An: Dr. Emma Watson Absender: Helen Koenig, Wissenschaftliche Leiterin Betreff: Experiment CCU Nr. 23 (Archäen-Zellkultur) Nachricht: Das Experiment sofort abbrechen. Jüngste von Atlantis überbrachte Proben weisen Verunreinigung durch Pilze auf. Alle Archäenkulturen sollten samt Behälter im Verbrennungsofen vernichtet werden; die Asche ist über Bord zu werfen. Emma las die Nachricht auf dem Bildschirm ein ums andere Mal. Sie hatte noch nie eine so sonderbare Aufforderung erhalten. Pilzbefall war an sich nichts Gefährliches. Die Kulturen einzuäschern kam ihr wie eine extreme Überreaktion vor. Die rätselhafte Aufforderung beschäftigte sie so sehr, dass sie Kenichi, der gerade die toten Mäuse aus dem Kühlschrank nahm, ganz vergessen hatte. Erst als sie seinen erschrockenen Ausruf hörte, drehte sie sich zu ihm um. Zuerst sah sie nur sein geschocktes Gesicht, das mit ekelhaften Klumpen von Gedärm bespritzt war. Dann fiel ihr Blick auf den Plastikbeutel, der gerade aufgeplatzt war. Vor Schreck hatte, Kenichi ihn losgelassen, sodass er jetzt zwischen ihnen in der Luft schwebte. »Was ist denn das?« Mit ungläubigem Entsetzen antwortete er: »Die Maus.« Doch was sie da in dem Beutel sah, war keine tote Maus. Sondern eine Masse von zerfallenem Gewebe, ein fauliger Brei aus Fleisch und Fell, aus dem sich jetzt übel riechende Tropfen lösten. Biologischer Alarm! Sie schoss quer durch das Modul auf die Alarm- und Sicherheitskonsole zu, wo sie mit einem Knopfdruck den Luftaustausch zwischen den Modulen unterbrach. Kenichi hatte bereits den Notfallschrank geöffnet und zwei Filtermasken herausgenommen. Er warf ihr eine davon zu, und sie legte sie über Nase und Mund. Sie mussten kein Wort sprechen; beide wussten genau, was zu tun war. Rasch schlossen sie die Luken an beiden Enden des Moduls, wodurch das Labor praktisch vom Rest der Station abgeriegelt war. Dann nahm Emma einen Isolierbeutel für biologisches Material und näherte sich vorsichtig dem dahintreibenden Behälter mit dem zersetzten Fleisch. Durch die Oberflächenspannung wurden die flüssigen Partikel in einem einzigen großen Klumpen zusammengehalten; wenn sie darauf achtete, dass es keine größere Luftbewegung gab, gelang es ihr vielleicht, den Beutel einzufangen, ohne dass irgendwelche Tröpfchen entkamen. Behutsam stülpte sie den Isolierbeutel über das frei schwebende Material und versiegelte ihn sofort. Sie hörte Kenichi erleichtert aufseufzen. Gefahr gebannt. »Ist im Kühlschrank etwas ausgelaufen?«, fragte sie. »Nein. Erst als ich es herausgenommen habe.« Er wischte sich das Gesicht mit einem Alkoholtupfer ab, den er anschließend sogleich sicher entsorgte. »Der Beutel, er war … so richtig aufgeblasen. Wie ein Ballon.«, Der Inhalt hatte unter Druck gestanden, weil der Verwesungsprozess Gase freigesetzt hatte. Durch den Plastikbeutel konnte sie das Todesdatum auf dem Etikett erkennen. Das ist unmöglich, dachte sie. Innerhalb von fünf Tagen war der Kadaver zu einem schwarzen Brei aus verfaultem Fleisch zerfallen. Der Beutel fühlte sich kalt an; der Kühlschrank funktionierte also. Trotz der kühlen Lagerung hatte irgendetwas den Verwesungsprozess beschleunigt. Etwa Fleisch fressende Streptokocken? Oder eine andere, ebenso aggressive Bakterienart? Sie sah Kenichi an und dachte: Es ist ihm ins Auge gespritzt. »Wir müssen mit Ihrem wissenschaftlichen Leiter sprechen«, sagte sie. »Mit demjenigen, der uns die Mäuse geschickt hat.« Es war erst fünf Uhr morgens Pazifischer Sommerzeit, doch die Stimme von Dr. Michael Loomis, dem wissenschaftlichen Leiter des Experiments »Konzeption und Gestation bei Mäusen unter Weltraumbedingungen«, klang hellwach und offensichtlich besorgt. Er sprach vom Ames Research Center in Kalifornien aus mit Emma. Obwohl sie ihn nicht sehen konnte, fiel es ihr nicht schwer, sich den Mann vorzustellen, der zu dieser durchdringenden Stimme gehörte: hochgewachsen, voller Energie – ein Mann, für den fünf Uhr morgens normale Arbeitszeit ist. »Wir beobachten diese Tiere seit einem Monat«, sagte Loomis. »Für die Mäuse ist das Experiment mit relativ geringem Stress verbunden. Wir hatten vor, die Männchen und Weibchen nächste Woche zusammenzuführen, in der Hoffnung, dass sie sich erfolgreich paaren und fortpflanzen. Dieses Experiment hat bedeutende Folgerungen für Raumflüge über längere Zeiträume. Für die Besiedlung fremder Planeten. Sie können sich vorstellen, dass diese Todesfälle sehr beunruhigend sind.« »Wir haben bereits Kulturen angelegt«, antwortete Emma., »Alle toten Mäuse scheinen viel schneller zu verwesen, als normalerweise. Der Zustand der Kadaver ist so, dass ich befürchte, es könnte sich um eine Infektion mit Clostridia oder Streptokokken handeln.« »So gefährliche Bazillen an Bord der Station? Das wäre ein ernsthaftes Problem.« »Eben. Gerade in einer abgeschlossenen Umgebung wie der unseren. Wir wären alle in Gefahr.« »Was halten Sie von einer Autopsie an den toten Mäusen?« Emma zögerte. »Wir sind hier nur auf den Umgang mit Kontaminierungen zweiten Grades eingerichtet. Wenn es sich um einen gefährlichen Krankheitserreger handeln sollte, darf ich nicht das Risiko eingehen, andere Tiere zu infizieren. Oder gar Menschen.« Am anderen Ende war es still. Dann sagte Loomis: »Ich verstehe. Und ich muss Ihnen wohl zustimmen. Sie werden also alle Kadaver sicher entsorgen?« »Unverzüglich«, antwortete Emma. 31. Juli Zum ersten Mal, seit er auf der ISS war, konnte Kenichi nicht einschlafen. Schon vor Stunden war er in seine Koje gekrochen, aber noch immer lag er wach, noch immer grübelte er über das Rätsel der toten Mäuse nach. Obwohl niemand ein vorwurfsvolles Wort an ihn gerichtet hatte, fühlte er sich irgendwie verantwortlich für das Scheitern des Experiments. Er überlegte hin und her, was er falsch gemacht hatte. Hatte er eine verunreinigte Kanüle benutzt, um den Tieren Blut abzunehmen, oder hatte er die Regler für die Umweltbedingungen im Habitat nicht richtig eingestellt? Die Gedanken an all die Fehler, die ihm hätten unterlaufen können, ließen ihn keinen Schlaf finden., Außerdem war da dieser pochende Schmerz in seinem Kopf. Die Beschwerden hatten am Morgen angefangen, zunächst nur in Form eines leichten Kribbeins um ein Auge herum. Im Laufe des Tages war es immer schmerzhafter geworden, und jetzt tat ihm die ganze linke Kopfhälfte weh. Es waren keine unerträglichen Schmerzen, sondern nur ein dumpfes Pochen, das ihm keine Ruhe ließ. Er öffnete den Reißverschluss seines Schlafsacks. Da er ohnehin nicht schlafen konnte, wollte er lieber noch einmal nach den Mäusen sehen. Er schwebte an dem geschlossenen Vorhang von Nikolais Schlafstelle vorbei auf die Verbindungsmodule zu, die zu der amerikanischen Hälfte der Station führten. Erst als er im Labor angelangt war, bemerkte er, dass außer ihm noch jemand wach war. Aus dem angrenzenden NASDA-Labor drang leises Gemurmel. Geräuschlos schwebte er in den Verbindungsknoten 2 und warf einen Blick durch die geöffnete Luke. Er sah Diana Estes und Michael Griggs in inniger Umarmung, die Lippen in wilder Gier aufeinander gepresst. Er wich zurück, ohne dass sie ihn bemerkt hatten. Sein Gesicht glühte angesichts der Situation, deren Zeuge er gerade geworden war, vor Verlegenheit. Und was nun? Sollte er sie in Ruhe lassen und in seine Koje zurückkehren? Das ist nicht in Ordnung, dachte er mit plötzlichem Groll. Ich bin hier, um zu arbeiten, um meinen Pflichten nachzugehen. Er schwebte zum Tierhabitat hinüber. Beim Öffnen und Schließen der Schubfächer machte er absichtlich jede Menge Lärm, und kurz darauf tauchten, wie er es erwartet hatte, Diana und Griggs in der Luke auf. Beide waren ziemlich rot im Gesicht. Und das mit gutem Grund, dachte er, bei dem, was sie gerade getrieben haben. »Wir hatten ein Problem mit der Zentrifuge«, log Diana. »Ich, denke, wir haben den Fehler jetzt beseitigt.« Kenichi nickte nur und ließ sich nicht im Geringsten anmerken, dass er die Wahrheit kannte. Diana blieb cool wie immer, was ihn entsetzte und zugleich verärgerte. Griggs besaß immerhin den Anstand, ein wenig schuldbewusst dreinzuschauen. Kenichi sah ihnen nach, als sie durch die Luke hinausschwebten. Dann wandte er seine Aufmerksamkeit endlich dem Habitat zu. Er starrte in den Käfig. Eine weitere Maus war tot. Ein Weibchen. 1. August Gelassen streckte Diana Estes den Arm zum Abbinden aus und ballte die Hand mehrmals hintereinander zur Faust, um die Ellenbeugenvene aufzupumpen. Als die Nadel ihre Haut durchbohrte, zuckte sie nicht zusammen und sah auch nicht weg; im Gegenteil, Diana war so unbeeindruckt, als würde das Blut gar nicht ihr selbst abgezapft. Die Astronauten machten in dieser Hinsicht im Laufe ihres Berufslebens einiges mit. Bei den Untersuchungen im Rahmen des Auswahlverfahrens wurde ihnen mehrfach Blut abgenommen; hinzu kamen Belastungstests und eine ganze Liste von bohrenden Fragen. Über ihre Blutbilder, EKGs und Zellzählungen wurde permanent Buch geführt, und Experten für Raumfahrtmedizin beschäftigten sich eingehend mit den Ergebnissen. Sie mussten mit Elektroden gespickt auf Laufbändern hecheln und schwitzen, von ihren Körperflüssigkeiten wurden Kulturen angelegt, und man untersuchte ihre Eingeweide und jeden Quadratzentimeter ihrer Haut. Astronauten waren nicht bloß hoch qualifizierte Fachkräfte, sondern auch Gegenstand von allerlei Experimenten. Sie waren so etwas wie Versuchskaninchen, und während eines Raumflugs mussten sie sich einer ganzen Reihe zuweilen, schmerzhafter Tests unterziehen. Heute wurden wieder einmal Proben gesammelt. Als Bordärztin war Emma jetzt diejenige, die mit der Spritze herumzugehen hatte. Kein Wunder, dass die meisten Kollegen stöhnten, sobald sie auftauchte. Nur Diana hatte einfach ihren Arm hingehalten und sich pieksen lassen. Während Emma darauf wartete, dass sich die Spritze mit Blut füllte, spürte sie den kritischen Blick der anderen Frau, die jede ihrer Bewegungen beobachtete. Wenn Prinzessin Diana Englands Rose war, so witzelte man im JSC, dann war Diana Estes Englands Eiswürfel. Sie war eine Astronautin, die nie die Fassung verlor, selbst wenn um sie herum das totale Chaos ausbrach. Vor vier Jahren war Diana an Bord der Atlantis gewesen, als plötzlich ein Haupttriebwerk ausgefallen war. Auf den Funkaufzeichnungen war zu hören, wie die Stimmen des Shuttle-Commanders und des Piloten sich vor Aufregung fast überschlugen, als sie sich gezwungen sahen, das Shuttle auf einen transatlantischen Notlandeplatz zu steuern. Nicht so Dianas Stimme. Kühl und gelassen war sie die Checkliste durchgegangen, während das Shuttle einer unsicheren Landung in Nordafrika entgegengerast war. Was ihren Ruf als menschlichen Eisblock endgültig besiegelt hatte, waren die Biotelemetriewerte. Während die Herzfrequenzen der anderen allesamt in die Höhe geschossen waren, hatte sich Dianas Puls gerade mal auf gemächliche sechsundneunzig Schläge pro Minute beschleunigt. »Das liegt daran, dass sie kein Mensch ist«, hatte Jack gescherzt. »In Wirklichkeit ist sie ein Androide. Der Prototyp der neuen Astronauten-Baureihe der NASA.« Emma musste zugeben, dass der Frau etwas nicht ganz Menschliches anhaftete., Diana warf einen kurzen Blick auf die Einstichstelle, sah, dass sie nicht mehr blutete, und wandte sich nüchtern und sachlich wieder ihren Experimenten über das Wachstum von Proteinkristallen zu. Sie hatte in der Tat den fast perfekten Körperbau eines Androiden: schlank, feingliedrig, die makellose Haut durch den einmonatigen Aufenthalt im Orbit zu einem milchigen Weiß verblasst. Dazu kam noch ein überragender IQ, wie Emma von Jack erfahren hatte, der mit Diana für die Shuttle-Mission trainiert hatte, an der er dann doch nicht hatte teilnehmen können. Diana besaß einen Doktortitel in Materialwissenschaften und hatte mehr als ein Dutzend Artikel über Zeolithe veröffentlicht – eine Art von Kristallen, die bei der Petroleumverarbeitung Verwendung finden –, bevor sie in das Astronautenkorps aufgenommen worden war. Bei dieser Mission war sie die verantwortliche Wissenschaftlerin für die Forschungen sowohl über organische als auch anorganische Kristalle. Auf der Erde wurde die Kristallbildung durch die Schwerkraft beeinträchtigt. Im Weltraum dagegen wurden die Kristalle größer und wuchsen in komplexeren Formen, wodurch eine gründlichere Analyse ihrer Struktur möglich wurde. Hunderte von menschlichen Proteinen, von Angiotensin bis hin zu Choriongonadotropin, wurden an Bord der ISS in Kristallform gezüchtet – entscheidende pharmakologische Grundlagenforschung, die zur Entwicklung neuer Medikamente führen konnte. Nachdem sie mit Diana fertig war, verließ Emma das ESA- Labor und schwebte hinüber ins Wohnmodul, wo sie Michael Griggs fand. »Sie sind als Nächster dran«, sagte sie. Er seufzte und hielt ihr widerwillig den Arm hin. »Alles im Namen der Wissenschaft.« »Diesmal ist es nur ein einziges Röhrchen«, sagte Emma, während sie das Stauband anlegte. »Wir haben so viele Einstiche, dass wir wie Junkies, aussehen.« Sie schlug ein paar Mal mit der flachen Hand auf die Haut, damit die Vene deutlicher hervortrat. Sogleich wurde sie sichtbar, ein blauer Strang, der sich über seinen muskulösen Arm zog. Griggs hatte immer streng darauf geachtet, in Topform zu bleiben, was während eines Raumflugs keine leichte Sache war. Das Leben im All hinterließ seine Spuren am menschlichen Körper. Die Gesichter der Astronauten waren durch die Verlagerung der Körperflüssigkeiten aufgequollen, und ihre Beinmuskeln schrumpften zusehends, bis schließlich die charakteristischen »Hühnerbeine« aus ihren zu groß wirkenden Shorts ragten. Die Arbeit war anstrengend, die Unannehmlichkeiten ohne Zahl. Nicht zu vergessen die emotionale Belastung durch das enge Zusammenleben mit einer Crew, die ausnahmslos unter Stress stand, sich nie richtig waschen konnte und oft schmutzige Kleidung tragen musste. Emma betupfte die Haut mit Alkohol und stach in die Vene. Das Blut schoss in den Kolben der Spritze. Sie sah nach seinem Gesicht und stellte fest, dass er den Blick abgewandt hatte. »Alles okay?« »Ja. Ich weiß einen geschickten Blutsauger durchaus zu schätzen.« Sie löste das Stauband und hörte seinen erleichterten Seufzer, als sie die Nadel herauszog. »Sie können jetzt frühstücken. Ich habe allen Blut abgenommen außer Kenichi.« Sie ließ den Blick durch das Modul schweifen. »Wo ist er denn?« »Ich habe ihn heute Morgen noch nicht gesehen.« »Hoffentlich hat er noch nichts gegessen, sonst können wir mit seinem Glukosewert nichts anfangen.« Nikolai, der in einer Ecke des Moduls in aller Ruhe sein Frühstück verzehrt hatte, sagte: »Er schläft noch.« »Komisch«, meinte Griggs. »Sonst ist er doch immer als Erster aus den Federn.«, »Er hat nicht sehr gut geschlafen«, sagte Nikolai. »Letzte Nacht habe ich gehört, wie er sich erbrochen hat. Ich frage, kann ich dir helfen, aber er sagt nein.« »Ich sehe mal nach«, sagte Emma. Sie verließ das Wohnmodul und schwebte durch den langen Tunnel in Richtung RSM, wo Kenichis Schlafstelle war. Als sie dort ankam, fand sie den Vorhang zugezogen. »Kenichi?«, rief sie. Keine Antwort. »Kenichi?« Sie zögerte einen Moment, dann zog sie den Vorhang zurück und sah sein Gesicht. Seine Augen waren blutrot unterlaufen. »O mein Gott«, sagte sie., DIE KRANKHEIT, Die Konsole des Flugarztes in der ISS-Bodenkontrolle war mit Dr. Todd Cutler besetzt, einem Arzt, dessen auffallend jugendliches Aussehen ihm bei den Astronauten den Spitznamen »Dougie Howser« eingebracht hatte – nach einer Fernsehserie über einen halbwüchsigen Doktor. In Wirklichkeit hatte Cutler bereits das gesetzte Alter von zweiunddreißig Jahren erreicht und war für seine Besonnenheit und Kompetenz bekannt. Er fungierte während ihres Weltraumaufenthalts als Emmas persönlicher Arzt, und einmal pro Woche hielten sie über eine gesonderte Frequenz eine Art Funksprechstunde ab, bei der sie ihm die intimsten Details über ihre Gesundheit mitteilte. Sie vertraute Todds medizinischen Fähigkeiten und war erleichtert, als sie erfuhr, dass er in diesem Moment im ISS-Kontrollraum in Johnson Dienst tat. »Er hat sklerale Blutungen in beiden Augen«, sagte sie. »Ich habe einen Riesenschreck bekommen, als ich das sah. Ich glaube, er hat sie sich zugezogen, als er sich letzte Nacht so heftig erbrochen hat – durch den plötzlichen Druckanstieg sind in seinen Augen wohl ein paar Blutgefäße geplatzt.« »Das ist im Moment kein so ernstes Problem«, sagte Todd. »Die Blutungen hören von selbst auf. Was haben Sie sonst noch festgestellt?« »Seine Temperatur ist momentan achtunddreißig sechs, Puls hundertzwanzig, Blutdruck einhundert zu sechzig. Herz und Lungen hören sich gut an. Er klagt zwar über Kopfschmerzen, aber ich kann keine neurologischen Veränderungen feststellen. Was mir wirklich Sorgen macht, ist die Tatsache, dass keine Darmgeräusche zu hören sind und die Bauchdecke diffus druckempfindlich ist. Er hat sich allein in der letzten Stunde mehrmals erbrochen – allerdings bisher ohne Blut.« Sie machte, eine Pause. »Tod, er sieht einfach krank aus. Und die schlechte Nachricht kommt noch: Ich habe gerade seinen Amylasespiegel gemessen, er liegt bei sechshundert.« »Oh, verdammt. Glauben Sie, er hat eine Pankreatitis?« »Bei steigender Amylase ist das auf jeden Fall eine Möglichkeit.« Amylase ist ein Enzym, das in der Bauchspeicheldrüse gebildet wird. Wenn das Organ sich entzündet, schießt der Wert gewöhnlich in die Höhe. Aber Emma wusste, dass ein hoher Amylasespiegel auch durch andere Prozesse in der Bauchhöhle verursacht werden konnte, etwa durch eine Darmperforation oder ein Zwölffingerdarmgeschwür. »Seine Leukozyten sind auch erhöht«, sagte Emma. »Ich habe Blutkulturen angelegt, nur zur Sicherheit.« »Wie ist seine Vorgeschichte? Irgendetwas Auffallendes?« »Zwei Dinge. Erstens hat er unter emotionalem Stress gestanden. Eines seiner Experimente ist schief gelaufen, und er fühlt sich dafür verantwortlich.« »Und das Zweite?« »Vor zwei Tagen ist ihm etwas ins Auge gespritzt. Es waren Körperflüssigkeiten einer toten Labormaus darin.« »Erzählen Sie mir mehr davon.« Todds Stimme klang plötzlich sehr leise. »Die Mäuse in diesem Experiment sind aus unerfindlichen Gründen eine nach der anderen gestorben. Die Kadaver sind verblüffend schnell verwest. Ich befürchtete, irgendwelche Krankheitserreger könnten die Ursache sein, und habe deshalb Proben der Körperflüssigkeiten genommen, um Kulturen anzulegen. Leider sind diese Kulturen alle verdorben.« »Wie das?« »Ich glaube, es war Pilzbefall. Die Schalen haben sich plötzlich grün verfärbt; ich musste sie alle wegwerfen. Es sind, aber keine bekannten Krankheitserreger nachweisbar. Das Gleiche ist bei einem anderen Experiment passiert, einer Zellkultur von Meeresorganismen. Wir mussten dieses Projekt abbrechen, weil in das Kulturröhrchen Pilze eingedrungen sind.« Pilzbefall war, trotz der ständigen Luftzirkulation, leider kein ungewöhnliches Problem in einer geschlossenen Umgebung wie der ISS. An Bord der alten Mir hatten sich die Fenster manchmal mit einer Schicht aus Schimmelpilzen überzogen. Ist die Luft in einem Raumschiff einmal von solchen Organismen befallen, dann ist es schier unmöglich, sie wieder loszuwerden. Glücklicherweise waren sie im Großen und Ganzen harmlos für Menschen und Labortiere. »Wir wissen also nicht, ob er irgendwelchen Krankheitserregern ausgesetzt war«, sagte Todd. »Nein. Im Moment sieht es eher nach einem Fall von Pankreatitis aus als nach einer Bakterieninfektion. Ich habe einen Zugang gelegt, und ich denke, eine Magensonde ist auch fällig.« Sie hielt inne und fügte dann zögernd hinzu: »Wir müssen uns Gedanken über eine Notevakuierung machen.« Am anderen Ende war es lange still. Dies war das Szenario, das alle fürchteten; die Entscheidung, die niemand treffen wollte. Das CRV, das »Rettungsboot« der Station, das immer an die ISS gekoppelt blieb, solange Personal an Bord war, bot genug Platz für alle sechs Astronauten. Da die Sojus-Kapsel nicht mehr betriebsbereit war, blieb nur das CRV als Fluchtfahrzeug. Wenn es eingesetzt wurde, dann nur mit der gesamten Besatzung an Bord. Wegen eines einzigen kranken Crewmitglieds wären sie gezwungen, die ISS zu verlassen, was wiederum das Ende für Hunderte von Weltraumexperimenten bedeutete. Es wäre ein äußerst schwerer Rückschlag für die Station. Aber es gab eine Alternative. Sie konnten auf den nächsten Shuttleflug warten, um Kenichi zu evakuieren. Letztendlich war, es eine medizinische Entscheidung: Konnte er so lange warten? Emma wusste, dass die NASA sich auf ihr ärztliches Urteil verließ, und die Verantwortung lastete schwer auf ihren Schultern. »Wie wäre es mit einer Shuttle-Evakuierung?« Todd Cutler war sich des Dilemmas bewusst. »Wir haben die Discovery auf der Startrampe für STS 161, Start minus fünfzehn Tage. Aber diese Mission ist als militärisch eingestuft. Bergung und Reparatur von Satelliten. Die Crew von 161 ist nicht auf ein Rendezvous mit der ISS vorbereitet.« »Und wenn man sie durch Kittredges Team ersetzt? Durch meine alte Crew von 162? Schließlich sollen die ohnehin in sieben Wochen planmäßig hier andocken. Sie sind vorbereitet.« Emma warf Michael Griggs, der sich in der Nähe aufhielt und das Gespräch mitgehört hatte, einen Blick zu. Sein oberstes Ziel als Kommandant der ISS war es, den ungestörten Betrieb der Station zu gewährleisten, und daher war er strikt gegen eine vollständige Evakuierung. Jetzt schaltete er sich in die Unterhaltung ein. »Cutler, hier spricht Griggs. Wenn meine Crew evakuiert wird, verlieren wir Experimente. Dann ist die Arbeit von vielen Monaten umsonst gewesen. Eine Rückholung per Shuttle scheint mir das Sinnvollste zu sein. Wenn Kenichi nach Hause muss, dann kommt ihr eben und holt ihn ab. Aber lasst uns hier bleiben und unsere Arbeit machen.« »Haben wir denn so viel Zeit?«, wollte Todd wissen. »Wie schnell könnt ihr den Vogel herschicken?«, fragte Griggs zurück. »Das ist eine Frage der Logistik. Startfenster …« »Sagen Sie einfach, wie lange es dauert.« Cutler zögerte. »Flugdirektor Ellis steht neben mir. Bitte sehr, Flight.«, Was als vertrauliches Gespräch zwischen zwei Ärzten auf einer gesonderten Frequenz begonnen hatte, war nun zu einer regelrechten Konferenz geworden. Sie hörten Woody Ellis sagen: »Sechsunddreißig Stunden. Das ist der frühestmögliche Starttermin.« In sechsunddreißig Stunden konnte sich vieles ändern, dachte Emma. Ein Geschwür konnte aufbrechen oder zu bluten beginnen. Eine Pankreatitis konnte zu Schock und Kreislaufkollaps führen. Oder Kenichi konnte sich vollständig erholen, wenn seine Erkrankung nichts Schlimmeres war als ein heftiger Darminfekt. »Dr. Watson hat den Patienten untersucht«, sagte Ellis. »Wir müssen uns auf ihr Urteil verlassen. Wie ist der klinische Befund?« Emma dachte kurz nach. »Er hat kein akutes Abdomen – jedenfalls im Moment nicht. Aber die Lage könnte sich rapide verschlimmern.« »Sie sind sich also nicht sicher?« »Nein.« »Wenn Sie uns Bescheid geben, brauchen wir immer noch vierundzwanzig Stunden zum Auftanken.« Ein ganzer Tag Verzögerung zwischen einem eventuellen Notruf und dem Start des Shuttle, hinzu käme noch die Zeit für das Rendezvous. Würde sie ihn so lange am Leben halten können, falls sich Kenichis Zustand plötzlich extrem verschlechterte? Die Situation wurde allmählich zu einer Nervenprobe. Sie war Ärztin und keine Wahrsagerin. Sie hatte keinen Röntgenapparat zur Verfügung, keinen OP Die Resultate der Untersuchung und der Bluttests waren abnorm, aber unspezifisch. Wenn sie sich entschied, die Rückführung aufzuschieben, würde Kenichi vielleicht sterben. Ein verfrühter, Notruf hingegen hätte zur Folge, dass Millionen von Dollar für einen unnötigen Start verpulvert wurden. So oder so – eine falsche Entscheidung würde das Ende ihrer NASA-Karriere bedeuten. Das war genau der Drahtseilakt, von dem sie Jack geschrieben hatte. Wenn ich versage, erfährt es die ganze Welt. Sie wollen alle nur wissen, ob ich als Frau das Zeug dazu habe. Sie warf einen Blick auf den Computerausdruck mit Kenichis Blutwerten. Nichts, was sie dort sah, rechtfertigte eine Panikreaktion. Noch nicht. Sie sagte: »Flight, ich werde ihm weiter Infusionen geben und eine Magensonde zum Absaugen legen. Im Moment scheinen seine Werte stabil zu sein. Ich wüsste nur zu gern, was in seinem Bauch vor sich geht.« »Also ist Ihrer Meinung nach ein vorgezogener Shuttlestart noch nicht erforderlich?« Sie atmete einmal tief durch. »Nein. Noch nicht.« »Wir halten uns trotzdem bereit, die Lunte an die Discovery zu legen, sobald es nötig sein sollte.« »Ich bin Ihnen sehr dankbar. Ich melde mich wieder und gebe Ihnen den neuesten medizinischen Befund durch.« Sie beendete das Gespräch und sah Griggs an. »Ich hoffe, ich habe die richtige Entscheidung getroffen.« »Machen Sie ihn einfach wieder gesund, okay?« Sie machte sich auf, um nach Kenichi zu sehen. Da er die ganze Nacht betreut werden musste, hatte sie ihn aus dem Wohnmodul in das amerikanische Labor verlegt, um die Nachtruhe der Crew nicht zu stören. Er lag in seinem gesicherten Schlafsack. Eine Infusionspumpe sorgte für eine stetige Zufuhr von Salzlösung. Kenichi war wach und hatte offensichtlich starke Beschwerden. Luther und Diana, die bei dem Patienten gewacht hatten,, wirkten erleichtert, als sie Emma sahen. »Er hat wieder erbrochen«, sagte Diana. Emma schnallte ihre Füße fest, um genügend Halt zu haben, und setzte sich das Stethoskop auf. Vorsichtig legte sie die Membran auf Kenichis Bauch. Immer noch keine Darmgeräusche. Sein Verdauungstrakt arbeitete nicht mehr, und in seinem Magen würde sich Flüssigkeit ansammeln. »Kenichi«, sagte sie. »Ich werde einen Schlauch in Ihren Magen einführen. Das wird die Schmerzen lindern, und vielleicht hört dann auch das Erbrechen auf.« »Was – was für einen Schlauch?« »Eine Magensonde.« Sie öffnete den Wandschrank mit dem medizinischen Notfall-Set. Hier fand sich eine Fülle von unterschiedlichen Instrumenten und Medikamenten, eine Ausrüstung wie in einem modernen Rettungswagen. In dem Fach mit der Aufschrift »Atemwege« waren diverse Schläuche, Absaugvorrichtungen, Auffangbehälter sowie ein Laryngoskop. Sie riss die Verpackung der langen Magensonde auf. Es war ein dünner, zusammengerollter Schlauch aus biegsamem Plastik mit abgerundeter, perforierter Spitze. Kenichis blutrote Augen weiteten sich. »Ich bin so behutsam wie möglich«, sagte sie. »Sie können helfen, das Ganze zu beschleunigen, indem Sie einen Schluck Wasser trinken, wenn ich es Ihnen sage. Ich führe dieses Ende hier in Ihr Nasenloch ein. Der Schlauch dringt in den Rachenraum vor, und wenn Sie dann das Wasser schlucken, rutscht er in Ihren Magen weiter. So richtig unangenehm ist es nur am Anfang, wenn ich die Sonde einführe. Sobald sie einmal sitzt, dürfte sie Sie kaum noch stören.« »Wie lange muss sie drin bleiben?« »Mindestens einen Tag. So lange, bis Ihr Darm wieder arbeitet.« Sanft fügte sie hinzu: »Es ist wirklich notwendig, Kenichi.«, Er seufzte und nickte ergeben. Emma sah Luther an, den der Gedanke an diesen Schlauch noch mehr zu entsetzen schien als den Patienten selbst. »Er braucht einen Schluck Wasser. Holst du uns bitte etwas?« Dann wandte sie sich Diana zu, die in der Nähe schwebte. Wie gewöhnlich wirkte Diana ungerührt, als gehe die ganze Krise sie nichts an. »Wir müssen die Saugdrainage vorbereiten.« Automatisch griff Diana nach der Absaugvorrichtung und dem Auffangbeutel. Emma rollte die Magensonde auf. Zuerst tauchte sie die Spitze in ein Gleitgel; so würde die Sonde leichter durch den Nasenrachenraum rutschen. Dann reichte sie Kenichi den Wasserbeutel, den Luther gefüllt hatte. Aufmunternd drückte sie Kenichis Arm. Obwohl ihm die Angst ins Gesicht geschrieben stand, antwortete er mit einem zustimmenden Nicken. Emma führte das perforierte Ende der Sonde mit dem Gleitmittel in Kenichis rechtes Nasenloch ein und schob es vorsichtig weiter in den Rachenraum. Er würgte, seine Augen tränten, und er begann heftig zu husten, als der Schlauch in seinen Hals glitt. Unter Zuckungen kämpfte er gegen den überwältigenden Drang an, sie wegzustoßen und sich den Schlauch aus der Nase zu reißen. »Trinken Sie einen Schluck Wasser«, drängte sie ihn. Er holte keuchend Luft und führte mit zitternder Hand den Strohhalm an die Lippen. »Schlucken, Kenichi«, sagte sie. Wenn ein Schluck Wasser durch die Kehle in die Speiseröhre befördert wird, legt sich der Kehldeckel reflexartig über den Eingang der Luftröhre, sodass kein Wasser in die Lunge gelangen kann. Denselben Effekt macht man sich zunutze, um eine Magensonde korrekt einzuführen. Sobald sie sah, dass, Kenichi zu schlucken begann, führte sie den Schlauch rasch noch etwas tiefer ein, sodass er durch die Speiseröhre glitt und die Spitze schließlich in den Magen eintauchte. »Schon erledigt«, sagte sie, während sie den Schlauch mit Heftpflaster an seiner Nase befestigte. »Das haben Sie gut gemacht!« »Fertig zum Absaugen«, meldete Diana. Emma verband die Magensonde mit der Absaugvorrichtung. Es gurgelte ein paar Mal, und dann sahen sie, wie eine Flüssigkeit den Schlauch füllte und aus Kenichis Magen in den Auffangbehälter floss. Sie war grünlich wie Galle. Kein Blut, wie Emma erleichtert feststellte. Vielleicht war das schon alles, was er an Behandlung brauchte: Ruhigstellung des Verdauungsapparats, Saugdrainage und intravenöse Flüssigkeitszufuhr. Sollte er tatsächlich eine Pankreatitis haben, würde ihm diese Therapie über die nächsten paar Tage helfen, bis das Shuttle ankam und ihn abholte. »Mein Kopf … tut weh«, sagte Kenichi und schloss die Augen. »Ich gebe Ihnen etwas gegen die Schmerzen«, sagte Emma. »Was meinen Sie? Krise abgewendet?« Es war Griggs’ Stimme. Er hatte die Prozedur von der Luke aus beobachtet, und obwohl die Sonde jetzt an Ort und Stelle war, hielt Griggs immer noch gebührenden Abstand, als ob ihm der bloße Anblick eines Kranken zuwider sei. Er sah den Patienten nicht einmal an, sondern hielt den Blick starr auf Emma gerichtet. »Das bleibt abzuwarten«, erwiderte sie. »Was soll ich Houston sagen?« »Ich habe die Sonde eben erst eingeführt. Es ist noch zu früh.« »Wir müssen ihnen bald Bescheid geben.« »Ich weiß es aber nun mal nicht!«, gab sie gereizt zurück. Dann fasste sie sich und fuhr mit ruhigerer Stimme fort:, »Können wir das bitte im Wohnmodul besprechen?« Sie ließ Luther bei dem Kranken zurück und schwebte auf die Luke zu. Im Wohnmodul gesellten sich Nikolai und Griggs zu ihr. Sie versammelten sich um den Kombüsentisch wie zu einer Mahlzeit. Was sie stattdessen jedoch teilten, war ihre Frustration angesichts einer ungewissen Situation. »Sie sind hier die Ärztin«, sagte Griggs. »Können Sie denn keine Entscheidung fällen?« »Ich bin bemüht, ihn zu stabilisieren«, antwortete Emma. »Im Moment weiß ich noch nicht, womit ich es zu tun habe. Vielleicht erledigt es sich in den nächsten ein, zwei Tagen von selbst. Vielleicht wird es auch plötzlich schlimmer.« »Und Sie können uns nicht sagen, welcher Fall eintreten wird.« »Ohne Röntgenapparat und ohne OP kann ich nicht feststellen, was in seinem Innern vorgeht. Ich kann nicht voraussagen, wie sein Zustand morgen sein wird.« »Na großartig.« »Ich denke, er sollte wirklich nach Hause. Ich bin dafür, den Start so weit wie möglich vorzuverlegen.« »Und wie steht es mit einer CRV-Evakuierung?«, fragte Nikolai. »Ein regulärer Shuttleflug ist besser geeignet für einen Krankentransport«, sagte Emma. Ein Rückflug im CRV war eine turbulente Angelegenheit, und je nach Wetterlage konnten sie gezwungen sein, an einem für die medizinische Versorgung ungünstigen Ort zu landen. »Vergessen Sie die CRV-Evakuierung«, sagte Griggs bestimmt. »Wir werden diese Station nicht im Stich lassen.« »Und wenn sein Zustand kritisch wird …«, warf Nikolai ein. »Emma wird ihn einfach so lange am Leben halten müssen, bis die Discovery hier ist. Mensch, diese Station ist doch wie, eine Weltraumambulanz! Sie sollte wirklich in der Lage sein, ihn zu stabilisieren.« »Und wenn nicht?«, beharrte Nikolai. »Ein Menschenleben ist mehr wert als all diese Experimente.« »Diese Option ist nur der allerletzte Ausweg«, sagte Griggs. »Wenn wir alle ins CRV steigen, ist die Arbeit von vielen Monaten im Eimer.« »Hören Sie, Griggs«, sagte Emma. »Ich will diese Station ebenso wenig aufgeben wie Sie. Ich habe wie eine Wahnsinnige um meinen Platz hier gekämpft, und ich habe keine Lust, meinen Aufenthalt so bald abzubrechen. Aber wenn mein Patient dringend evakuiert werden muss, werden Sie nach meiner Pfeife tanzen!« »Entschuldigung, Emma«, sagte Diana, die eben durch die Luke hereinkam. »Ich habe gerade Kenichis letzte Bluttests abgeschlossen. Ich denke, Sie sollten das hier sehen.« Sie reichte Emma einen Computerausdruck. Emma starrte auf die Ergebnisse: Creatinphosphokinase: 20,6 (normal 0-3,08). Diese Krankheit war mehr als nur eine Pankreatitis und mehr als eine bloße Verdauungsstörung. Ein hoher CPK-Wert bedeutete, dass entweder seine Muskeln oder sein Herz geschädigt waren. Erbrechen ist manchmal ein Anzeichen für einen Herzinfarkt. Sie sah Griggs an. »Ich habe gerade eine Entscheidung gefällt«, sagte sie. »Sagen Sie Houston, sie sollen das Shuttle losschicken. Kenichi muss zurück zur Erde.« 2. August Jack straffte das Klüversegel. Seine sonnenverbrannten Arme, glänzten vor Schweiß, als er sich gegen die Kurbel stemmte. Mit einem satten Knall spannte sich das Segel, die Sanneke krängte nach Lee, und plötzlich begann ihr Bug schneller durch das trübe Wasser der Galveston Bay zu pflügen. Er hatte den Golf von Mexiko hinter sich gelassen und einige Stunden zuvor am frühen Nachmittag Point Bolivar umsegelt, war der Fähre von Galveston Island ausgewichen und kreuzte nun an der von Raffinerien gesäumten Küste von Texas City entlang in nördlicher Richtung auf Clear Lake zu. Heimwärts. Nach vier Tagen auf See im Golf von Mexiko war er braun gebrannt und ziemlich verwildert. Er hatte niemandem von seinem Vorhaben erzählt, sondern einfach nur Vorräte geladen, die Segel gesetzt und Kurs auf die offene See genommen, bis er kein Land mehr sehen konnte – dorthin, wo die Nächte so schwarz waren, dass das Licht der Sterne ihn geradezu blendete. Auf dem Rücken an Deck liegend hatte er, sanft geschaukelt von den Wellen des Golfs, stundenlang zum Nachthimmel hinaufgeschaut. Mit dem Sternenfeld vor Augen, das sich in alle Richtungen ausdehnte, so weit sein Blick reichte, konnte er sich fast einbilden, er würde durch das Weltall rasen und mit jedem Anschwellen der Dünung tiefer in die Wirbel einer fremden Galaxie geschleudert werden. In seinem Kopf hatten nur noch die Sterne und die See Platz gehabt. Dann war die grelle Lichtspur eines Meteors vorbeigeschossen, und er hatte an Emma gedacht. Er konnte einfach keine Barrikaden um sich herum errichten, die hoch genug waren, sie fern zu halten. Sie war immer da und lag auf der Lauer, um sich plötzlich in seine Gedanken zu schleichen, wenn er am wenigsten damit rechnete. Wenn er es am wenigsten wollte. Er war erstarrt und hatte die Augen nicht von dem ersterbenden Lichtstreifen des Meteors wenden können, und obwohl sich um ihn herum nichts verändert hatte, weder der Wind noch das Auf und Ab der Wellen, hatte er sich mit einem Mal unglaublich allein gefühlt. Es war noch dunkel gewesen, als er die Segel gesetzt und Kurs, auf die Küste genommen hatte. Als er jetzt mit Motorkraft den Kanal zum Clear Lake hinauffuhr, vorbei an Häusern, deren Silhouetten sich gegen das grelle Licht der Abendsonne abzeichneten, bedauerte er seine Entscheidung, so bald zurückzukehren. Auf dem Golf hatte eine stete Brise geweht; hier aber regte sich kein Lüftchen, und es war erdrückend schwül. Er machte an seiner Anlegestelle fest und trat, ein wenig schwankend nach den Tagen auf hoher See, auf den Pier. Als Erstes steht eine kalte Dusche auf der Tagesordnung, dachte er. Das Boot versorge ich am Abend, wenn es etwas kühler ist. Und was Humphrey betrifft – nun, ein weiterer Tag im Tierheim wird dem kleinen Fellknäuel nicht schaden. Mit dem Seesack über der Schulter marschierte er über den Pier. Als er an dem kleinen Lebensmittelladen des Jachthafens vorbeikam, fiel sein Blick auf den Zeitungsständer. Der Seesack entglitt ihm und fiel zu Boden. Er stand da und starrte auf die Schlagzeile der Morgenausgabe der Houston Chronicle: »Countdown für Shuttle-Sondereinsatz hat begonnen – Start für morgen geplant.« Was ist passiert? dachte er. Was ist bloß schief gegangen? Mit zitternden Händen zog er ein paar Münzen aus der Tasche, steckte sie in den Schlitz und nahm sich eine Zeitung. Der Artikel war mit zwei Fotos versehen. Das eine zeigte Kenichi Hirai, den NASDA-Astronauten aus Japan. Das andere Emma. Er schnappte seinen Seesack und rannte los, um ein Telefon zu suchen. Bei der Besprechung waren drei Flugärzte zugegen – für Jack ein Zeichen, dass die Krise, mit der sie es zu tun hatten, in der Tat medizinischer Natur war. Als er den Raum betrat, drehten sich alle überrascht nach ihm um. In den Augen von Woody Ellis, dem Flugdirektor der ISS, las er die unausgesprochene, Frage: Seit wann gehört Jack McCallum denn wieder dazu? Dr. Todd Cutler gab die Antwort: »Jack hat bei der Entwicklung unseres medizinischen Notfallplans für die erste Besatzung der Station mitgewirkt. Ich war der Meinung, er sollte dabei sein.« Ellis schien Bedenken zu haben. »Der persönliche Aspekt verkompliziert die Sache«, sagte er. Was er meinte, war Emma. »Alle Crewmitglieder sind für uns wie Familienmitglieder«, entgegnete Todd. »So gesehen kann man den persönlichen Aspekt gar nicht ausschließen.« Jack nahm neben Todd Platz. Am Tisch saßen außerdem der stellvertretende Direktor des Shuttle-Programms NSTS, der ISS- Einsatzleiter, die Flugärzte sowie verschiedene Programm- Manager. Ebenfalls anwesend war die Pressesprecherin der NASA, Gretchen Liu. Im Grunde ignorierten die Nachrichtenmedien die Arbeit der NASA, sofern nicht gerade ein Start anstand. Heute jedoch drängten sich Journalisten sämtlicher Nachrichtenagenturen in dem winzigen Presseraum des NASA-Medienzentrums, wo sie auf Gretchens Erscheinen warteten. Wie schnell sich die Dinge doch ändern können, dachte Jack. Es war schwer, die Aufmerksamkeit der wankelmütigen Öffentlichkeit zu erregen. Sie verlangte Explosionen, Tragödien, Krisen. Das Wunder einer fehlerlosen Operation lockte niemanden hinter dem Ofen hervor. Todd reichte ihm einen Stapel Papiere. Auf das oberste hatte er eine Notiz gekritzelt: »Hirais Labor- und Untersuchungsergebnisse der letzten 24 Stunden. Willkommen zurück!« Jack blätterte die Berichte durch, während er die Besprechung verfolgte. Er hinkte den Entwicklungen um einen ganzen Tag hinterher und brauchte eine Weile, bis er die wesentlichen Fakten erfasst hatte. Der Astronaut Kenichi Hirai war ernstlich erkrankt, seine Laborwerte waren allen ein Rätsel. Das Shuttle, Discovery stand bereit zum Start, der für 6 Uhr morgens Ortszeit vorgesehen war. Die Besatzung bestand aus Kittredges Crew, ergänzt durch einen Flugarzt. Der Countdown verlief planmäßig. »Hat sich an Ihren Empfehlungen irgendetwas geändert?«, fragte der stellvertretende NSTS-Direktor die Ärzte. »Sind Sie immer noch der Meinung, dass Hirai auf eine Shuttle- Evakuierung warten kann?« Todd Cutler antwortete ihm. »Wir halten das immer noch für die sicherste Alternative. In dieser Hinsicht hat sich an unseren Empfehlungen nichts geändert. Die ISS hat eine recht gute medizinisch-technische Ausstattung; alle Medikamente und Apparaturen für eine kardiopulmonale Reanimation sind an Bord.« »Sie glauben also immer noch, dass er einen Herzinfarkt hatte?« Todd wechselte Blicke mit seinen Kollegen. »Offen gesagt«, gab er zu, »sind wir uns nicht vollkommen sicher. Es gibt gewisse Anzeichen, die auf einen Myokardinfarkt deuten – also das, was allgemein als Herzinfarkt bezeichnet wird. In erster Linie handelt es sich dabei um den Anstieg von Herzenzymen in seinem Blut.« »Und warum sind Sie sich dann immer noch nicht sicher?« »Das EKG weist nur unspezifische Veränderungen auf – lediglich einige T-Inversionen. Das ist nicht das klassische Muster eines Myokardinfarkts. Zudem wurde Hirai vor der Aufnahme in das Programm gründlich auf Herz- und Kreislauferkrankungen untersucht. Er hatte keinerlei Risikofaktoren. Wir wissen ehrlich gesagt nicht, was mit ihm los ist. Aber wir müssen davon ausgehen, dass er einen Herzinfarkt hatte. Das bedeutet, dass eine Shuttle-Evakuierung die beste Lösung ist. Der Wiedereintritt ist sanfter und die Landung besser steuerbar. Die Belastung für den Patienten ist somit wesentlich geringer als bei einer Rückkehr im CRY In der, Zwischenzeit kann die ISS-Crew bei eventuell auftretenden Arrhythmien eingreifen.« Jack sah von den Laborberichten auf, die er durchgelesen hatte. »Ohne die nötige Laborausstattung kann die Station diese CPK-Spiegel nicht fraktionieren. Wie können wir dann wissen, ob das Enzym tatsächlich aus dem Herz stammt?« Alle Aufmerksamkeit richtete sich plötzlich auf ihn. »Was verstehen Sie unter ›fraktionieren‹?«, fragte Woody Ellis. »Creatinphosphokinase ist ein Enzym, das den Muskelzellen hilft, gespeicherte Energie zu nutzen. Es findet sich sowohl im gestreiften Muskelgewebe als auch im Herzmuskel. Werden Herzmuskelzellen geschädigt, wie zum Beispiel bei einem Herzinfarkt, steigt der CPK-Spiegel im Blut an. Deshalb vermuten wir, dass er eine Herzattacke hatte. Aber wenn es nun nicht das Herz ist?« »Was könnte es denn sonst sein?« »Eine andere Art der Muskelschädigung. Ein Trauma vielleicht, oder Krämpfe. Eine Entzündung. Selbst eine simple intramuskuläre Injektion kann den CPK-Spiegel ansteigen lassen. Man muss eine Fraktionierung durchführen, um zu bestimmen, ob das CPK aus dem Herzmuskel stammt. Die Station kann diesen Test nicht durchführen.« »Also hatte er vielleicht gar keinen Herzinfarkt.« »Richtig. Es gibt ein weiteres verwirrendes Detail. Nach einer akuten Muskelschädigung sollte sein CPK wieder auf den Normalwert sinken. Aber sehen Sie sich diesen Verlauf an.« Jack blätterte in den Laborberichten und las die Zahlen vor. »In den letzten vierundzwanzig Stunden ist sein Spiegel stetig angestiegen. Das deutet auf eine dauerhafte Schädigung hin.« »Das ist nur ein Teil des eigentlichen Rätsels«, ergänzte Todd. »Wir haben durchweg abnorme Werte, ohne dass sich ein, Muster erkennen ließe. Leberenzyme, Nierenfunktionen, Leukozyten. Einige Werte steigen, während andere fallen. Es sieht so aus, als würden verschiedene Organsysteme der Reihe nach angegriffen.« Jack sah ihn an. »Angegriffen?« »Das habe ich nicht wörtlich gemeint, Jack. Ich weiß nicht, mit welcher Art von Prozess wir es zu tun haben. Ich weiß aber, dass es kein Laborfehler ist. Wir haben zur Kontrolle die anderen Crewmitglieder untersucht, ihre Werte sind völlig normal.« »Aber ist er denn überhaupt so krank, dass eine Evakuierung gleich welcher Art gerechtfertigt ist?« Die Frage kam vom Einsatzleiter für das Shuttle-Programm. Ihm gefiel das Ganze überhaupt nicht. Der ursprüngliche Auftrag der Discovery war gewesen, den geheimen Spionagesatelliten Capricorn zu bergen und zu reparieren. Jetzt hatte die Krise an Bord der ISS sich dieser Mission bemächtigt. »Washington ist nicht glücklich über die Verschiebung der Satellitenreparatur. Sie haben diesen Flug an sich gerissen, damit die Discovery den fliegenden Rettungswagen spielen kann. Ist das wirklich erforderlich? Kann sich Hirai nicht an Bord der Station erholen?« »Das können wir nicht vorhersagen. Wir wissen nicht, was ihm fehlt«, sagte Todd. »Aber ich bitte Sie, Sie haben doch eine Ärztin da oben! Kann sie denn nicht dahinter kommen?« Jacks Muskeln spannten sich. Das war ein Angriff gegen Emma. »Sie hat schließlich keinen Röntgenblick«, sagte er. »Aber sonst hat sie so gut wie alles zur Verfügung. Wie sagten Sie noch, Dr. Cutler? ›Die Station hat eine gute medizinischtechnische Ausstattung‹?« »Der Astronaut Hirai muss zurück zur Erde, und zwar so schnell wie möglich«, sagte Todd. »Das ist und bleibt unser Standpunkt. Wenn Sie die Arbeit Ihrer Flugärzte kritisieren, wollen, bitte sehr. Ich kann nur sagen, dass ich mir niemals anmaßen würde, einem Ingenieur Ratschläge hinsichtlich der Antriebssysteme zu erteilen.« Damit war die Auseinandersetzung beendet. Der stellvertretende NSTS-Direktor sagte: »Gibt es sonst noch irgendetwas?« »Das Wetter«, sagte der NASA-Meteorologe. »Ich denke, ich sollte vielleicht erwähnen, dass westlich von Guadeloupe eine Gewitterfront im Entstehen ist, die sich sehr langsam in westlicher Richtung bewegt. Sie wird den Start nicht beeinträchtigen. Aber je nachdem, welchen Weg sie nimmt, könnte sie ungefähr in einer Woche in Kennedy für Probleme sorgen.« »Danke für die Warnung.« Der stellvertretende Direktor blickte sich im Raum um und sah, dass es keine weiteren Fragen gab. »Dann ist der Start weiterhin klar für fünf Uhr Mittlerer Sommerzeit. Wir sehen uns dort.«, Punta Arena, Mexiko Das Cortez-Meer schimmerte wie getriebenes Silber im schwindenden Tageslicht. Von ihrem Tisch auf der Terrasse des Café Las Tres Vírgenes aus konnte Helen Koenig die Fischerboote sehen, die nach Punta Colorado zurückkehrten. Dies war ihre liebste Tageszeit, wenn die Abendbrise ihre von der Sonne erhitzte Haut kühlte und ihre Muskeln vom Schwimmen am Nachmittag angenehm müde waren. Ein Kellner brachte ihre Margarita, er stellte das Glas vor sie auf den Tisch. »Gracias, señor«, murmelte sie. Für einen kurzen Moment erwiderte er ihren Blick. Sie sah einen ruhigen, würdevollen Mann mit müden Augen und silbernen Strähnen im Haar, und sie verspürte einen Anflug von Unbehagen. Das schlechte Yankee-Gewissen, dachte sie, während sie beobachtete, wie er zurück zum Tresen ging. Dieses Gefühl befiel sie jedes Mal, wenn sie nach Baja fuhr. Sie nippte an ihrem Drink, blickte auf das Meer hinaus und hörte den wimmernden Trompeten der Mariachi-Band zu, die irgendwo am Strand spielte. Es war ein guter Tag gewesen, sie hatte ihn fast ganz auf dem Meer verbracht. Am Morgen war sie zunächst mit den Sauerstoffflaschen tauchen gegangen, am Nachmittag dann noch einmal nicht ganz so tief hinunter, und schließlich war sie kurz vor dem Abendessen, als der Sonnenuntergang das Wasser schon vergoldete, noch ein wenig geschwommen. Das Meer war ihr Trost, ihr Refugium. So war es immer gewesen. Anders als, die Liebe eines Mannes war das Meer etwas Beständiges, und es enttäuschte sie nie. Immer war es bereit, sie aufzunehmen, sie zu beruhigen und zu trösten, und in schwierigen Zeiten floh sie immer wieder in seine Arme. Genau deshalb war sie nach Baja gekommen. Um im warmen Wasser zu schwimmen und allein zu sein, für niemand erreichbar. Nicht einmal für Palmer Gabriel. Der saure Geschmack der Margarita ließ sie das Gesicht verziehen. Sie leerte das Glas und bestellte noch eine. Schon gab ihr der Alkohol das Gefühl zu schweben. Es war doch alles gleich; jetzt war sie frei. Das Projekt war erledigt, abgebrochen. Die Kulturen zerstört. Obwohl Palmer wütend auf sie war, wusste sie, dass sie das Richtige getan hatte. Im Interesse der Sicherheit. Morgen würde sie lange schlafen und heiße Schokolade und huevos rancheros zum Frühstück bestellen. Dann würde sie noch einmal ein wenig tauchen gehen, sich noch einmal mit ihrem meergrünen Liebhaber treffen. Das Lachen einer Frau schreckte sie aus ihren Gedanken. Helen sah zum Tresen hinüber, wo sie ein flirtendes Paar erblickte. Die Frau war schlank und braun, der Mann hatte Muskeln wie Stahlseile. Eine Urlaubsaffäre im Frühstadium. Sie würden wahrscheinlich gemeinsam zu Abend essen und anschließend Händchen haltend am Strand spazieren gehen. Und dann ein Kuss, eine Umarmung, das ganze hormongeladene Ritual der Paarbildung. Helen beobachtete sie mit dem Interesse einer Wissenschaftlerin und zugleich mit dem Neid einer Frau. Sie wusste, dass solche Rituale nichts für sie waren. Sie war neunundvierzig, und man sah es ihr an. Ihre Taille war zu dick, ihr Haar schon mehr als halb ergraut, und ihr Gesicht hatte nichts Bemerkenswertes bis auf ihre intelligenten Augen. Sie war nicht der Typ Frau, der die Blicke sonnengebräunter Adonisse auf sich zog. Sie trank ihre zweite Margarita aus. Das Gefühl des Schwebens hatte sich inzwischen auf ihren ganzen Körper, ausgedehnt, und sie wusste, dass es an der Zeit war, etwas Festes zu sich zu nehmen. Sie schlug die Speisekarte auf. »Restaurante de Las Tres Virgenes« stand oben auf der ersten Seite. Die drei Jungfrauen. Wie passend. Sie hätte ebenso gut eine Jungfrau sein können. Der Kellner kam, um ihre Bestellung aufzunehmen. Sie sah zu ihm auf und hatte ihn gerade gebeten, ihr die gegrillte Dorade zu bringen, als ihr Blick auf den Fernseher über der Bar fiel – auf das Bild des Space Shuttle auf seiner Startrampe. »Was passiert denn da?«, fragte sie und zeigte auf den Fernseher. Der Kellner zuckte mit den Achseln. »Stellen Sie es lauter!«, rief sie dem Barkeeper zu. »Bitte, ich muss das hören!« Er drehte am Lautstärkeregler, und sogleich war der englischsprachige Kommentar zu hören. Ein amerikanischer Sender. Helen ging an den Tresen und starrte gebannt auf den Bildschirm. »… wird der Astronaut Kenichi Hirai aus medizinischen Gründen evakuiert. Die NASA hat keine weiteren Informationen verlauten lassen, doch Berichte deuten darauf hin, dass seine Erkrankung die Ärzte der Weltraumbehörde weiterhin vor ein Rätsel stellt. Die Ergebnisse der heutigen Blutuntersuchungen ließen eine Rückholung per Shuttle geraten erscheinen. Die Discovery soll morgen früh um sechs Uhr Ortszeit von Cape Canaveral aus starten.« »Señora?«, fragte der Kellner. Helen drehte sich um und sah, dass er immer noch seinen Notizblock in der Hand hielt. »Möchten Sie noch einen Drink?« »Nein. Nein, ich muss gehen.« »Aber Ihr Essen …« »Streichen Sie meine Bestellung. Bitte.« Sie öffnete ihre, Geldbörse, drückte ihm fünfzehn Dollar in die Hand und eilte nach draußen. Von ihrem Hotelzimmer aus versuchte sie Palmer Gabriel in San Diego anzurufen. Erst nach dem sechsten Versuch kam sie zur internationalen Vermittlung durch, und als die Verbindung endlich stand, erreichte sie nur Palmers Voicemail. »Sie haben einen kranken Astronauten an Bord der ISS«, sagte sie. »Palmer, das ist genau das, was ich befürchtet habe. Wovor ich Sie alle gewarnt habe. Wenn es sich bestätigt, müssen wir sehr schnell handeln. Bevor …« Sie brach ab und sah nach der Uhr. Ach, zum Teufel, dachte sie. Ich muss zurück nach San Diego. Ich bin die Einzige, die weiß, was hier zu tun ist. Sie brauchen mich. Sie stopfte ihre Kleider in den Koffer, gab den Zimmerschlüssel ab und stieg in ein Taxi, das sie zu dem fünfundzwanzig Kilometer entfernten winzigen Flugplatz von Buena Vista bringen sollte. Dort würde ein kleines Flugzeug auf sie warten, das sie nach La Paz brachte, und von dort würde sie einen Linienflug nach San Diego bekommen. Es war eine ungemütliche Fahrt, die Straße war holprig und kurvenreich, und durch die offenen Fenster wehte der Staub herein. Aber wovor sie sich wirklich fürchtete, war der bevorstehende Flug. Kleine Flugzeuge versetzten sie in Panik. Hätte sie es nicht so eilig gehabt, nach Hause zu kommen, hätte sie die lange Fahrt über die Halbinsel von Baja California in ihrem eigenen Wagen gemacht, der jetzt sicher in der Ferienanlage geparkt war. Mit verschwitzten Händen klammerte sie sich an die Armlehne und malte sich aus, welches fürchterliche Flugunglück auf sie wartete. Dann sah sie ein Stück des klaren und samtschwarzen Nachthimmels und dachte an die Menschen an Bord der Raumstation. Sie dachte an die Risiken, die andere, mutigere Menschen eingingen. Es war alles eine Frage der Perspektive., Ein Flug in einer kleinen Propellermaschine ist nichts im Ver- gleich zu den Gefahren, denen ein Astronaut sich zu stellen hat. Sie durfte jetzt nicht feige sein. Es ging womöglich um Leben oder Tod. Und sie war die Einzige, die wusste, wie die Gefahr abzuwenden war. Plötzlich hörte das durch Mark und Bein gehende Rütteln auf. Gott sei Dank, sie fuhren jetzt auf einer asphaltierten Straße, und es waren nur noch wenige Kilometer bis Buena Vista. Der Fahrer, der merkte, wie eilig sein Gast es hatte, trat aufs Gaspedal, und der Wind peitschte durch die offenen Fenster und wirbelte ihr Staubkörner ins Gesicht. Sie griff nach dem Hebel, um die Scheibe hochzudrehen. Plötzlich spürte sie, wie der Wagen nach links ausscherte, um ein langsames Auto zu überholen. Sie blickte auf und sah mit Entsetzen, dass sie sich in einer Kurve befanden. »Señor! Más despacio!«, rief sie. Fahren Sie langsamer. Sie waren jetzt auf gleicher Höhe mit dem anderen Wagen. Der Taxifahrer gab weiter Gas, er wollte die gewonnenen Sekunden auf keinen Fall verschenken. Vor ihnen machte die Straße eine Linkskurve und verschwand hinter einer Kuppe. »Nicht überholen!«, rief sie. »Bitte nicht …« Sie sah nach vorne und erstarrte, als die Scheinwerfer des entgegen- kommenden Wagens sie blendeten. Sie hob die Arme, um ihr Gesicht zu schützen, um nicht in dieses grelle Licht blicken zu müssen. Doch vor dem Geräusch der kreischenden Reifen konnte sie sich nicht schützen, ebenso wenig wie vor ihrem eigenen entsetzten Schrei, als die Scheinwerfer auf sie zugeschossen kamen. 3. August Jack saß hinter der gläsernen Trennwand in der voll besetzten, Besuchergalerie, von wo aus er den ganzen Flugkontrollraum sehen konnte. Alle Konsolen waren besetzt, alle Controller für die Fernsehkameras ordentlich herausgeputzt. Die Männer und Frauen, die dort unten arbeiteten, mochten durchaus auf ihre Aufgaben konzentriert sein, dennoch vergaßen sie nie ganz, dass die Augen der Öffentlichkeit auf sie gerichtet waren und dass jede Geste, jedes nervöse Kopfschütteln durch die Glaswand hinter ihnen beobachtet werden konnte. Erst vor einem Jahr hatte Jack selbst während eines Shuttlestarts an der Konsole des Flugarztes gesessen und die Blicke der Fremden wie einen schwachen, aber dennoch störenden Hitzestrahl im Nacken gespürt. Er wusste, dass die Leute dort unten in diesem Moment das Gleiche empfanden. Im Kontrollraum schien eine Atmosphäre abgeklärter Ruhe zu herrschen, und so klangen auch die Stimmen, die über die Kopfhörer zu vernehmen waren. Dies war genau das Bild, das die NASA zu vermitteln bemüht war: ein Team von Profis, die ihren Job erledigten, und zwar tadellos. Was selten an die Öffentlichkeit drang, waren die Krisen in den hinteren Kontrollräumen, die Beinahe-Katastrophen, die heillose Verwirrung, die ausbrach, wenn wirklich einmal etwas schief ging. Aber nicht heute, dachte er. Carpenter ist am Ruder. Alles wird laufen wie am Schnürchen. Flugdirektor Carpenter leitete das Bodenkontrollteam. Er war alt und erfahren genug, um im Laufe seiner Karriere eine Vielzahl von Krisen durchlebt zu haben. Er war überzeugt, dass Raumfahrttragödien normalerweise nicht das Ergebnis eines einzelnen schwerwiegenden Defekts waren, sondern vielmehr einer ganzen Reihe kleinerer Probleme, die sich häuften und schließlich zur Katastrophe führten. Deshalb legte er so großen Wert auf Details; für ihn war jede kleine Störung eine potenzielle Krise. Sein Team schaute zu ihm auf – und zwar im wahrsten Sinne des Wortes, denn mit seinen eins, fünfundneunzig und zweieinhalb Zentnern Lebendgewicht war Carpenter eine überragende Erscheinung. Gretchen Liu, die Pressesprecherin, saß ganz links in der letzten Konsolenreihe. Jack sah, wie sie sich umdrehte und der Galerie ein »Alles okay« -Lächeln zuwarf. Sie hatte sich extra fürs Fernsehen in Schale geworfen, marineblaues Kostüm und grauer Seidenschal. Die Mission hatte die Aufmerksamkeit der Weltöffentlichkeit erregt, und obwohl die meisten Pressevertreter sich in Cape Canaveral versammelt hatten, um den Start zu beobachten, waren noch genug Reporter hier im Kontrollzentrum des JSC, um die Zuschauergalerie bis auf den letzten Platz zu füllen. Die zehnminütige Unterbrechung des Countdowns ging zu Ende. Sie hörten die endgültige Startfreigabe aus dem Wetter- zentrum, und dann wurde der Countdown fortgesetzt. Jack beugte sich vor. Bis zum Moment des Abhebens würden sich die Ereignisse jetzt überschlagen, und seine Muskeln spannten sich an. Da war es wieder, das alte Startfieber. Als er dem Raumfahrtprogramm vor einem Jahr den Rücken gekehrt hatte, war er sich sicher gewesen, dass auch das der Vergangenheit angehörte. Aber jetzt saß er hier und war so aufgeregt wie eh und je. Und mit der Aufregung wurde auch der Traum wieder lebendig. Er stellte sich die Crew vor, in ihren Sitzen festgeschnallt, während das Fahrzeug unter ihnen erbebte und in den Kammern mit flüssigem Sauerstoff und Wasserstoff der Druck stetig anstieg. Er dachte an die Platzangst, die sie überkam, wenn sie ihre Visiere zuklappten. Das Zischen des Sauerstoffs. Das Herzklopfen. »Jetzt zünden die Feststoffraketen«, sagte der Pressesprecher im Startkontrollzentrum von Kennedy »Und Start! Sie haben abgehoben! Jetzt übernimmt das JSC in Houston …« Auf dem zentralen Großbildschirm leuchtete die Flugkurve des Shuttle auf, das auf seine vorgeschriebene Bahn in Richtung Osten einschwenkte. Jack war immer noch angespannt, sein, Herz raste. Auf den Fernsehmonitoren über der Galerie erschienen aus Kennedy übermittelte Bilder des Shuttle. Der Funkverkehr zwischen dem Capcom und dem Shuttle- Commander lief über die Lautsprecher. Die Discovery hatte ihr Rollmanöver vollführt und stieg nun in die oberen Schichten der Atmosphäre auf, wo der blaue Himmel bald der Schwärze des Weltalls weichen würde. »Sieht alles sehr gut aus«, sagte Gretchen Liu über die Medienleitung. Jack hörte den Triumph eines perfekten Starts aus ihrer Stimme heraus. Bis hierher war auch alles perfekt. Vom kritischen Punkt Max Q über die Abtrennung der Feststoffraketen bis hin zum Abschalten der Haupttriebwerke. Im Kontrollraum stand Flugdirektor Carpenter reglos da, den Blick starr auf den Großbildschirm gerichtet. »Discovery, alles klar für Außentank-Abtrennung«, sagte der Capcom. »Roger, Houston«, antwortete Kittredge. »Außentank abgetrennt.« Es war die Art, wie Carpenter plötzlich seinen massigen Kopf zurückwarf, die Jack verriet, dass sich gerade etwas getan hatte. Alle Controller schienen gleichzeitig von einer hektischen Betriebsamkeit erfasst worden zu sein. Einige warfen verstohlene Seitenblicke auf Carpenter, dessen normalerweise hängende Schultern sich plötzlich gestrafft hatten. Gretchen hatte die Hand an ihren Kopfhörer gelegt und horchte konzentriert auf den Funkverkehr. Irgendetwas ist schief gelaufen, dachte Jack. Die Funkverbindung zwischen Bodenstation und Kapsel war weiterhin über die Lautsprecher zu hören. »Discovery«, sagte der Capcom, »MMACS meldet, dass die Verbindungstüren sich nicht geschlossen haben. Bitte bestätigen.«, »Roger, wir bestätigen die Meldung. Türen lassen sich nicht schließen.« »Schlage vor, auf manuellen Betrieb zu gehen.« Ein ominöses Schweigen folgte. Dann hörten sie Kittredge sagen: »Houston, alles wieder okay bei uns. Die Türen haben sich gerade geschlossen.« Erst als er einen erleichterten Seufzer ausstieß, merkte Jack, dass er die ganze Zeit die Luft angehalten hatte. Bisher war das die einzige Panne. Alles andere läuft hervorragend, dachte er. Doch die Wirkung dieses plötzlichen Adrenalinstoßes hielt an, und seine Hände schwitzten. Sie waren gerade daran erinnert worden, wie viele Dinge schief gehen konnten, und dieses Unbehagen war nicht so leicht wieder abzuschütteln. Er blickte in den Kontrollraum hinunter und fragte sich, ob Randy Carpenter, der Beste unter den Besten, wohl von den gleichen Vorahnungen geplagt wurde. 4. August Es war, als hätte sich seine innere Uhr automatisch umgestellt und seinen Schlaf-Wach-Rhythmus so verschoben, dass er um ein Uhr früh mit einem Schlag hellwach war. Mit weit offenen Augen lag Jack im Bett und starrte auf die Leuchtanzeige des Weckers. Ich jage mit der Discovery der ISS hinterher, dachte er. Mit Emma. Schon hatte sein Körper begonnen, sich mit dem ihren gleichzuschalten. In einer Stunde würde sie aufwachen und ihren Arbeitstag beginnen. Und hier unten war Jack gerade eben aufgewacht – ihre Biorhythmen verliefen nahezu synchron. Er versuchte gar nicht erst, wieder einzuschlafen; stattdessen stand er auf und zog sich an. Um ein Uhr dreißig herrschte im Kontrollzentrum routinierte Geschäftigkeit. Jack warf zuerst einen Blick in den, Flugkontrollraum, wo die Shuttle-Controller saßen. Bislang waren an Bord der Discovery keinerlei Krisensituationen eingetreten. Er ging den Korridor entlang bis zu dem separaten Kontrollraum für die ISS, der »Special Vehicle Operations« genannt wurde und ähnlich wie der Shuttle-Kontrollraum aufgebaut war, nur dass er wesentlich kleiner war. Jack steuerte schnurstracks auf die Konsole des Flight Surgeon zu und ließ sich in den Sessel neben Roy Bloomfeld, dem Dienst habenden Flugarzt, sinken. Bloomfeld sah ihn überrascht an. »Hallo, Jack. Du bist ja tatsächlich wieder im Programm.« »Ich kann die Finger einfach nicht davon lassen.« »Na, am Geld kann’s ja nicht liegen. Muss wohl der aufregende Job sein.« Er lehnte sich zurück und gähnte. »Nicht besonders aufregend heute Nacht.« »Ist der Patient stabil?« »Ja, die letzten zwölf Stunden schon.« Bloomfeld deutete mit einem Kopfnicken auf die Biotelemetriemessungen auf seiner Konsole. Kenichis EKG und Blutdruckwerte zogen ihre Leuchtspuren über den Monitor. »Sein Rhythmus ist regelmäßig wie ein Uhrwerk.« »Keine neuen Entwicklungen?« »Der letzte Statusbericht ist vier Stunden alt. Seine Kopfschmerzen sind schlimmer geworden, und er hat immer noch Fieber. Antibiotika scheinen nicht zu greifen. Wir können uns hier alle nur am Kopf kratzen.« »Hat Emma irgendwelche Ideen?« »Im Moment ist sie wahrscheinlich zu erschöpft, um darüber nachzudenken. Ich habe ihr gesagt, sie soll ein wenig schlafen; schließlich haben wir den Monitor im Auge. Bis jetzt ist es eher langweilig.« Bloomfeld gähnte erneut. »Hör mal, ich muss mal eben für kleine Jungs. Kannst du die Konsole so lange im Auge, behalten?« »Kein Problem.« Bloomfeld verließ den Raum, und Jack setzte den Kopfhörer auf. Es war ein gutes und vertrautes Gefühl, wieder vor einer Konsole zu sitzen, die gedämpfte Unterhaltung der übrigen Controller zu hören und den Großbildschirm zu beobachten, auf dem sich die Flugbahn der ISS um die Erde als Sinuskurve abzeichnete. Es war vielleicht nicht dasselbe wie ein Platz im Shuttle, aber es war das Nächstbeste, was er für sich erhoffen konnte. Ich werde nie mehr nach den Sternen greifen können, aber ich kann hier sein und dafür sorgen, dass es anderen gelingt. Er war verblüfft über die Erkenntnis, dass er diese bittere Wendung in seinem Leben offenbar akzeptiert hatte. Dass er, seinen alten Traum vor Augen und doch für immer davon ausgeschlossen, den Blick aus der Ferne trotz allem genießen konnte. Irgendetwas an Kenichi Hirais EKG ließ ihn plötzlich aufschrecken. Er beugte sich vor und starrte auf den Monitor. Die Herzkurve hatte einige Male heftig nach oben und unten ausgeschlagen. Jetzt glitt eine schnurgerade Linie über die obere Hälfte des Bildschirms. Jack entspannte sich. Das war nichts Beunruhigendes; er erkannte es als eine elektronische Anomalie – vermutlich ein loses EKG-Kabel. Die Blutdruckkurve war unverändert. Vielleicht hatte sich der Patient bewegt und versehentlich ein Kabel abgerissen. Oder Emma hatte den Monitor abgestellt, damit er ungestört die Toilette benutzen konnte. Jetzt brach die Blutdruckaufzeichnung abrupt ab – ein weiteres Zeichen dafür, dass Kenichi nicht mehr angeschlossen war. Er beobachtete den Monitor noch einige Sekunden und wartete ab, ob die Aufzeichnungen wieder einsetzten. Als sich nichts tat, erstattete er Meldung. »Capcom, hier Surgeon. Ich sehe ein Lose-Kabel-Muster auf, dem EKG des Patienten.« »Lose-Kabel-Muster?« »Sieht aus, als wäre er nicht mehr an den Monitor angeschlossen. Es kommt keine Herzkurve an. Könnten Sie mal bei Emma nachfragen?« »Roger, Surgeon. Ich werde sie anklingeln.« Ein leises Piepsen weckte Emma aus einem traumlosen Schlaf, und im Erwachen spürte sie, dass etwas Kühles und Feuchtes sanft ihr Gesicht berührte. Sie hatte eigentlich nicht einnicken wollen. Obwohl die Bodenkontrolle per Biotelemetrie ständig Kenichis EKG überwachte und sie auf jegliche Statusveränderungen aufmerksam machen würde, hatte sie sich vorgenommen, während der gesamten Ruhephase der Crew wach zu bleiben. Doch in den letzten beiden Tagen hatte sie immer nur kurze Ruhepausen einlegen können, und selbst dann war sie häufig von ihren Kollegen gestört worden, die irgendwelche Fragen zu Kenichis Zustand hatten. Endlich hatten die Erschöpfung und die vollkommene Entspannung, die nur in der Schwerelosigkeit möglich ist, sie überwältigt. Sie erinnerte sich noch, dass sie die hypnotisierende Schlangenlinie von Kenichis Herzrhythmus auf dem Monitor beobachtet hatte, die sich vor ihren Augen allmählich in einen verschwommenen grünen Fleck verwandelt hatte. Und dann war alles schwarz geworden. Sie spürte den kalten Wasserspritzer auf ihrer Wange und öffnete die Augen. Ein in allen Regenbogenfarben schimmernder Tropfen schwebte durch die Luft auf sie zu. Ein paar Sekunden lang war sie zu benommen, um zu begreifen, was sie da sah, und es dauerte wiederum einige Sekunden, bis sie die Dutzende weiterer Wassertropfen wahrnahm, die wie silbrige Christbaumkugeln um sie herumtanzten. In ihrem Kopfhörer war statisches Rauschen zu hören, dann ein Knacken und schließlich eine Stimme: »Äh, Watson, hier, Capcom. Wir wecken Sie nur ungern, aber wir müssen den Status der EKG-Kabel des Patienten überprüfen.« Heiser vor Erschöpfung antwortete Emma: »Ich bin wach, Capcom, glaube ich jedenfalls.« »Die Biotelemetrie weist eine Anomalie im EKG Ihres Patienten auf. Der Surgeon meint, Sie hätten da oben ein paar lockere Kabel.« Sie hatte sich im Schlaf in der Luft gedreht und musste sich in dem Modul zunächst wieder orientieren und die Stelle suchen, wo ihr Patient sein sollte. Sein Schlafsack war leer. Der herausgerissene Infusionsschlauch schwebte frei umher; aus der Katheteröffnung traten glitzernde Tröpfchen der Salzlösung aus. Ein Gewirr von losen EKG-Kabeln hing in der Luft. Sie stellte sofort die Infusionspumpe ab und sah sich in der Kapsel um. »Capcom, er ist nicht hier. Er hat das Modul verlassen! Bleiben Sie dran.« Sie stieß sich von der Wand ab und schoss los in Richtung Node 2, von wo die NASDA- und ESA-Labors abzweigten. Ein kurzer Blick durch die Luken verriet ihr, dass er dort nicht war. »Haben Sie ihn gefunden?«, fragte der Capcom. »Negativ. Ich suche weiter.« War er etwa verwirrt und streifte orientierungslos durch die Station? Sie kehrte um und glitt wieder durch die Luke des US- Labors. Ein kleiner Tropfen spritzte ihr ins Gesicht. Sie wischte den feuchten Fleck weg und sah mit Schrecken, dass ihr Finger blutverschmiert war. »Capcom, er ist durch Node 1 gekommen. Er blutet aus dem IV-Einstich.« »Schlage vor, Sie kappen die Luftzirkulation zwischen den Modulen.« »Roger, wird gemacht.« Sie schwebte durch die Luke in das, Wohnmodul. Die Beleuchtung war gedämpft, und in dem schwachen Schein erkannte sie Griggs und Luther, die beide in ihre Schlafsäcke gehüllt waren und fest schliefen. Keine Spur von Kenichi. Keine Panik, sagte sie sich, während sie mit einem Knopfdruck den Luftaustausch zwischen den Modulen unterbrach. Denk nach. Wohin würde er sich wohl wenden? Zurück zu seinem eigenen Schlafplatz am russischen Ende der ISS. Ohne Luther und Griggs zu wecken, verließ sie das Wohnmodul und schlüpfte rasch in den Tunnel aus Verbindungsknoten und -modulen hinein, wobei sie immer wieder nach links und rechts spähte. Ihren flüchtigen Patienten konnte sie jedoch nirgendwo entdecken. »Capcom, ich habe ihn noch immer nicht gefunden. Ich habe Zarya durchquert und bin jetzt unterwegs zum RSM.« Sie schwebte in das russische Servicemodul hinein, in dem Kenichi normalerweise schlief. Im Dämmerlicht erkannte sie Diana und Nikolai. Beide schliefen in ihren gesicherten Schlafsäcken; ihre Arme ruderten frei umher, wodurch sie wie Ertrunkene aussahen. Kenichis Schlafplatz war leer. Ihre Besorgnis verwandelte sich in echte Angst. Sie fasste Nikolai an der Schulter und schüttelte ihn. Es dauerte eine Weile, bis er endlich aufwachte, und dann brauchte er immer noch einen Moment, um zu begreifen, was sie ihm sagte. »Ich kann Kenichi nicht finden«, wiederholte sie. »Wir müssen alle Module absuchen.« »Watson«, hörte sie den Capcom in ihrem Kopfhörer sagen. »Die Technik meldet eine periodisch auftretende Anomalie in der Druckschleuse von Node 1. Bitte Status überprüfen.« »Was für eine Anomalie?«, »Die Anzeigen deuten in gewissen Abständen darauf hin, dass die Luke zwischen Ausrüstungsschleuse und Mannschaftsschleuse möglicherweise nicht vollständig gesichert ist.« Kenichi. Er ist in der Druckschleuse. Dicht gefolgt von Nikolai schoss sie wie ein Vogel durch die Gänge der Station, bis sie in Node 1 ankam. Beim ersten fieberhaften Blick durch die offene Luke in die Ausrüstungsschleuse bot sich Emma ein verblüffender Anblick. Sie glaubte zunächst, drei Menschen zu sehen – doch dann erkannte sie, dass zwei der vermeintlichen Körper nur Raumanzüge waren, deren feste Rumpfteile an die Schleusenwand montiert waren, um das Anziehen zu erleichtern. Mitten in der Schleuse, das Rückgrat in krampfartigen Zuckungen nach hinten gebogen, hing Kenichi in der Luft. »Helfen Sie mir, ihn hier rauszuholen!«, rief Emma. Sie manövrierte sich hinter ihn, stemmte die Füße gegen die äußere Luke und schob Kenichi auf Nikolai zu, der ihn aus der Schleuse zog. Gemeinsam trieben sie ihn auf das Labormodul zu, wo das medizinische Gerät aufgebaut war. »Capcom, wir haben den Patienten gefunden«, sagte Emma. »Er scheint einen Anfall zu haben – ein Grand Mal. Geben Sie mir den Surgeon.« Plötzlich hörte sie eine merkwürdig vertraute Stimme in ihrem Kopfhörer. »Hallo Em. Ich höre, du hast da oben ein Problem.« »Jack? Was machst du denn …« »Wie geht es deinem Patienten?« Immer noch wie geschockt, zwang sie sich, ihre Aufmerksamkeit auf Kenichi zu konzentrieren. Während sie den intravenösen Zugang neu legte und die EKG-Kabel anbrachte, fragte sie sich unentwegt, was Jack in der Bodenkontrolle zu suchen hatte. Er hatte seit einem Jahr nicht mehr als Flight, Surgeon an einer Konsole gesessen, und jetzt tauchte er plötzlich im Funkverkehr auf. Und als er sich nach Kenichis Zustand erkundigt hatte, hatte seine Stimme ruhig, ja gelassen geklungen. »Hat der Anfall aufgehört?« »Ja. Ja, er macht jetzt gezielte Bewegungen – er wehrt sich gegen uns …« »Vitale Messwerte?« »Puls ist beschleunigt – hundertzwanzig, hundertdreißig. Er atmet spontan.« »Gut.« »Wir sind gerade dabei, das EKG anzuschließen.« Sie warf einen Blick auf den Monitor und sah eine Herzkurve darüber hinwegjagen. »Sinustachykardie, Frequenz hundertvierundzwanzig. Gelegentliche Extrasystolen.« »Ich kann es über Biotelemetrie verfolgen.« »Messe jetzt den Blutdruck …« Sie pumpte die Manschette auf und horchte auf den Puls, während der Druck langsam abgelassen wurde. »Fünfundneunzig zu sechzig. Nicht auffällig …« Der Schlag traf sie völlig unerwartet. Sie stieß einen schrillen Schmerzensschrei aus, als Kenichis Hand plötzlich ausschlug und sie am Mund traf. Durch den Aufprall wurde sie durch die Luft gewirbelt, flog quer durch das Modul und prallte gegen die Wand. »Emma«, rief Jack. »Emma?« Benommen fasste sie sich an die schmerzhaft pochende Lippe. »Sie bluten!«, rief Nikolai. Im Kopfhörer war Jacks aufgeregte Stimme zu hören. »Was zum Teufel geht da oben vor?« »Schon gut, mir fehlt nichts«, murmelte sie. Und wiederholte, dann gereizt: »Mir fehlt nichts, Jack. Reg dich bloß nicht auf.« Doch ihr Schädel brummte noch von dem Schlag. Während Nikolai Kenichi auf dem Behandlungstisch festschnallte, wartete sie in der Ecke, bis sich das Schwindelgefühl gelegt hatte. Sie registrierte anfangs gar nicht, was Nikolai sagte. Dann sah sie seinen ungläubigen Blick. »Sehen Sie sich mal seinen Bauch an!«, flüsterte Nikolai. »So sehen Sie doch hin!« Emma kam näher. »Was um alles in der Welt ist das?«, flüsterte sie. »Sag doch was, Emma!«, drängte Jack. »Sag mir endlich, was los ist!« Sie starrte auf Kenichis Bauch. Die Haut wellte und kräuselte sich, als ob es darunter brodelte. »Es bewegt sich etwas … unter seiner Haut …« »Wie meinst du das, es bewegt sich etwas?« »Es sieht aus wie faszikuläre Zuckungen. Aber es wandert quer über den Bauch …« »Keine Peristaltik?« »Nein. Nein, es wandert nach oben. Es folgt nicht dem Darmverlauf.« Sie hielt inne. Die Wellenbewegungen hatten plötzlich aufgehört, und sie sah nur noch die glatte, regungslose Oberfläche von Kenichis Abdomen. Faszikulationen, dachte sie. Unkoordinierte Zuckungen der Muskelfasern. Es war die wahrscheinlichste Erklärung, bis auf ein einziges Detail: Faszikulationen breiten sich nicht in Wellen aus. Plötzlich schlug Kenichi die Augen auf und starrte Emma an. Der Herzalarm schrillte los. Emma drehte sich zum Monitor um und sah, wie das EKG in wilden Zacken nach oben und unten ausschlug. »Kammertachykardie!«, rief Jack., »Ich sehe es, ich sehe es!« Sie drückte den Aufladeknopf des Defibrillators und fühlte dann den Puls an der Halsschlagader. Da war er. Sehr schwach, kaum fühlbar. Er hatte die Augen nach oben verdreht, sodass nur noch die blutroten Skleren zu sehen waren. Noch atmete er. Rasch klatschte sie zwei Defibrillatorkissen auf seine Brust, setzte die Elektroden darauf und drückte auf die Knöpfe. Eine elektrische Ladung von einhundert Joule schoss durch Kenichis Körper. Seine Muskeln zogen sich in einem einzigen heftigen Krampf zusammen, sodass seine Beine gegen den Tisch schlugen. Nur die Gurte hinderten ihn daran, quer durch das Modul zu fliegen. »Immer noch tachykard!«, rief Emma. Diana kam in das Modul geschwebt. »Was kann ich tun?«, fragte sie. »Machen Sie das Lidocain fertig!«, antwortete Emma knapp. »Es ist im Medikamentenschrank, rechtes Schubfach!« »Hab’s schon.« »Er atmet nicht mehr!«, meldete Nikolai. Emma schnappte das Beatmungsgerät und sagte: »Nikolai, stützen Sie mich ab!« Er brachte sich in Position, indem er sich Rücken an Rücken gegen sie lehnte und die Füße an der Wand abstützte, während sie Kenichi die Sauerstoffmaske aufsetzte. Kardiopulmonale Reanimation ist schon auf der Erde eine anstrengende Angelegenheit; unter den Bedingungen der Mikrogravitation ist sie geradezu ein Albtraum – eine komplizierte akrobatische Übung mit frei schwebenden Instrumenten, mit Schläuchen, die sich in der Luft verdrehen und verheddern, und Spritzen, die samt ihrer wertvollen Füllung wegzudriften drohen. Man drückt mit beiden Händen auf die Brust des Patienten, und schon kann es einem passieren, dass man an die Decke fliegt. Obwohl die, Crew dieses Szenario geübt hatte, konnte man in einer Simulation niemals das tatsächliche Chaos dieser auf engstem Raum durcheinander wirbelnden Körper reproduzieren, den hektischen Wettlauf gegen die Zeit und den Herztod. Nachdem die Maske fest über Kenichis Mund und Nase lag, begann sie, Sauerstoff in seine Lungen zu pumpen. Die EKG- Kurve auf dem Monitor schlug immer noch wild aus. »Verabreiche eine Ampulle Lidocain intravenös«, verkündete Diana. »Nikolai, schocken Sie ihn noch einmal!« Er zögerte einen winzigen Moment, dann griff er nach den Elektroden, drückte sie auf die Brust des Patienten und löste den Stromschlag aus. Diesmal jagten zweihundert Joule durch Kenichis Herz. Emma sah nach dem Monitor. »Jetzt haben wir Kammerflimmern! Nikolai, beginnen Sie mit der Herzmassage! Ich werde intubieren.« Nikolai ließ die Platten los, und sie begannen zu schweben, nur noch von den Kabeln festgehalten. Er stützte die Füße wieder an der Wand des Moduls ab und wollte gerade die Handflächen auf Kenichis Brustbein legen, als er plötzlich ruckartig die Hände wegzog. Emma sah ihn an. »Was ist los?« »Seine Brust! Sehen Sie sich seine Brust an!« Sie starrten alle darauf. Die Haut von Kenichis Brust brodelte und wogte auf und ab. An den Kontaktstellen, wo die Elektroden des Defibrillators ihre Ladung abgegeben hatten, hatten sich zwei erhabene Kreise gebildet, die sich jetzt wie die Wellen um einen ins Wasser geworfenen Stein ausbreiteten. »Asystolie!«, rief Jacks Stimme im Kopfhörer. Nikolai blickte immer noch wie erstarrt auf Kenichis Brust., Es war Emma, die sich nun in Position brachte und sich mit dem Rücken an Nikolai abstützte. Asystolie. Das Herz hat aufgehört zu schlagen. Ohne Herzmassage wird er sterben. Sie spürte keinerlei Bewegung, nichts Ungewöhnliches. Nur Haut, die sich über die vertrauten Konturen des Brustbeins spannte. Faszikuläre Zuckungen. Das muss es sein, dachte sie. Es gibt keine andere Erklärung. Sie begann mit den Kompressionen – ihre Hände übernahmen die Arbeit von Kenichis Herz und pumpten das Blut in seine lebenswichtigen Organe. »Diana, eine Ampulle Adrenalin IV!«, befahl sie. Diana injizierte das Medikament in den Infusionsschlauch. Sie starrten auf den Monitor, hoffend und betend, dass der leuchtende Punkt wieder ausschlagen würde., »Es muss eine Autopsie durchgeführt werden«, sagte Todd Cutler. Gordon Obie, der Leiter der Flugeinsatzabteilung, warf ihm einen ungehaltenen Blick zu. Einige der übrigen Anwesenden im Konferenzzimmer reagierten ebenfalls mit wegwerfenden Gesten, denn Cutler hatte nur ausgesprochen, was ohnehin offensichtlich war. Selbstverständlich musste es eine Autopsie geben. Über ein Dutzend Menschen hatten sich zu dieser Krisensitzung zusammengefunden. Eine Autopsie war das geringste ihrer Probleme. Obie hatte im Moment drängendere Sorgen. Gewohnt, nur wenige Worte zu machen, fand er sich plötzlich in der unangenehmen Lage, von Reportern mit Mikrofonen bestürmt zu werden, wann immer er sich in der Öffentlichkeit zeigte. Der quälende Prozess der Suche nach dem Schuldigen hatte begonnen. Obie musste einen Teil der Verantwortung für diese Tragödie übernehmen, hatte er doch der Auswahl der Crewmitglieder in jedem einzelnen Fall zugestimmt. Wenn die Crew versagt hatte, dann hatte letzten Endes er selbst versagt. Und seine Entscheidung für Emma Watson sah rückblickend allmählich wie ein schwerer Fehler aus. Das war zumindest die Botschaft, die er in diesem Raum zu hören bekam. Als einzige Ärztin an Bord der ISS hätte Emma Watson merken müssen, dass Hirai sterben würde. Eine sofortige CRV-Evakuierung hätte ihm vielleicht das Leben gerettet. Jetzt war ein Shuttle in den Weltraum geschickt worden, und eine mehrere Millionen Dollar teure Rettungsmission war zu einem Leichentransport geworden. Washington brauchte dringend einen Sündenbock, und die, ausländische Presse stellte eine politisch brisante Frage: Hätte man auch einen amerikanischen Astronauten sterben lassen? Die Reaktion der Medien stand bei diesem Treffen denn auch ganz oben auf der Tagesordnung. Gretchen Liu sagte: »Senator Parish hat sich folgendermaßen geäußert …« Ken Blankenship, der Direktor des JSC, stöhnte. »Ich will es gar nicht wissen.« »CNN Atlanta hat uns ein Fax geschickt. Ich zitiere: ›Millionen von Steuerdollars sind in die Entwicklung des Crew Return Vehicle als Rettungsboot der Station geflossen. Doch die NASA hat es für richtig erachtet, es nicht zu benutzen. Sie hatten einen schwer kranken Mann dort oben, dessen Leben man hätte retten können. Jetzt ist dieser tapfere Astronaut tot, und es ist für alle offensichtlich, dass ein schrecklicher Fehler gemacht wurde. Ein Todesopfer im Weltraum ist genau eines zu viel. Der Kongress muss einen Untersuchungsausschuss bilden.‹« Gretchen sah mit grimmiger Miene auf. »Die Worte unseres Lieblingssenators.« »Ich frage mich, wie viele Leute sich noch daran erinnern, dass er unser CRV-Programm zu Fall bringen wollte«, sagte Blankenship. »Das würde ich ihm jetzt gerne unter die Nase reiben.« »Das können Sie nicht tun«, erwiderte Leroy Cornell. Als NASA-Verwaltungschef war es ihm in Fleisch und Blut übergegangen, stets sämtliche politischen Konsequenzen einer Entscheidung abzuwägen. Er war der Verbindungsmann der Weltraumbehörde zum Kongress und zum Weißen Haus, und er vergaß nie zu berücksichtigen, wie sich die Dinge in Washington darstellen würden. »Wenn Sie den Senator direkt angreifen, sitzen wir erst recht in der Tinte.« »Er greift uns doch an!« »Das ist nichts Neues, und jeder weiß, dass es so ist.«, »Die Öffentlichkeit nicht«, meinte Gretchen. »Mit diesen Attacken kommt er in die Schlagzeilen.« »Genau darum geht es ja – der Senator will in die Schlagzeilen«, sagte Cornell. »Wenn wir zurückschießen, geben wir den Medien nur neues Futter. Sehen Sie mal, Parish war noch nie unser Freund. Er hat jede Budgeterhöhung bekämpft, die wir je beantragt haben. Er will Kanonenboote kaufen, keine Raumschiffe, und wir werden ihn niemals umstimmen.« Cornell holte tief Luft und ließ den Blick durch den Raum schweifen. »Also sollten wir uns vielleicht lieber ernsthaft mit der Kritik auseinander setzen. Und uns fragen, ob sie nicht gerechtfertigt ist.« Einen Moment lang war es ganz still. »Offensichtlich sind Fehler gemacht worden«, sagte Blankenship schließlich. »Fehler in der medizinischen Einschätzung. Warum haben wir nicht gewusst, wie krank der Mann wirklich war?« Obie sah, wie die beiden Flugärzte beunruhigte Blicke tauschten. Alles konzentrierte sich jetzt auf die Arbeit des medizinischen Teams. Und auf Emma Watson. Sie war nicht hier, um sich zu verteidigen. Obie würde für sie sprechen müssen. Todd Cutler kam ihm zuvor: »Watson war dort oben stark gehandikapt. Jeder Arzt wäre das gewesen«, sagte er. »Kein Röntgengerät, kein OP. In Wahrheit weiß niemand von uns, weshalb Hirai gestorben ist. Deshalb brauchen wir die Autopsie. Wir müssen wissen, was genau passiert ist und ob die Mikrogravitation dabei eine Rolle gespielt hat.« »An der Notwendigkeit einer Autopsie besteht kein Zweifel«, sagte Blankenship. »In dem Punkt sind sich alle einig.« »Ja, aber der Grund, weshalb ich darauf zu sprechen komme,, ist …« – Cutler senkte die Stimme – »… das Problem der Konservierung.« Es entstand eine Pause. Obie sah, wie sich die Blicke senkten, während alle mit Unbehagen darüber nachdachten, was das bedeutete. »Was er anspricht, ist das Fehlen von Kühlmöglichkeiten an Bord«, erklärte Obie. »Jedenfalls für etwas so Großes wie eine menschliche Leiche, und dann auch noch in einem System mit einem geschlossenen Luftkreislauf.« Woody Ellis, der Flugdirektor der ISS, sagte: »Das Shuttle- Rendezvous ist in siebzehn Stunden. Wie stark kann der Körper in dieser Zeit verwesen?« »An Bord des Shuttles gibt es auch keine Kühlung«, bemerkte Cutler. »Der Tod ist vor sieben Stunden eingetreten. Hinzu kommt die Zeit für das Rendezvous, für den Transport der Leiche und der übrigen Ladung von der ISS ins Shuttle und für das Entkopplungsmanöver. Das heißt, dass die Leiche mindestens drei Tage lang der normalen Raumtemperatur ausgesetzt ist. Und das auch nur, wenn alles wie ein Uhrwerk abläuft. Wovon man, wie wir alle wissen, nicht unbedingt ausgehen kann.« Drei Tage. Obie dachte daran, was innerhalb von zwei Tagen mit einem toten Körper passieren konnte. Er dachte daran, wie rohes Hühnerfleisch stank, wenn er es nur für eine Nacht in seinem Mülleimer stehen ließ … »Wollen Sie damit sagen, die Discovery kann ihren Rückflug zur Erde nicht um einen einzigen Tag aufschieben?«, fragte Ellis. »Wir hatten gehofft, es würde Zeit für andere Aufgaben bleiben. Zahlreiche Experimente an Bord der ISS sind abgeschlossen, und die Wissenschaftler hier unten warten darauf.« »Eine Autopsie wäre wenig aufschlussreich, wenn die Leiche schon zu stark zersetzt wäre«, sagte Cutler., »Gibt es denn keine Möglichkeit, sie zu konservieren? Vielleicht Einbalsamieren?« »Das geht nicht, ohne dass man die Chemie durcheinander bringt. Wir brauchen eine unbehandelte Leiche. Und wir brauchen sie so bald wie möglich.« Ellis seufzte. »Es muss einen Kompromiss geben. Es muss doch möglich sein, irgendetwas zu erreichen, solange sie aneinander gekoppelt sind.« Gretchen meinte: »Vom PR-Blickwinkel aus gesehen wäre es nicht sehr gut, wenn alle ihrer gewohnten Arbeit nachgingen, während auf dem Mitteldeck eine Leiche herumliegt. Und besteht da nicht auch ein gewisses – nun ja, Gesundheitsrisiko? Und dann ist da der … Geruch.« »Die Leiche befindet sich in einem luftdichten Plastiksack«, sagte Cutler. »Und sie können sie hinter dem Vorhang in einer der Kojen aufbewahren.« Angesichts der unappetitlichen Wendung des Gesprächs waren die Gesichter in der Runde ziemlich blass geworden. Sie konnten sich über politische Konsequenzen und Probleme mit den Medien unterhalten, über feindlich gesinnte Senatoren und technische Fehlfunktionen. Aber Leichen, üble Gerüche und verwesendes Fleisch gehörten nicht zu den Dingen, mit denen sie sich gerne befassten. Schließlich brach Leroy Connell das Schweigen. »Dr. Cutler, ich verstehe, dass Sie darauf drängen, die Leiche so schnell wie möglich herzuschaffen, damit eine Autopsie durchgeführt werden kann. Und ich verstehe auch den PR-Standpunkt. Dass es wie ein … Mangel an Feinfühligkeit aussehen könnte, wenn wir einfach unserer Arbeit nachgehen. Aber es gibt Dinge, die getan werden müssen, selbst angesichts unserer Verluste.« Er blickte in die Runde. »Das ist unser oberstes Ziel, habe ich Recht? Eine unserer Stärken als Organisation. Ganz gleich, was passiert, ganz gleich, was wir durchmachen, wir setzen immer, alles daran, den Job zu erledigen, oder?« In diesem Moment spürte Obie, wie die Stimmung im Raum plötzlich umschlug. Bis zu diesem Zeitpunkt hatte der Schatten der Tragödie, der Druck des Medieninteresses auf ihnen gelastet. Er hatte Niedergeschlagenheit und Hoffnungslosigkeit in den Gesichtern gelesen. Jetzt begann der Schatten zu weichen. Sein Blick traf den Cornells, und Obie spürte, wie sein abschätziges Urteil über diesen Mann zu bröckeln begann. Noch nie hatte er Schönrednern wie Cornell getraut. Die NASA- Verwaltungsmenschen betrachtete er als notwendiges Übel, und er duldete sie nur so lange, wie sie sich aus allen praktischen Entscheidungen heraushielten. Cornell hatte diese Linie zuweilen überschritten. Heute jedoch hatte er ihnen allen einen großen Dienst erwiesen, indem er sie dazu gebracht hatte, einen Schritt zurückzutreten und das Gesamtbild zu betrachten. Jeder war mit seinen eigenen speziellen Anliegen in diese Versammlung gekommen. Cutler wollte eine frische Leiche zum Obduzieren, Gretchen Liu wollte die Geschichte mediengerecht hinbiegen, das Shuttle- Bodenpersonal wollte die Mission der Discovery ausdehnen. Cornell hatte sie soeben daran erinnert, dass sie über diesen Todesfall und über ihre individuellen Probleme hinausblicken mussten, um zu erkennen, was das Beste für das Raumfahrtprogramm war. Obie gab seine Zustimmung in Form eines Kopfnickens, was von der Runde am Tisch zur Kenntnis genommen wurde. Endlich hatte die Sphinx ihre Entscheidung bekannt gegeben. »Jeder gelungene Start ist ein Geschenk des Himmels«, sagte er. »Dieser hier soll nicht umsonst gewesen sein.«, 5. August Tot. Emmas Sportschuhe stampften rhythmisch auf die Lauffläche des TVIS-Trainers, und jedes Aufklatschen ihrer Sohlen auf dem rollenden Band, jeder Aufprall, der ihre Knochen, Gelenke und Muskeln durchrüttelte, war ein weiterer Schlag, mit dem sie sich selbst bestrafte. Tot. Ich habe ihn verloren. Ich habe Mist gebaut und ihn verloren. Ich hätte merken müssen, wie krank er war. Ich hätte auf eine CRV-Evakuierung drängen müssen. Aber ich habe es aufgeschoben, weil ich dachte, ich würde es allein schaffen. Ich dachte, ich würde ihn am Leben halten können. Ihre Muskeln schmerzten, Schweißperlen standen ihr auf der Stirn, und dennoch hörte sie nicht auf, sich selbst zu bestrafen, ihre Wut über ihr Versagen an ihrem Körper auszulassen. Sie hatte den TVIS-Trainer seit drei Tagen nicht benutzt, weil sie zu sehr mit Kenichi beschäftigt gewesen war. Jetzt holte sie alles nach. Sie hatte sich die Haltegurte umgeschnallt, hatte das Laufband eingeschaltet und war einfach losgerannt. Auf der Erde lief sie oft und gerne. Sie war nicht besonders schnell, aber sie hatte eine gehörige Ausdauer entwickelt und gelernt, sich in jene hypnotische Trance hineinzusteigern, die Langstreckenläufer überkommt, wenn die Kilometer unter ihren Füßen verrinnen und das Brennen der überanstrengten Muskeln allmählich der Euphorie weicht. Tag für Tag hatte sie an dieser Ausdauer gearbeitet, hatte sich durch schiere Hartnäckigkeit dazu getrieben, immer länger und weiter zu laufen, sich von Lauf zu Lauf immer wieder selbst zu übertrumpfen, ohne jemals nachzulassen. So war sie schon immer gewesen, auch schon als junges Mädchen: kleiner als die anderen, aber zäher, härter. Sie war immer schon hart gewesen, am härtesten jedoch stets gegen, sich selbst. Ich habe Fehler gemacht. Und jetzt ist mein Patient tot. Schweiß durchtränkte ihr Hemd; ein großer feuchter Fleck begann sich zwischen ihren Brüsten auszubreiten. Ihre Unter- und Oberschenkel waren bereits über das Stadium des Brennens hinaus. Die Muskeln zuckten, dem Kollaps nahe wegen des stetigen Widerstands der Halteriemen. Eine Hand griff nach dem Schalter und stellte den TVIS- Trainer ab. Das Laufband kam mit einem Ruck zum Stehen. Sie sah auf und begegnete Luthers Blick. »Ich denke, das ist mehr als genug, Watson«, sagte er leise. »Noch nicht ganz.« »Du bist schon über drei Stunden zugange.« »Ich komme gerade erst in Fahrt«, murmelte sie verbissen. Sie schaltete das Gerät wieder ein, und erneut hämmerten ihre Füße auf das Laufband ein. Luther sah ihr eine Weile zu. Er schwebte auf Augenhöhe vor ihr; sie konnte seinem Blick nicht ausweichen. Sie hasste es, beobachtet zu werden, hasste sogar ihn in diesem Moment, weil sie überzeugt war, dass er ihren Schmerz und ihre Selbstverachtung glatt durchschaute. »Wäre es nicht einfacher, du würdest gleich mit dem Kopf gegen die Wand rennen?«, meinte er. »Einfacher schon. Aber nicht schmerzhaft genug.« »Ich verstehe. Damit es eine Strafe ist, muss es auch ordentlich wehtun, hm?« »Stimmt.« »Würde es etwas ändern, wenn ich dir sagen würde, dass das Quatsch ist? Das ist es nämlich. Vergeudete Energie. Kenichi ist gestorben, weil er krank war.« »Und ich bin dazu da, Leute gesund zu machen.«, »Und du konntest ihn nicht retten. Und jetzt bist du also die Versagerin vom Dienst, was?« »Stimmt genau.« »Da liegst du aber schief. Ich hab dir nämlich den Titel vor der Nase weggeschnappt.« »Soll das so eine Art Wettbewerb sein?« Wieder schaltete er den TVIR-Trainer aus. Wieder kam das Laufband zum Stehen. Er starrte ihr direkt in die Augen. Sein Blick war wütend. So unnachgiebig wie der ihre. »Weißt du noch, wie ich den Bock geschossen habe? Damals auf der Columbia?« Sie sagte nichts. Sie musste nichts sagen, denn keiner in der NASA hatte das vergessen. Es war vor vier Jahren passiert, auf einer Mission mit dem Ziel, einen Nachrichtensatelliten im Orbit zu reparieren. Luther war als Missionsspezialist dafür verantwortlich gewesen, den künstlichen Trabanten nach Abschluss der Reparaturen wieder in seine ursprüngliche Position zu bringen. Die Crew hatte den Satelliten von der Rampe im Nutzlastendock aus in den Weltraum katapultiert und zugesehen, wie er davongetrieben war. Die Steuerraketen hatten ihn auf seine korrekte Umlaufbahn gebracht. Dort angekommen, hatte er plötzlich auf keinerlei Befehle mehr reagiert. Er war im Orbit verreckt – ein Millionen Dollar teures Stück Schrott, das nutzlos um die Erde kreiste. Wer war für diese Kalamität verantwortlich? Ohne Zögern hatte man sogleich Luther die Schuld gegeben. In der Eile hatte er vergessen, wichtige Programmiercodes einzugeben. Das behauptete jedenfalls der private Vertragspartner. Luther bestand darauf, dass er die Codes eingegeben hatte, dass er für Fehler des Satellitenherstellers als Sündenbock herhalten sollte. Während die Öffentlichkeit nur wenig von der Kontroverse mitbekam, war die Geschichte innerhalb der NASA allseits bekannt. Luthers Flugeinsätze, wurden immer weniger. Er war dazu verdammt, als Geisterastronaut sein Dasein zu fristen; immer noch im Korps, aber unsichtbar für diejenigen, die die Shuttle-Crews zusammenstellten. Was die ganze verfahrene Angelegenheit noch komplizierter machte, war die Tatsache, dass Luther schwarz war. Drei Jahre lang hatte er unter der unausgesprochenen Ächtung gelitten, und seine Verbitterung war gewachsen. Nur die Unterstützung seiner engsten Freunde unter den übrigen Astronauten – allen voran Emma – hatte ihn im Korps halten können. Er wusste, dass er nichts falsch gemacht hatte, aber in der NASA glaubte ihm kaum jemand. Er wusste auch, dass die Leute hinter seinem Rücken redeten. Luther war der Mann, den die Ewiggestrigen als Beweis dafür anführten, dass gewisse Minderheiten einfach nicht das »Zeug« zum Astronauten hätten. Er war bemüht, seine Würde zu bewahren und, so schwer es ihm auch fiel, nicht in völlige Verzweiflung zu verfallen. Dann war die Wahrheit ans Licht gekommen. Der Satellit war fehlerhaft gewesen. Luther Arnes war öffentlich von jeglicher Schuld freigesprochen worden. Schon eine Woche darauf hatte Gordon Obie ihm einen Einsatz zugeteilt: eine viermonatige Mission an Bord der ISS. Aber den Schaden, der seinem Ansehen zugefügt worden war, konnte Luther so schnell nicht vergessen. Er wusste aus eigener schmerzlicher Erfahrung, was Emma im Augenblick durchmachte. Jetzt hielt er sein Gesicht so dicht vor das ihre, dass sie gezwungen war, ihm in die Augen zu sehen. »Du bist nicht perfekt, okay? Wir sind alle nur Menschen.« Er machte eine Pause und fügte dann trocken hinzu: »Vielleicht mit Ausnahme von Diana Estes.« Gegen ihren Willen musste sie lachen. »Bestrafung abgeschlossen. Das Leben geht weiter, Watson!«, Ihr Atem ging wieder normal, wenn auch ihr Herz weiter heftig pochte, weil sie immer noch wütend auf sich selbst war. Aber Luther hatte Recht, das Leben ging weiter, und sie musste sich mit den Folgen ihrer Fehlentscheidungen auseinander setzen. Ein abschließender Bericht für Houston war fällig: medizinisches Gutachten, Krankheitsverlauf, Diagnose, Todesursache. Ärztliches Versagen. »Die Discovery dockt in zwei Stunden an«, sagte Luther. »Du hast noch viel zu tun.« Nach einer Weile nickte sie und begann sich loszuschnallen. Zeit, sich wieder an die Arbeit zu machen. Der Leichenwagen war unterwegs. 7. August Festgebunden und versiegelt in seinem Leichentuch aus Plastik drehte sich der Tote langsam im Dämmerlicht. Inmitten des Durcheinanders aus überzähligen Ausrüstungsgegenständen und Ersatzkanistern mit Lithium wirkte Kenichis Leiche wie irgendein nicht mehr benötigtes Teil, das zusammen mit dem anderen Kram in der alten Sojus-Kapsel verstaut worden war. Die Sojus war seit über einem Jahr außer Betrieb, und die Crew nutzte das Versorgungsabteil als zusätzlichen Stauraum. Es schien schrecklich würdelos, Kenichi hier unterzubringen, doch die Crew war durch seinen Tod sehr mitgenommen. Immer wieder mit der Leiche konfrontiert zu werden, die in einem der Module herumschwebte, wo sie leben und arbeiten mussten, wäre zu schlimm für sie gewesen. Emma wandte sich an Commander Kittredge und Sanitätsoffizier O’Leary, die mit der Discovery gekommen waren. »Ich habe die Überreste sofort nach dem Tod versiegelt«, sagte sie., »Seither hat niemand sie angerührt.« Sie brach ab, und ihr Blick fiel wieder auf die Leiche. Der Sack war schwarz, und die Plastikfolie bauschte sich und schlug Falten, sodass von der menschlichen Gestalt im Inneren kaum etwas zu erkennen war. »Die Schläuche sind noch drin?«, fragte O’Leary »Ja. Zwei IV-Zugänge, der Endotrachealtubus und die Magensonde.« Sie hatte nichts verändert; sie wusste, dass die Pathologen, die die Autopsie durchführten, alles an Ort und Stelle belassen haben wollten. »Ihr habt alle Blutkulturen und alle Gewebeproben, die wir ihm entnommen haben. Alles.« Kittredge nickte ernst. »Also los dann.« Emma löste den Sicherungshaken und griff nach der Leiche. Sie fühlte sich steif und aufgequollen an, als ob das Gewebe bereits von anaerober Zersetzung befallen sei. Sie wollte gar nicht darüber nachdenken, wie Kenichi unter der dunklen Plastikschicht inzwischen aussah. Es war eine schweigsame Prozession, die da durch die Raumstation zog, düster wie ein Leichenzug, mit Trauergästen, die, selbst wie Geister schwebend, den Toten durch den langen Tunnel aus Modulen eskortierten. Kittredge und O’Leary bildeten die Spitze; behutsam steuerten sie die Leiche durch die Luken. Jill Hewitt und Andy Mercer folgten ihnen. Niemand sprach ein Wort. Als der Raumtransporter anderthalb Tage zuvor angedockt hatte, waren Kittredge und seine Crew mit Lächeln und Umarmungen, mit frischen Äpfeln und Zitronen und mit einer heiß ersehnten Ausgabe der New York Times vom Sonntag in die Station eingefallen. Dies war Emmas altes Team; die Leute, mit denen sie ein Jahr lang trainiert hatte, und sie wiederzusehen hatte etwas von einem bittersüßen Familientreffen. Jetzt war die Wiedersehensfeier vorüber, und der letzte Gegenstand, der an Bord der Discovery geschafft werden musste, war auf seiner gespenstischen Reise in Richtung Andockmodul., Kittredge und O’Leary steuerten ihre makabre Fracht durch die Luke in das Mitteldeck der Discovery. Hier, wo die Crew des Shuttles schlief und aß, würde die Leiche bis zur Landung aufbewahrt werden. O’Leary manövrierte sie in eine der horizontalen Kojen, die normalerweise als Schlafplatz dienten. Vor dem Start war die Koje zum provisorischen Krankenbett für den Patienten umgebaut worden. Jetzt würde sie als Behelfssarg für die Rückführung der Leiche dienen. »Er passt nicht rein«, sagte O’Leary. »Ich glaube, die Leiche hat sich zu stark ausgedehnt. War sie zu hohen Temperaturen ausgesetzt?« Er sah Emma an. »Nein. Die Temperatur in der Sojus war immer konstant.« »Da haben wir das Problem«, sagte Jill. »Die Plastikfolie ist an der Lüftungsöffnung hängen geblieben.« Sie griff hinein und löste das verhedderte Stück. »Versucht es jetzt mal.« Diesmal passte die Leiche hinein. O’Leary schloss die Abdeckplatte, um der Crew den Anblick zu ersparen. Es folgte die feierliche Abschiedszeremonie der beiden Besatzungen. Kittredge zog Emma an sich und flüsterte: »Bei der nächsten Mission bist du meine erste Wahl, Watson.« Als sie sich wieder voneinander lösten, standen Emma Tränen in den Augen. Das Ganze endete mit dem traditionellen Händedruck der beiden Kommandeure Griggs und Kittredge. Emma erhaschte noch einen letzten Blick auf die winkende Orbiter-Crew – ihre Crew –, dann wurden die Luken geschlossen. Zwar würde die Discovery noch weitere vierundzwanzig Stunden an der ISS angedockt bleiben, während die Crew sich ausruhte und das Abkopplungsmanöver vorbereitete, doch das Verschließen dieser luftdichten Luken hatte jeden unmittelbaren Kontakt zwischen ihnen beendet. Sie befanden sich wieder in zwei getrennten Raumfahrzeugen, die nur vorübergehend miteinander verbunden waren, wie zwei Libellen, die im Hochzeitstanz, durch das Weltall schwebten. Pilotin Jill Hewitt konnte keinen Schlaf finden. Schlaflosigkeit war etwas völlig Neues für sie. Selbst in der Nacht vor einem Start gelang es ihr immer, mühelos in einen tiefen Schlummer zu fallen – im Vertrauen auf das Glück, das ihr ein Leben lang treu gewesen war und sie auch den nächsten Tag überstehen lassen würde. Sie war stolz darauf, noch nie Schlaftabletten gebraucht zu haben. Pillen waren etwas für Flattermänner, die sich ständig den Kopf zerbrachen über die tausend fürchterlichen Dinge, die passieren konnten. Etwas für Zwangsneurotiker. Als Marinepilotin hatte Jill reichlich Erfahrung mit lebensgefährlichen Situationen. Sie hatte Einsätze über dem Irak geflogen, war mit einem angeschlagenen Jet auf einem schwankenden Flugzeugträger gelandet und hatte sich mit dem Schleudersitz in eine stürmische See katapultiert. Sie war, so dachte sie, dem Tod schon so oft von der Schippe gesprungen, dass er es schließlich aufgegeben hatte und geschlagen seiner Wege gezogen war. Und deshalb konnte sie normalerweise nachts ausgezeichnet schlafen. Aber heute Nacht wollte der Schlaf sich einfach nicht einstellen. Es war wegen der Leiche. Niemand mochte in ihrer Nähe sein. Obwohl sie hinter der Abdeckung verborgen war, spürten alle ihre Gegenwart. Der Tod teilte ihren Lebensraum mit ihnen, warf seinen Schatten über ihre Abendmahlzeit und erstickte ihre üblichen Scherze im Ansatz. Er war das unerwünschte fünfte Mitglied ihrer Crew Als wollten sie davor fliehen, hatten Kittredge, O’Leary und Mercer ihre üblichen Schlafplätze verlassen und waren auf das Oberdeck umgezogen. Nur Jill war auf dem Mitteldeck geblieben, wie um den Männern zu beweisen, dass sie nicht so zart besaitet war, dass es ihr als Frau nichts ausmachte, ihr Schlafzimmer mit einer Leiche zu teilen., Aber jetzt, im Dämmerlicht der künstlichen Nacht, musste sie feststellen, dass sie einfach nicht abschalten konnte. Ständig musste sie an das denken, was dort unter der Abdeckung lag. An Kenichi Hirai, als er noch gelebt hatte. Sie erinnerte sich noch ganz deutlich an ihn, an sein blasses Gesicht, seine leise Stimme und sein schwarzes, drahtiges Haar. Einmal hatte sie während des Trainings in der Schwerelosigkeit mit der Hand seinen Kopf gestreift und war überrascht gewesen, wie borstig sein Haar sich anfühlte. Sie fragte sich, wie er jetzt wohl aussah. Plötzlich verspürte sie eine krankhafte Neugier, was aus seinem Gesicht geworden war, welche Veränderungen der Tod bewirkt hatte. Es war die gleiche Neugier, die sie als Kind dazu gebracht hatte, mit Zweigen in Tierkadaver hineinzustechen, die sie im Wald gefunden hatte. Sie beschloss, weiter von der Leiche abzurücken. Sie brachte ihren Schlafsack nach Backbord und machte ihn hinter der Leiter zum Oberdeck fest. Es war die größtmögliche Entfernung, die sie zwischen sich und den Toten bringen konnte, ohne das Deck zu wechseln. Dann zog sie den Reißverschluss wieder zu. Morgen, beim Wiedereintritts- und Landemanöver, müssten alle ihre Reflexe einwandfrei funktionieren, alle Gehirnzellen optimal arbeiten. Mit bloßer Willenskraft gelang es ihr, sich in eine immer tiefer werdende Trance zu zwingen. Sie schlief schon, als die schillernde Flüssigkeit in kleinen Wirbeln aus Kenichis Leichensack hervorzuquellen begann. Angefangen hatte es mit ein paar glitzernden Tröpfchen, die durch den kleinen Riss in der Plastikfolie gesickert waren, wo sie an der Lüftungsöffnung hängen geblieben war. Über Stunden hatte sich Druck aufgebaut, und mit dem Anschwellen seines Inhalts hatte die Plastikhülle sich immer mehr aufgebläht. Jetzt hatte das Loch sich geweitet, und ein schimmerndes flüssiges Band strömte daraus hervor. Es entwich durch die Lüftungsschlitze der Koje und löste sich dann in viele blaugrüne, Tröpfchen auf, die eine Weile im schwerelosen Raum umhertanzten, um dann wieder zu größeren Kugeln zu verschmelzen, die im schwachen Licht der Kabine auf und ab schwebten. Immer mehr opaleszierende Flüssigkeit ergoss sich aus dem Plastiksack. Die Tropfen breiteten sich, getragen vom sanften Strom der zirkulierenden Luft, weiter aus. Sie trieben quer durch die Kabine bis hin zu der schlaffen, reglosen Gestalt, die in ihrem tiefen Schlaf weder die schimmernde Wolke bemerkte, die sie allmählich einhüllte, noch den Nebel, den sie mit jedem ruhigen Atemzug inhalierte, oder die Tröpfchen, die sich wie Kondenswasser auf ihrem Gesicht absetzten. Nur einmal regte Jill Hewitt sich kurz, um sich über die Wange zu wischen, wo die glitzernden Tröpfchen sie kitzelten, während sie langsam auf ihr Auge zuglitten. Mit dem Luftstrom aufsteigend, passierten die tanzenden Tröpfchen den Durchgang zwischen den Decks und breiteten sich im Dämmerlicht des Oberdecks aus, wo die drei Männer in der völligen Entspannung der Schwerelosigkeit schwebten und schliefen., 8. August Der ominöse Wirbel hatte schon vor einigen Tagen über der östlichen Karibik Gestalt angenommen. Begonnen hatte alles als Trog an der Rückseite eines Tiefdruckgebiets, ein sanft gewelltes Wolkenfeld, entstanden aus dem verdunsteten Wasser des sonnenbeschienenen Ozeans. Die Wolken waren mit einer von Norden kommenden Kaltluftschicht zusammengestoßen und ins Rotieren gekommen. Jetzt kreisten sie um ein windstilles Auge aus trockener Luft. Die Spirale schien mit jedem Bild, das der geostationäre Wettersatellit GOES lieferte, weiter anzuwachsen. Der Nationale Wetterdienst hatte die Turbulenz vom Moment ihrer Entstehung an verfolgt und ihre zunächst ziellosen, mäandernden Bewegungen vor der Ostküste Kubas beobachtet. Nun kamen die neuesten Bojendaten herein, mit Messungen von Temperatur, Windstärke und Windrichtung. Diese Daten bestätigten, was die Meteorologen bereits auf ihren Computerbildschirmen sahen. Es war ein tropischer Wirbelsturm. Und er bewegte sich in nordwestlicher Richtung auf die Südspitze Floridas zu. Das war genau die Art von Meldung, die Flugdirektor Randy Carpenter fürchtete wie der Teufel das Weihwasser. Technische Pannen konnten sie beheben. Auch für komplexe Fehlfunktionen der elektronischen Systeme fanden sie immer irgendwie eine Lösung. Aber gegen die Mächte der Natur waren sie machtlos. In der Besprechung des Bodenkontrollteams der Shuttle-Mission ging es an diesem Morgen in erster Linie darum, ob grünes Licht für den Deorbit Burn, den Wiedereintritt der Raumfähre in die, Erdatmosphäre, gegeben werden konnte. Man hatte vorgehabt, das Shuttle in sechs Stunden abzukoppeln und die Zündung für das Verlassen der Umlaufbahn auszulösen. Der Wetterbericht machte ihnen einen Strich durch die Rechnung. »Die Abteilung Raumfahrtmeteorologie des Nationalen Wetterdienstes meldet, dass der Wirbelsturm sich in Richtung Nord-Nordwest auf die Florida Keys zu bewegt«, sagte der Meteorologe. »Die Radarmessungen von Patrick Air Force Base und Melbourne weisen radiale Windgeschwindigkeiten von bis zu fünfundsechzig Knoten auf, bei stärker werdenden Niederschlägen. Die Wetterballons Rawinsonde und Jimsphere bestätigen diese Daten. Außerdem wird vom Field-Mill- Netzwerk und LDAR für das Gebiet um Canaveral zunehmende Blitztätigkeit gemeldet. Diese Bedingungen werden voraus- sichtlich für die nächsten achtundvierzig Stunden gleich bleiben. Möglicherweise auch darüber hinaus.« »Mit anderen Worten«, sagte Carpenter, »wir werden nicht in Kennedy landen.« »Kennedy fällt definitiv aus. Wenigstens für die nächsten drei bis vier Tage.« Carpenter seufzte. »Okay, damit haben wir ja schon mehr oder weniger gerechnet. Hören wir mal, wie es in Edwards aussieht.« Der Luftwaffenstützpunkt Edwards, in einem Tal der Sierra Nevada in Kalifornien gelegen, war nicht ihre erste Wahl. Eine Landung auf Edwards verlängerte die Überholungs- und Bereitstellungszeit bis zum nächsten Shuttle-Einsatz, weil das Raumfahrzeug zuerst von einer Boeing 747 huckepack nach Kennedy zurücktransportiert werden musste. »Leider gibt es mit Edwards auch ein Problem«, sagte der Meteorologe. Carpenter spürte, wie sich sein Magen verkrampfte – eine Vorahnung, dass dies der Beginn einer unglücklichen Ver- kettung von Ereignissen war. Als führender Shuttle-Flugdirektor, hatte er es zu seiner persönlichen Aufgabe gemacht, jeden bekannt gewordenen Zwischenfall zu analysieren, um herauszufinden, was genau falsch gelaufen war. Im Rückblick gelang es ihm gewöhnlich, das Problem über eine Serie auf den ersten Blick harmlos erscheinender Fehlentscheidungen zurückzuverfolgen. Manchmal fing alles schon in der Fabrik an, wenn etwa ein unkonzentrierter Techniker eine Schalttafel falsch verkabelte. War nicht selbst in einem so großen und teuren Gerät wie dem Hubble-Teleskop von Anfang an der Wurm drin gewesen? Jetzt wurde er das Gefühl nicht los, dass er später einmal an genau diese Besprechung zurückdenken und sich fragen würde: Was hätte ich anders machen sollen? Was hätte ich tun können, um eine Katastrophe zu verhindern? »Wie ist die Lage in Edwards?«, fragte er. »Im Moment haben sie dort eine Wolkendecke bei siebentausend Fuß.« »Damit fällt Edwards automatisch flach.« »Richtig. So viel zum sonnigen Kalifornien. Aber es besteht die Möglichkeit eines teilweisen Aufklarens innerhalb der nächsten vierundzwanzig bis sechsunddreißig Stunden. Wir könnten brauchbare Landebedingungen bekommen, wenn wir einfach abwarten. Ansonsten heißt es auf nach New Mexico. Ich habe gerade das MIDDS abgefragt, und in White Sands sieht es gut aus. Wolkenloser Himmel, Gegenwinde von fünf bis zehn Knoten. Wettervorhersage positiv.« »Wir müssen uns also entscheiden«, sagte Carpenter. »Entweder abwarten, bis es in Edwards aufklart, oder gleich nach White Sands gehen.« Mit einem Blick in die Runde forderte er seine Teamkollegen auf, sich zu äußern. Einer der Programm-Manager sagte: »Im Moment können sie es da oben noch gut aushalten. Wir könnten sie so lange an der ISS angedockt lassen, bis das Wetter mitspielt. Ich sehe keine, Notwendigkeit, sie übereilt zurückzuholen, um sie an einem nicht optimalen Standort landen zu lassen.« Nicht optimal war eine Untertreibung. White Sands war kaum mehr als ein abgelegener kleiner Flugplatz mit zwei Reihen von Landebahnmarkierungen. »Wir dürfen nicht vergessen, dass die Leiche so bald wie möglich zur Erde gebracht werden sollte«, sagte Todd Cutler. »Solange eine Autopsie noch irgendwie sinnvoll ist.« »Das ist uns allen bewusst«, erwiderte der Programm- Manager. »Aber dagegen stehen die Nachteile. White Sands hat begrenzte Möglichkeiten. Falls es Probleme bei der Landung gibt, haben wir weit und breit keine zivile medizinische Unterstützung. Alles in allem würde ich sogar vorschlagen, dass wir abwarten, bis Kennedy wieder klar ist. Logistisch gesehen ist es das Beste für das Programm. Die Liegezeit für den Raumtransporter wird verkürzt, und wir können das Shuttle gleich für die nächste Mission auf die Rampe packen. Die Crew kann ja für die nächsten paar Tage die ISS als Hotel benutzen.« Mehrere andere Manager nickten. Sie waren für die konservativste Lösung. Die Crew war dort, wo sie sich befand, in Sicherheit, und angesichts der vielfältigen Probleme, die mit einer Landung in White Sands verbunden waren, verblasste die Dringlichkeit der Rückführung von Hirais Leiche. Carpenter dachte an die Vorwürfe, die man ihm machen würde, sollte es bei einer Landung in White Sands – was Gott verhüten mochte – zur Katastrophe kommen. Er dachte an die Fragen, die er selbst stellen würde, wenn er die Entscheidungen eines anderen Flugdirektors zu überprüfen hätte. Warum haben Sie keine Wetterbesserung abgewartet? Warum haben Sie die Crew so übereilt zurückgeholt? Die richtige Entscheidung war diejenige, die das geringste Risiko barg, ohne dass die Ziele der Mission gefährdet wurden. Er entschied sich für den Mittelweg., »Drei Tage sind zu lang«, sagte er. »Kennedy kommt also nicht in Frage. Entscheiden wir uns für Edwards. Vielleicht haben wir ja morgen einen klaren Himmel.« Er wandte sich an den Meteorologen. »Sehen Sie zu, dass diese Wolken verschwinden.« »Klar. Ich mache einfach einen umgekehrten Regentanz.« Carpenter warf einen Blick auf die Uhr an der Wand. »Okay, die Crew wird in vier Stunden rausgeklingelt. Dann sagen wir ihnen, dass sie vorerst noch nicht nach Hause können.« 9. August Jill Hewitt erwachte keuchend und nach Luft ringend. Ich ertrinke, war ihr erster bewusster Gedanke. Mit jedem Atemzug schien sie Wasser zu inhalieren. Voller Panik öffnete sie die Augen und sah sich von etwas umzingelt, das wie ein Schwarm grüner Quallen aussah. Sie hustete, dann gelang es ihr endlich, einmal tief einzuatmen, und sie hustete erneut. Durch den Luftstoß ihres Atems stoben die Quallen auseinander. Sie befreite sich hastig aus ihrem Schlafsack und schaltete die Kabinenbeleuchtung ein. Verblüfft starrte sie auf die schimmernde Masse, die den Raum erfüllte. »Bob!«, rief sie. »Wir haben ein Leck!« Vom Oberdeck her hörte sie O’Leary sagen: »Mein Gott, was ist das denn?« »Holt die Masken raus!«, befahl Kittredge. »Wir wissen nicht, ob es nicht giftig ist.« Jill öffnete den Notfallschrank, zog die Kontaminationsschutz- Sets heraus und warf Kittredge, O’Leary und Mercer, die durch die Luke in das Mitteldeck getaucht kamen, die Atemmasken und Schutzbrillen zu. Es war keine Zeit zum Anziehen, geblieben; sie trugen noch ihre Unterwäsche und mussten erst einmal richtig zu sich kommen. Nachdem sie die Masken aufgesetzt hatten, betrachteten sie verwundert die blaugrünen Tropfen, die um sie herumschwebten. Mercer griff nach einem und hielt ihn in der Hand fest. »Sonderbar«, sagte er, während er das Material zwischen den Fingern zerrieb. »Es fühlt sich dickflüssig an. Glitschig. Wie eine Art Schleim.« Jetzt fing O’Leary, der Sanitätsoffizier, einen Tropfen ein und hielt ihn dicht vor seine Schutzbrille, um ihn zu begutachten. »Es ist überhaupt keine Flüssigkeit.« »Für mich sieht es danach aus«, meinte Jill. »Es verhält sich wie eine Flüssigkeit.« »Aber es ist eher gallertartig. Fast wie …« Sie zuckten zusammen, als plötzlich laute Musik aus den Lautsprechern tönte. Es war Elvis Presley, der mit seiner Samtstimme »Blue Suede Shoes« sang. Ihr morgendlicher Weckruf von der Bodenkontrolle. »Einen wunderschönen guten Morgen, Discovery«, sagte die muntere Stimme des Capcom. »Zeit, aus den Federn und in die Gänge zu kommen, Leute!« Kittredge antwortete: »Capcom, wir sind schon wach. Wir, äh, wir haben eine ziemlich merkwürdige Situation hier oben.« »Situation?« »Wir haben eine Art Leck in der Kabine. Wir versuchen gerade, es zu identifizieren. Eine zähflüssige Substanz, so eine Art milchiges Blaugrün. Sieht fast aus wie herumfliegende Opale. Es hat sich schon über beide Decks ausgebreitet.« »Habt ihr eure Masken auf?« »Haben wir.«, »Wisst ihr, wo es herkommt?« »Keine Ahnung.« »Okay, wir fragen gleich mal bei ECLSS nach. Die haben vielleicht eine Idee, was es sein könnte.« »Was immer es ist, es scheint nicht toxisch zu sein. Wir haben alle geschlafen, während dieses Zeug in der Luft hing. Niemand von uns scheint krank zu sein.« Kittredge sah von einem maskierten Crewmitglied zum anderen, und alle drei schüttelten den Kopf. »Hat das Zeug irgendeinen Geruch?«, fragte der Capcom. »Die von ECLSS wollen wissen, ob es vielleicht aus dem Abfallentsorgungssystem stammt.« Jill wurde plötzlich ein wenig übel. War dieses Zeug, das sie eingeatmet hatten und in dem sie gerade schwammen, etwa aus der Toilette ausgetreten? »Äh … nun ja, ich schätze, einer von uns muss mal dran schnuppern«, sagte Kittredge. Er sah die anderen an, doch die erwiderten nur stumm seinen Blick. »Ist ja gut, Leute, bloß nicht drängeln«, murmelte er und hob schließlich seine Maske an. Er verrieb einen Tropfen zwischen den Fingern und roch daran. »Ich glaube nicht, dass es sich um Abwasser handelt. Es riecht auch nicht nach Chemikalien. Jedenfalls ist es nichts Petroleumartiges.« »Wie riecht es denn?«, fragte der Capcom. »Irgendwie … fischig. Wie der Schleim von einer Forelle. Vielleicht stammt es aus der Kombüse?« »Oder es könnte ein Leck in einer der biowissenschaftlichen Nutzlasten sein. Ihr habt doch verschiedene Experimente von der ISS an Bord. Sind da nicht auch Aquarien drunter?« »Dieses Zeug erinnert mich aber nicht an Froschlaich. Wir überprüfen mal die Behälter«, sagte Kittredge. Er sah sich in der Kabine um und betrachtete die glitzernden Klümpchen, die an, den Wänden klebten. »Das Zeug setzt sich jetzt überall ab. Wir werden eine Weile brauchen, um die Flecken wegzuwischen. Das wird unseren Wiedereintritt verzögern.« »Äh, Discovery, ich sage es euch ja nur ungern«, erwiderte der Capcom. »Aber der Wiedereintritt wird sich ohnehin verzögern. Ihr werdet Geduld haben müssen.« »Wo liegt das Problem?« »Wir haben ziemlich mieses Wetter hier unten. In Kennedy gibt es Seitenwind von bis zu vierzig Knoten und aufziehende Gewitterwolken. Aus Südosten zieht ein tropischer Wirbelsturm auf. Er hat in der Dominikanischen Republik schon Chaos angerichtet, und jetzt ist er auf dem Weg zu den Keys.« »Wie sieht es mit Edwards aus?« »Dort melden sie momentan eine Wolkendecke bei sieben- tausend Fuß. Die sollte sich aber in den nächsten zwei Tagen verziehen. Also, sofern ihr nicht scharf darauf seid, in White Sands zu landen, müssen wir uns auf eine Verzögerung von mindestens sechsunddreißig Stunden einstellen. Vielleicht lassen wir euch die Luken öffnen und wieder zur ISS-Crew stoßen.« Kittredge musterte die vorbeischwebenden Tropfen. »Abgelehnt, Capcom. Wir würden die Station mit diesem Zeug kontaminieren. Wir müssen erst klar Schiff machen.« »Roger. Der Surgeon ist hier, er möchte wissen, ob es bei der Crew wirklich keine negativen Auswirkungen gibt. Können Sie das bestätigen?« »Das Material ist offenbar harmlos. Niemand weist irgendwelche Krankheitssymptome auf.« Er schlug mit der flachen Hand nach einem Klumpen von Kügelchen, die daraufhin davonwirbelten wie vergossene Perlen. »Irgendwie sind die Dinger ganz hübsch. Aber ich möchte auf keinen Fall, dass sie unsere Elektronik verkleben, also machen wir uns besser gleich ans Aufwischen.«, »Wir halten euch auf dem Laufenden, was das Wetter betrifft, Discovery. Also, dann holt mal die Putzlappen und Eimer raus.« »Ja«, lachte Kittredge. »Man nennt uns auch die himmlische Putzkolonne. Wir reinigen auch Fenster.« Er nahm die Schutzmaske ab. »Ich glaube, es kann nichts passieren, wenn wir sie ausziehen.« Jill nahm ihre Maske und ihre Schutzbrille ab und schwebte auf den Notfallschrank zu. Sie hatte die Ausrüstung eben wieder verstaut, als sie bemerkte, wie Mercer sie anstarrte. »Was ist?«, fragte sie. »Dein Auge – was hast du damit gemacht?« »Was ist denn mit meinem Auge?« »Sieh’s dir an.« Sie schwebte zur Hygienestation hinüber. Der erste Blick in den Spiegel versetzte ihr einen Schock. Die Lederhaut des einen Auges war blutrot. Nicht nur blutunterlaufen, sondern eine leuchtend rote Fläche. »Mein Gott«, murmelte sie, entsetzt über ihr Spiegelbild. Ich bin Pilotin. Ich brauche meine Augen. Und eines davon sieht aus wie eine Blutblase. O’Leary fasste sie an den Schultern, drehte sie zu sich um und musterte ihre Augen. »Das ist nichts Ernstes, okay?«, sagte er. »Nur eine sklerale Blutung.« »Nur?« »Ein wenig Blut ist in das Weiße Ihres Auges gesickert. Es sieht schlimmer aus, als es ist. Das vergeht von selbst wieder, ohne dass Ihre Sehkraft Schaden leidet.« »Wie habe ich mir das eingefangen?« »So etwas passiert zum Beispiel durch eine plötzliche Veränderung des Schädelinnendrucks. Manchmal genügt heftiges Husten oder Erbrechen, um ein Blutgefäß zum Platzen zu bringen.«, Sie atmete erleichtert auf. »Das muss es gewesen sein. Ich bin aufgewacht, weil ich wegen dieser umherfliegenden Schleimklumpen husten musste.« »Sehen Sie? Kein Grund zur Sorge.« Er klopfte ihr auf die Schulter. »Das macht dann fünfzig Dollar. Der Nächste, bitte!« Beruhigt wandte sich Jill wieder dem Spiegel zu. Es ist bloß eine kleine Blutung, dachte sie. Kein Grund zur Sorge. Aber das Bild, das ihr entgegenblickte, entsetzte sie dennoch. Ein normales Auge und eines von abstoßend blutroter Farbe. Etwas Fremdartiges. Etwas Teuflisches. 10. August »Diese Gäste hat uns wirklich der Teufel geschickt«, sagte Luther. »Wir machen ihnen die Tür vor der Nase zu, und sie weigern sich zu gehen.« Gelächter erfüllte die Kombüse der ISS. Selbst Emma lachte mit. In den letzten paar Tagen war die Stimmung an Bord der Station nicht gerade heiter gewesen, und es tat gut, die Leute wieder Witze reißen zu hören. Seit sie Kenichis Leiche in die Discovery verlegt hatten, schienen sich die Gemüter erhellt zu haben. Sein eingehüllter Körper war wie eine grausige und unerbittliche Mahnung an den Tod gewesen, und Emma empfand es als Erleichterung, nicht mehr ständig mit diesem stummen Zeugen ihres Versagens konfrontiert zu werden. Sie konnte sich endlich wieder auf ihre Arbeit konzentrieren. Sie konnte sogar über Luthers Witz lachen, obwohl der Gegenstand seines Spotts – die Tatsache, dass der Raumtransporter nicht ablegen konnte – eigentlich alles andere als komisch war. Ihr Tagesablauf wurde durcheinander gebracht. Laut Plan hätte die Discovery gestern am frühen Morgen abkoppeln sollen. Jetzt war ein Tag vergangen, und die beiden Raumfahrzeuge waren immer noch verbunden und würden es, auch in den kommenden zwölf Stunden bleiben. Die Unsicherheit hinsichtlich der Abflugzeit wirkte sich auch auf den Arbeitsplan der ISS aus. Es war nicht damit getan, dass der Raumtransporter sich einfach von der Station löste und davonflog. Das Abkopplungsmanöver war vielmehr ein heikler Tanz zweier Objekte, die mit 28.000 Stundenkilometern durch den Weltraum rasten, und dazu war die Zusammenarbeit beider Besatzungen erforderlich. Während des Manövers musste die Software der Raumstation vorübergehend für die erforderliche Feinsteuerung rekonfiguriert werden, und die Crew musste ihre wissenschaftlichen Aktivitäten weitgehend einstellen. Alles hatte sich auf die Abtrennung des Raumtransporters zu konzentrieren. Auf die Verhinderung einer Katastrophe. Jetzt hatte ein Wolkenband über einem Luftwaffenstützpunkt in Kalifornien die ganze Operation verzögert und den Arbeitsplan der Station völlig über den Haufen geworfen. Aber das gehörte eben zum Wesen der Raumfahrt; das einzig Vorhersehbare daran war die Unvorhersehbarkeit. Ein Tropfen Traubensaft kam plötzlich an Emmas Kopf vorbeigeflogen. Schon wieder etwas Unvorhersehbares, dachte sie, während sie über Luther lachte, der dem Tropfen mit einem Strohhalm hinterherjagte. Man passt einen Moment lang nicht richtig auf, und schon schwebt einem ein unentbehrliches Werkzeug oder eben ein Schluck Saft davon. Ohne die Schwerkraft konnte ein loser Gegenstand wer weiß wo landen. Das war ein Problem, mit dem die Discovery-Crew jetzt zu tun hatte. »Dieser Dreck hat das ganze Schaltpult von unserem hinteren digitalen Autopiloten versaut«, hörte sie Kittredge über Funk sagen. Der Kommandant der Discovery unterhielt sich mit Griggs über das Subsystem, das die beiden Raumschiffe verband. »Wir sind immer noch dabei, Kippschalter sauber zu machen, aber das Zeug ist wie zäher Schleim, wenn es trocknet. Ich hoffe nur, dass es keine Datenports verstopft hat.«, »Habt ihr schon rausgefunden, wo es herkommt?« »Wir haben einen kleinen Riss im Anglerfisch-Aquarium gefunden. Aber es sieht nicht so aus, als wäre da viel ausgelaufen – nicht so viel, dass es erklären würde, was wir hier in der Kabine herumfliegen sehen.« »Wo könnte es denn sonst noch herkommen?« »Wir überprüfen jetzt die Kombüse und die Toilette. Wir waren so mit Saubermachen beschäftigt, dass wir noch nicht dazu gekommen sind, die Quelle zu identifizieren. Ich komme einfach nicht dahinter, was das für ein Zeug ist. Irgendwie erinnert es mich an Froschlaich. Runde Klümpchen, die sich zu einer klebrigen grünen Masse verbinden. Sie sollten mal unsere Crew sehen – man könnte glauben, die hätten bei Ghostbusters mitgespielt. Und dann hat Hewitt noch dieses schlimme rote Auge. Mensch, wir sehen ganz schön zum Fürchten aus.« Emma wandte sich zu Griggs. »Was ist mit Hewitts Auge?«, fragte sie. »Davon habe ich noch nichts gehört.« Griggs gab die Frage an die Discovery weiter. »Es ist bloß eine sklerale Blutung«, antwortete Kittredge. »Nichts Ernstes, meint O’Leary.« »Lassen Sie mich mit Kittredge reden«, sagte Emma. »Bitte sehr.« »Bob, hier ist Emma«, sagte sie. »Wie ist Jill zu dieser skleralen Blutung gekommen?« »Sie ist gestern mit einem Hustenanfall aufgewacht. Wir glauben, dass das die Blutung verursacht hat.« »Hat sie irgendwelche Schmerzen im Abdomen? Oder Kopfschmerzen?« »Vor einer Weile hat sie über Kopfschmerzen geklagt. Und uns allen tun die Muskeln weh. Aber wir haben hier auch wie die Blöden geschuftet.«, »Übelkeit? Erbrechen?« »Mercer hat sich den Magen verdorben. Wieso?« »Kenichi hatte auch sklerale Blutungen.« »Aber das ist nichts Ernstes«, erwiderte Kittredge. »Das sagt jedenfalls O’Leary.« »Nein, aber die Häufung der Symptome macht mir Sorgen«, sagte Emma. »Kenichis Erkrankung begann mit Erbrechen und skleralen Blutungen. Mit Bauchschmerzen. Und Kopfschmerzen.« »Willst du damit sagen, es handelt sich um eine Art Ansteckung? Warum bist du dann nicht erkrankt? Du hast ihn doch behandelt.« Eine gute Frage. Sie wusste keine Antwort darauf. »Von welcher Krankheit reden wir denn?«, fragte Kittredge. »Ich weiß es nicht. Ich weiß nur, dass Kenichi einen Tag, nachdem die ersten Symptome aufgetreten waren, nicht mehr in der Lage war, irgendetwas zu tun. Ihr müsst sofort ablegen und nach Hause fliegen. Bevor irgendjemand auf der Discovery krank wird.« »Ist nicht drin. Edwards liegt noch immer unter Wolken.« »Dann eben White Sands.« »Ist im Moment keine Alternative. Sie haben da ein Problem mit einem ihrer TACAN-Systeme. Hör mal, uns geht’s doch gut. Wir warten einfach ab, bis das Wetter sich bessert. Sollte nicht länger als noch mal vierundzwanzig Stunden dauern.« Emma sah Griggs an. »Ich möchte mit Houston sprechen.« »Die werden nicht White Sands ansteuern, bloß weil Hewitt ein rotes Auge hat.« »Es könnte mehr sein als nur eine Skleralblutung.« »Wie sollen sie sich denn bei Kenichi angesteckt haben? Sie hatten doch keinen Kontakt mit ihm.«, Die Leiche, dachte sie. Seine Leiche ist im Raumtransporter. »Bob«, sagte sie. »Hier ist noch mal Emma. Ich will, dass ihr euch den Leichensack anseht.« »Was?« »Überprüft Kenichis Plastiksack auf irgendwelche Beschädigungen.« »Du hast doch selbst gesehen, dass er dicht ist.« »Bist du sicher, dass er das noch ist?« »Okay«, seufzte er. »Ich gebe zu, dass wir nicht mehr nach der Leiche gesehen haben, seit sie an Bord ist. Ich schätze, wir gruseln uns alle ein bisschen davor. Wir haben die Abdeckung zugemacht, um sie nicht anschauen zu müssen.« »Wie sieht die Hülle aus?« »Ich versuche jetzt, die Abdeckung zu öffnen. Scheint ein wenig zu klemmen, aber …« Es war einen Moment still. Dann hörte Emma ein gemurmeltes »O Gott«. »Bob?« »Es kommt aus dem Leichensack!« »Was ist es? Blut? Serum?« »In der Plastikfolie ist ein Riss. Ich kann sehen, wie es herausströmt!« Was strömte da heraus? Sie hörte weitere Stimmen im Hintergrund. Angewidertes Stöhnen und ein Geräusch, als ob jemand würgte. »Dichtet es ab! Dichtet es ab!«, rief Emma. Doch sie antworteten nicht. Jill Hewitt sagte: »Sein Körper fühlt sich an wie Brei. Als ob er sich … auflöst. Wir sollten rausfinden, was da vor sich geht.« »Nein!«, schrie Emma. »Discovery, macht den Sack nicht auf!« Zu ihrer Erleichterung erwiderte Kittredge schließlich:, »Roger, Watson. O’Leary, dichten Sie den Sack ab. Wir werden nicht noch mehr von diesem … Zeug auslaufen lassen.« »Vielleicht sollten wir die Leiche über Bord werfen«, meinte Jill. »Nein«, antwortete Kittredge. »Sie brauchen sie für die Autopsie.« »Was für eine Flüssigkeit ist das?«, fragte Emma. »Bob, antworte mir!« Schweigen. Dann sagte er: »Ich weiß es nicht. Aber was immer es ist, ich hoffe, es ist nicht ansteckend. Wir waren alle damit in Kontakt.« Zwölf Kilo Speck mit Haaren – das war Humphrey, der sich wie ein fetter Pascha auf Jacks Brust breit machte. Diese Katze versucht mich umzubringen, dachte Jack, während er in Humphreys bösartige grüne Augen starrte. Er war auf der Couch eingeschlafen, und bevor er wusste, wie ihm geschah, drückte ihm schon eine Tonne Katzenspeck den Brustkorb ein und quetschte die Luft aus seinen Lungen. Schnurrend bohrte Humphrey eine Kralle in Jacks Brust. Mit einem schrillen Schrei stieß Jack ihn von sich, und der Kater landete mit einem dumpfen Aufprall auf allen vieren. »Geh dir eine Maus fangen«, murmelte Jack und drehte sich auf die Seite, um sein Nickerchen fortzusetzen, doch es war hoffnungslos. Humphrey miaute kläglich – er wollte gefüttert werden. Schon wieder. Gähnend hievte Jack sich von der Couch und tappte in die Küche. Kaum hatte er den Schrank mit dem Katzenfutter geöffnet, wurde Humphreys Miauen auch schon lauter. Jack füllte den Napf mit Little Friskies und sah angewidert zu, wie sein böser Geist das Futter in sich hineinschlang. Es war erst drei Uhr nachmittags, und Jack hatte den verlorenen Schlaf noch nicht nachholen können. Er hatte die, ganze Nacht an der Konsole des Flight Surgeon im ISS- Kontrollraum gesessen und war dann nach Hause gegangen, wo er es sich auf der Couch bequem gemacht hatte, um die ECLSS- Subsysteme für die Raumstation zu studieren. Er gehörte wieder dazu, und das war ein gutes Gefühl. Es machte ihm sogar Spaß, sich durch eine knochentrockene Anleitung zur Durchführung einer Shuttle-Operation durchzuarbeiten. Aber die Müdigkeit hatte ihn schließlich übermannt, und gegen Mittag war er eingeschlafen, umgeben von Stapeln von Handbüchern. Humphreys Napf war schon halb leer. Unglaublich. Als Jack aus der Küche gehen wollte, klingelte das Telefon. Es war Todd Cutler. »Wir trommeln das medizinische Personal zusammen, um die Discovery in White Sands zu empfangen«, sagte er. »Das Flugzeug geht in dreißig Minuten ab Ellington.« »Wieso White Sands? Ich dachte, die Discovery würde warten, bis es in Edwards aufklart.« »Wir haben einen Krankheitsfall an Bord und können nicht warten, bis das Wetter sich bessert. Sie verlassen in einer Stunde die Umlaufbahn. Wir müssen Infektionsschutzmaßnahmen treffen.« »Um welche Art von Infektion handelt es sich?« »Ist noch nicht identifiziert. Wir gehen auf Nummer Sicher. Bist du dabei?« »Ja. Ich bin dabei«, sagte Jack, ohne eine Sekunde zu zögern. »Dann solltest du dich beeilen, sonst verpasst du das Flugzeug.« »Moment. Wer ist der Patient? Wer von ihnen ist krank?« »Alle«, erwiderte Cutler. »Die gesamte Crew.«, Infektionsschutzmaßnahmen. Vorzeitiger Wiedereintritt. Was ist da eigentlich passiert? Ein böiger Wind wirbelte Staub und Sandkörnchen über das Rollfeld, als Jack auf den wartenden Jet zutrabte. Während er die Stufen erklomm und durch die niedrige Luke in die Maschine stieg, musste er die Augen zukneifen. Es war eine fünfzehnsitzige Gulfstream IV, mit der die NASA ihr Personal zwischen ihren weit im Land verstreuten Basen hin und her transportierte. Es waren bereits ein Dutzend Leute an Bord, darunter einige Krankenschwestern und Ärzte der Klinik für Flugmedizin. Manche von ihnen winkten Jack zur Begrüßung zu. »Wir müssen los, Sir«, sagte der Copilot. »Wenn Sie sich also bitte anschnallen würden.« Roy Bloomfeld kam als Letzter an Bord. Sein leuchtend rotes Haar war vom Wind zerzaust. Sobald er Platz genommen hatte, schloss der Copilot die Luke. »Kommt Todd nicht mit?«, fragte Jack. »Er sitzt während der Landung an der Konsole. Sieht aus, als sollten wir den Stoßtrupp spielen.« Das Flugzeug rollte auf die Startbahn zu. Sie hatten keine Zeit zu verlieren; der Flug nach White Sands dauerte anderthalb Stunden. »Hast du eine Ahnung, worum es geht?«, fragte Jack. »Ich tappe nämlich völlig im Dunkeln.« »Ich habe einen kurzen Lagebericht bekommen. Du erinnerst dich doch an das Leck, das sie gestern auf der Discovery hatten? Sie wussten zuerst nicht, wo das Zeug herkam, aber jetzt hat sich herausgestellt, dass aus Kenichi Hirais Leichensack Flüssigkeit ausgetreten ist.«, »Der Sack war doch luftdicht verschlossen. Wie konnte da etwas austreten?« »Durch einen Riss in der Plastikfolie. Die Crew sagt, der Inhalt scheint unter Druck zu stehen. Offenbar irgendein fortgeschrittener Zersetzungsprozess.« »Kittredge hat von einer grünlichen Flüssigkeit mit leichtem Fischgeruch gesprochen. Das hört sich kaum nach etwas an, was aus einer verwesenden Leiche austritt.« »Wir stehen alle vor einem Rätsel. Sie haben den Sack wieder versiegelt. Wir werden abwarten müssen, bis sie gelandet sind und wir uns den Inhalt anschauen können. Es ist das erste Mal, dass wir es in der Mikrogravitation mit einer menschlichen Leiche zu tun haben. Vielleicht ändert das etwas am Verwesungsprozess. Vielleicht gehen die anaeroben Bakterien ein, und deshalb entsteht kein übler Geruch.« »Wie krank ist die Crew?« »Hewitt und Kittredge klagen über heftige Kopfschmerzen. Mercer kotzt inzwischen wie ein Reiher, und O’Leary hat Bauchschmerzen. Wir wissen nicht, wie viel davon psychosomatisch ist. Es kann schließlich nicht spurlos an einem vorübergehen, wenn man weiß, dass man die ganze Zeit einen verwesenden Kollegen eingeatmet hat.« Psychologische Faktoren beeinflussten mit Sicherheit das Bild. Bei einem Ausbruch von Lebensmittelvergiftung stellt sich immer wieder heraus, dass ein nicht unerheblicher Prozentsatz der Opfer in Wirklichkeit gar nicht infiziert ist. Die Macht der Suggestion ist so groß, dass sie zu ähnlich heftigem Erbrechen führen kann wie eine tatsächliche Erkrankung. »Sie mussten das Abkopplungsmanöver aufschieben. In White Sands gab es auch Probleme – eines der TACAN-Systeme dort hat falsche Signale ausgesendet. Sie haben ein paar Stunden gebraucht, um es wieder in Ordnung zu bringen.« Das TACAN oder Tactical Air Navigation System bestand aus, einer Reihe von am Boden installierten Sendern, die den Raum- transporter mit aktualisierten Daten über seinen Navigations- vektor versorgten. Ein falsches TACAN-Signal konnte dazu führen, dass das Shuttle die Landebahn glatt verfehlte. »Jetzt sind sie zu dem Schluss gekommen, dass sie nicht mehr warten können«, sagte Bloomfeld. »Innerhalb der letzten Stunde hat sich der Zustand der Crew deutlich verschlechtert. Sowohl Kittredge als auch Hewitt haben sklerale Blutungen. So hat es auch bei Hirai angefangen.« Das Flugzeug rollte zum Start an. Das Dröhnen der Triebwerke füllte ihre Ohren. Dann hob die Maschine ab. Jack musste schreien, um sich in dem Getöse verständlich zu machen. »Was ist mit der ISS? Ist auf der Station jemand erkrankt?« »Nein. Sie haben die Verbindungsluken geschlossen gehalten, um die Kontaminierung einzudämmen.« »Die Sache ist also auf die Discovery beschränkt?« »Ja, soweit wir wissen.« Dann ist Emma okay, dachte er und atmete erleichtert auf. Emma ist in Sicherheit. Aber wenn eine ansteckende Substanz mit Hirais Leiche an Bord der Discovery gelangt war, wieso war dann die Crew der Raumstation nicht ebenfalls infiziert? »Wann soll das Shuttle denn landen?«, fragte er. »Sie koppeln jetzt gerade ab. Der Deorbit Burn soll in fünfundvierzig Minuten sein, Landung gegen siebzehnhundert.« Das ließ der Crew nicht sehr viel Zeit zur Vorbereitung. Er starrte aus dem Fenster, als die Maschine die Wolkendecke durchstieß und das goldene Sonnenlicht sich über sie ergoss. Alles arbeitet gegen uns, dachte er. Eine Notlandung. Ein kaputter TACAN-Sender. Eine kranke Crew. Und das alles wird auf einem kleinen Rollfeld irgendwo in der Pampa zusammenkommen., Jill Hewitts Kopf schmerzte, und ihre Augäpfel taten so weh, dass sie sich kaum auf die Checkliste für das Abkopplungs- manöver konzentrieren konnte. Innerhalb der letzten Stunde waren die Schmerzen in jeden einzelnen Muskel ihres Körpers gekrochen, und nun hatte sie ein Gefühl, als zuckten scharfe Blitze durch ihren Rücken und ihre Oberschenkel. Inzwischen waren die Lederhäute ihrer beiden Augen gerötet, und bei Kittredge war es genauso. Seine Augen sahen aus wie zwei blutgefüllte Ballons, glühend und knallrot. Auch er hatte Schmerzen; sie sah es an seinen Bewegungen, daran, wie langsam und vorsichtig er den Kopf drehte. Sie litten enorme Qualen, doch eine schmerzstillende Spritze wollten sie beide nicht. Das Abkoppeln und Landen verlangte äußerste Konzentration, und sie konnten es sich nicht leisten, auch nur einen Deut in ihrer Aufmerksamkeit nachzulassen. Schafft uns nach Hause. Schafft uns nach Hause. Das war das Mantra, das unaufhörlich in Jills Kopf ablief, während sie sich krampfhaft bemühte, weiter zu funktionieren. Ihr Hemd war schweißnass, und die Schmerzen begannen an ihrer Konzentration zu nagen. Im Eiltempo gingen sie die Checkliste für den Abflug durch. Sie hatte das Kabel des Laptops in den Port der hinteren Konsole gesteckt, das Gerät gestartet und das Programm für das Rendezvous- und Abkopplungsmanöver aufgerufen. »Es kommen keine Daten durch«, sagte sie. »Was?« »Der Port ist wohl von dem Zeug verstopft. Ich versuche es am Datenport auf dem Mitteldeck.« Sie zog das Kabel heraus. Jeder einzelne Knochen in ihrem Gesicht schrie vor Schmerzen auf, als sie mit dem Laptop in der Hand durch die Luke zwischen den Decks kroch. Das Pochen in ihren Augäpfeln war so schlimm, dass sie glaubte, sie würden aus ihren Höhlen, springen. Unten auf dem Mitteldeck sah sie Mercer, der bereits seinen Druckanzug trug und für den Wiedereintritt festgeschnallt war. Er war bewusstlos – wahrscheinlich von dem Schmerzmittel, das er sich gespritzt hatte. O’Leary, der ebenfalls bereits angeschnallt war, war noch wach, wirkte aber benommen. Jill schwebte zum Datenport des Mitteldecks hinüber und schloss den Laptop an. Immer noch kein Datenfluss. »Scheiße. Scheiße.« Sie machte sich auf den Weg zurück zum Flugdeck. Es fiel ihr immer schwerer, sich zu konzentrieren. »Klappt’s nicht?«, fragte Kittredge. »Ich wechsle das Quellkabel aus und versuche es noch einmal an diesem Port.« Das Pochen in ihrem Schädel war jetzt so schlimm, dass ihr Tränen in die Augen traten. Mit zusammengebissenen Zähnen zog sie das Kabel heraus und ersetzte es durch ein neues. Startete den Computer neu. Öffnete das Programm. Das Logo Rendezvous and Proximity Operations erschien auf dem Bildschirm. Schweißperlen erschienen auf ihrer Oberlippe, als sie die bisher verstrichene Flugzeit einzutippen begann. Tage, Stunden, Minuten, Sekunden. Ihre Finger gehorchten nicht so, wie sie sollten. Sie reagierten schwerfällig, und ihre Bewegungen waren so ungeschickt, dass sie die Zahlen mehrmals korrigieren musste. Schließlich wählte sie »Prox Ops« aus und klickte auf »okay«. »RPOP ist initialisiert«, sagte sie erleichtert. »Bereit zur Datenverarbeitung.« Kittredge fragte: »Capcom, sind wir klar zum Abkoppeln?« »Einen Augenblick, Discovery.« Das Warten war zermürbend. Jill sah auf ihre Hand herab und, stellte fest, dass ihre Finger zu zucken begonnen hatten und die Muskeln ihres Unterarms sich unwillkürlich zusammenzogen, als schlängelten sich ein Dutzend Würmer unter ihrer Haut durch. Als würde etwas Lebendiges sich durch ihr Fleisch graben. Sie versuchte verzweifelt, ihre Hand still zu halten, doch ihre Finger zuckten weiter, als stünden sie unter Strom. Holt uns sofort zurück. Solange wir diesen Vogel noch steuern können. »Discovery«, sagte der Capcom. »Ihr seid klar zum Abkoppeln.« »Roger. Digitaler Autopilot auf niedrige Z-Bahn. Abkopplungsmanöver wird gestartet.« Kittredge warf Jill einen Blick zu, aus dem unendliche Erleichterung sprach. »Sehen wir zu, dass wir endlich nach Hause kommen«, sagte er und griff nach der Handbedienung. Flugdirektor Randy Carpenter stand da wie der Koloss von Rhodos, den Blick unbeirrbar auf die Anzeigentafel des Kontrollraums gerichtet. Mit seinem kühlen technischen Verstand verarbeitete er mehrere visuelle Datenströme gleichzeitig, während er zusätzlich den Funkverkehr verfolgte. Wie immer dachte Carpenter mehrere Schritte voraus. Der Druck im Andockmodul war bereits abgelassen. Die Riegel, die den Raumtransporter mit der ISS verklammerten, würden sich lösen, und die zuvor gespannten Federn des Andocksystems würden die beiden Raumfahrzeuge behutsam auseinander schieben, bis kein Kontakt mehr bestand. Erst wenn ein halber Meter Abstand zwischen ihnen war, würden die Steuerungsdüsen der Discovery gezündet werden, um den Raumtransporter von der Station wegzulenken. An jedem Punkt dieser heiklen Abfolge von Operationen konnte etwas schief gehen, doch für jede denkbare Panne hatte Carpenter einen Ausweichplan. Sollten sich die Riegel nicht öffnen, würden kleine Sprengladungen gezündet werden, um die Bolzen, mit denen die Riegel befestigt waren, abzubrechen. Falls das ebenfalls nicht funktionierte, würden zwei, Crewmitglieder der ISS eine EVA durchführen und die Bolzen manuell entfernen. Sie hatten Ausweichpläne für jeden Ausweichplan, waren auf jede mögliche Fehlfunktion eingestellt. Wenigstens auf jede vorhersehbare Fehlfunktion. Wovor sich Carpenter wirklich fürchtete, war eine Funktionsstörung, an die noch niemand gedacht hatte. Und jetzt stellte er sich die Frage, die er sich immer am Beginn einer neuen Phase der Mission stellte: Auf welchen Fall sind wir nicht eingestellt? »ODS hat erfolgreich ausgekuppelt«, hörte er Kittredge verkünden. »Riegel sind gelöst. Wir driften jetzt frei.« Der Controller neben Carpenter stieß triumphierend die Faust in die Luft. Aber Carpenter dachte schon wieder voraus. Das Wetter in White Sands war beständig, Gegenwinde von fünfzehn Knoten. Der TACAN-Sender würde rechtzeitig zur Ankunft des Shuttles betriebsbereit sein. Das Bodenpersonal versammelte sich in diesem Moment bereits auf dem Rollfeld. Es waren keine weiteren Pannen in Sicht – und doch wusste er, dass hinter der nächsten Ecke schon wieder eine lauerte. All dies ging ihm durch den Sinn, sein Gesicht aber zeigte nicht die geringste Regung. Kein Blinzeln, kein Zucken verriet den Kollegen im Kontrollraum irgendetwas von der Panik, die bitter wie Galle in seiner Kehle aufstieg. Auch an Bord der ISS verfolgten Emma und ihre Kollegen angespannt die Ereignisse. Alle Forschungsaktivitäten waren vorübergehend eingestellt worden. Sie hatten sich in der Kuppel von Node 1 versammelt, um zuzusehen, wie das riesige Shuttle sich von der Station abkoppelte. Griggs überwachte die Operation zudem mit Hilfe eines Laptops, dessen Monitor die gleiche 3-D-Darstellung des RPOP-Programms anzeigte, die auch die Bodenkontrolle in diesem Moment auf dem Großbildschirm sah., Durch die Fenster der Kuppel sah Emma, wie die Discovery Zentimeter um Zentimeter von der Station abrückte, und sie seufzte erleichtert auf. Der Orbiter hatte sich komplett losgelöst und war nun auf dem Weg nach Hause. Sanitätsoffizier O’Leary schwebte in einem narkotischen Rauschzustand. Er hatte sich fünfzig Milligramm Demerol in den Arm gespritzt, gerade genug, um die schlimmsten Schmerzen zu lindern, damit er Mercer festschnallen und die Kabine für den Wiedereintritt vorbereiten konnte. Schon diese kleine Dosis des Narkotikums trübte sein Denkvermögen. Er saß angeschnallt an seinem Platz auf dem Mitteldeck, bereit für das Deorbit-Manöver. Die Kabine verschwamm vor seinen Augen, als stünde sie unter Wasser. Das Licht tat seinen Augen weh, und so schloss er sie. Vor wenigen Augenblicken hatte er geglaubt, Jill Hewitt mit dem Laptop vorbeischweben zu sehen; jetzt war sie weg, doch er konnte ihre angespannte Stimme im Kopfhörer vernehmen, dazu die von Kittredge und dem Capcom. Sie hatten abgekoppelt. Selbst in seinem benebelten Zustand verspürte er noch ein Gefühl von Ohnmacht und Scham, weil er hier wie ein Invalide an seinen Sitz festgeschnallt saß, während seine Kollegen oben auf dem Oberdeck sich mühten, das Schiff nach Hause zu fliegen. Sein Stolz ließ ihm keine Ruhe, er kämpfte gegen den verlockenden Schlaf an und zwang sich, aus dem Dunkel des Vergessens wieder in die Realität des hell erleuchteten Mitteldecks aufzutauchen. Er tastete nach den Gurtschnallen, öffnete sie und schwebte aus seinem Sitz. Sofort begann das Deck sich um ihn zu drehen, und er musste die Augen schließen, um der plötzlichen Welle von Übelkeit Einhalt zu gebieten. Wehr dich dagegen, dachte er. Es ist eine reine Willenssache. Ich war doch immer derjenige mit dem eisernen Magen. Doch er konnte sich nicht dazu bringen, die Augen zu öffnen und sich dem irritierenden Schwanken des Raumes auszusetzen., Bis er das Geräusch hörte. Ein Knarren, so nah, dass er glaubte, es müsse Mercer sein, der sich im Schlaf bewegt hatte. O’Leary drehte sich in die Richtung, aus der das Geräusch gekommen war – und stellte fest, dass es nicht Mercer war, den er ansah. Er starrte auf Kenichi Hirais Leichensack. Die Plastikhülle wölbte sich nach außen. Sie schwoll an. Meine Augen, dachte O’Leary. Sie spielen mir einen Streich. Er kniff die Augen zusammen und sah noch einmal hin. Die Plastikhülle war noch immer aufgebläht; wie ein Ballon wölbte sie sich über dem Bauch des Toten. Vor Stunden hatten sie den Riss zugeklebt; jetzt sah es so aus, als steige der Druck im Inneren wieder an. Ihm war, als ob er träumte, während er wie durch einen Dunstschleier auf die Koje zuschwebte und die Hand auf den prallen Plastiksack legte. Und entsetzt zurückwich. Denn in diesem kurzen Moment hatte er gespürt, wie der Inhalt angeschwollen war, sich wieder zurückgezogen hatte und erneut angeschwollen war. Die Leiche pulsierte. Mit schweißbedecktem Gesicht beobachtete Jill Hewitt durch das obere Fenster des Raumtransporters, wie sich die Discovery von der ISS löste. Langsam wuchs der Abstand zwischen den Raumfahrzeugen, und sie blickte wieder auf den Monitor, über den ein stetiger Strom von Daten wanderte. Dreißig Zentimeter Abstand. Sechzig. Wir fliegen nach Hause. Ein stechender Schmerz fuhr plötzlich durch ihren Kopf, so unerträglich, dass sie spürte, wie ihr Bewusstsein zu schwinden begann. Mit der Hartnäckigkeit einer Bulldogge kämpfte sie dagegen an. »ODS ist klar«, stieß sie mit zusammengebissenen Zähnen hervor. Kittredge erwiderte: »Schalte um auf RCS-Steuerung, niedrige, Z-Bahn.« Mit Hilfe der Raketen des Reaktionssteuerungssystems RCS würde Kittredge den Raumtransporter nunmehr vorsichtig von der Station weg zu einem Punkt tausend Meter näher an der Erde steuern; von dort würden die beiden Raumschiffe sich aufgrund ihrer unterschiedlichen Umlaufbahnen automatisch noch weiter voneinander entfernen. Jill hörte den dumpfen Knall der zündenden Steuerraketen und spürte, wie der Raumtransporter erbebte, als Kittredge, der am hinteren Kontrollpult saß, ihn langsam entlang der R-Bahn steuerte. Seine Hand zitterte, und seine Gesichtsmuskeln spannten sich vor Anstrengung. Krampfhaft hielt er den Steuerknüppel umklammert. Er war derjenige, der den Raumtransporter flog, nicht der Computer, eine einzige fahrige Bewegung seiner Hand konnte sie aus der Bahn werfen. Eins Komma fünf Meter Abstand. Drei Meter. Sie hatten die entscheidende Phase der Abtrennung jetzt hinter sich und rückten weiter und weiter von der Station ab. Jill begann sich zu entspannen. Und dann hörte sie den Schrei vom Mitteldeck. Einen Schrei ungläubigen Entsetzens. O’Leary. Sie drehte sich genau in dem Moment um, als die grausige Fontäne aus menschlichen Überresten sich in das Oberdeck ergoss und auf sie zuschoss. Kittredge, der sich am nächsten an der Verbindungsluke aufgehalten hatte, wurde am heftigsten getroffen und gegen die manuelle Rotationssteuerung geschleudert. Jill taumelte nach hinten, und der Kopfhörer wurde ihr vom Kopf gerissen, während übel riechende Fetzen von Gedärm und Haut und schwarze Haarbüschel mit Kopfhaut daran auf sie niederprasselten. Kenichis Haar. Sie hörte das Krachen der Steuerraketen, und der Raumtransporter schien einen Satz zu machen. Die Wolke aus zersetzten Körperteilen hatte sich im, ganzen Oberdeck ausgebreitet und wirbelte wie eine albtraumhafte Galaxis umher, Plastikfetzen, zerrissene Organe und seltsame grünliche Klumpen. Eine Traube von ihnen schwebte vorbei und klatschte neben ihr gegen die Wand. Wenn Tropfen irgendeiner Flüssigkeit in der Schwerelosigkeit mit einer flachen Oberfläche kollidieren und daran haften bleiben, dann vibrieren sie durch den Aufprall noch einen Moment und erstarren dann. Diese Spritzer hatten nicht aufgehört, sich zu bewegen. Ungläubig sah sie zu, wie das Zittern stärker wurde und eine Wellenbewegung die Oberfläche kräuselte. Jetzt erst erkannte sie, tief eingebettet in die gallertartige Masse, eine Art Kern, ein schwärzliches Etwas, das sich bewegte. Es krümmte und wand sich wie eine Mückenlarve. Plötzlich fiel ihr Blick auf ein neues, noch unglaublicheres Bild. Sie starrte durch das Fenster des Oberdecks und sah die Raumstation, die mit rasender Geschwindigkeit auf sie zugeschossen kam. Sie war schon so nah, dass Jill die Nieten an der Trägerstruktur der Sonnensegel erkennen konnte. In panischem Entsetzen stieß sie sich von der Wand ab und tauchte mit ausgestreckten Armen durch die ekelhafte Wolke aus zerfetztem Fleisch hindurch auf das Steuerpult des Raumtransporters zu. »Kollisionskurs!«, schrie Griggs über Funk. »Discovery, Sie sind auf Kollisionskurs!« Es kam keine Antwort. »Discovery! Kurs sofort umkehren!« Starr vor Schreck sah Emma, wie das Verderben auf sie zuraste. Durch das Fenster in der Kuppel erkannte sie, wie die Nase des Raumtransporters sich hob und das Schiff gleichzeitig nach steuerbord rollte. Sie sah, wie der Deltaflügel der, Discovery auf sie zuraste. Die Wucht des Aufpralls würde ausreichen, die Aluminiumhülle der Station aufzureißen. In der unmittelbar bevorstehenden Kollision sah sie ihren eigenen Tod herannahen. Plötzlich schossen Rauchfontänen aus der Düse der vorderen RCS-Steuerrakete in der Nase des Raumtransporters. Durch die Schubumkehr senkte sich der Bug der Discovery, und gleichzeitig rollte der Deltaflügel an der Steuerbordseite wieder zurück, jedoch nicht schnell genug, um die Kollision mit dem Hauptträger der Sonnensegel zu vermeiden. Emma spürte, wie ihr Herzschlag aussetzte. Sie hörte Luther flüstern: »Herr im Himmel!« »CRV!«, schrie Griggs in Panik. »Alle Mann ins Rettungsfahrzeug!« In einem chaotischen Gewirr rudernder Arme und Beine hastete die Crew auf den Ausgang des Verbindungsknotens zu. Nikolai und Luther krochen als Erste durch die Luke in das Wohnmodul. Emma hatte gerade den Handgriff an der Luke gepackt, als das Kreischen zerreißenden Metalls an ihr Ohr drang, das Ächzen des Aluminiums, das sich unter dem Zusammenstoß zweier gewaltiger Objekte verdrehte und verformte. Die Raumstation erbebte, und sie sah nur noch, wie die Wände der Kapsel wegkippten, wie Griggs’ Laptop in der Luft umherwirbelte und Dianas schweißüberströmtes Gesicht vor ihr auftauchte, gezeichnet von äußerstem Entsetzen. Das Licht flackerte einige Sekunden und erlosch. In der Dunkelheit blinkte ein rotes Warnlicht auf. An – aus, an – aus. Eine Sirene heulte., Shuttle-Flugdirektor Randy Carpenter sah den Tod auf dem Großbildschirm. Im Augenblick der Kollision spürte er den Schlag so deutlich, als hätte ihm jemand eine Faust in die Brust gerammt. Er hob sogar die Hand und hielt sie auf sein Herz. Einige Sekunden lang war es im Kontrollraum totenstill. Alle starrten fassungslos auf den Bildschirm mit der Weltkarte, auf der die Flugbahn des Shuttle sich abzeichnete. Rechts davon war das eingefrorene RPOP-Display mit den dreidimensionalen Darstellungen der Discovery und der ISS zu sehen. Der Orbiter war jetzt wie ein zerknautschtes Spielzeug mit der Silhouette der ISS verschmolzen. Carpenter spürte, wie seine Lungen sich plötzlich ausdehnten, und stellte fest, dass er vor Entsetzen vergessen hatte zu atmen. Im Kontrollraum brach das Chaos aus. »Flight, wir haben keine Sprechverbindung«, hörte er den Capcom sagen. »Die Discovery antwortet nicht.« »Flight, wir bekommen immer noch Daten vom TCS …« »Flight, kein Druckabfall in der Kabine. Kein Hinweis auf Sauerstoffverlust …« »Was ist mit der ISS?«, fragte Carpenter ungeduldig. »Haben wir ein Signal von denen?« »SVO versucht sie zu rufen. Der Druck in der Station sinkt …« »Wie stark?« »Er liegt jetzt bei siebenhundertzehn … sechshundertneunzig. O Mann, das geht verdammt schnell!« Ein Leck im Rumpf der Station, dachte Carpenter. Aber es war nicht seine Aufgabe, sich darum zu kümmern. Das war Sache, des SVO, des Kontrollraums der ISS am anderen Ende des Gangs. Plötzlich schaltete sich der Antriebsingenieur ein. »Flight, ich sehe eine Zündung der RCS-Raketen. F2U, F3U und F1U. Irgendjemand bedient da gerade die Steuerung im Orbiter!« Carpenter richtete sich gespannt auf. Auf dem RPOP-Display war immer noch das Standbild zu sehen; es kamen offenbar keine neuen Daten herein. Doch die Meldung des Antriebs- ingenieurs verriet ihm, dass die Steuerraketen der Discovery gerade gezündet hatten. Das musste mehr sein als eine zufällige Explosion – die Crew versuchte, den Raumtransporter von der ISS wegzusteuern. Aber solange sie keine Funkverbindung hatten, konnten sie nicht wissen, wie der Zustand der Crew war. Es gab keine Bestätigung, dass sie noch am Leben waren. Es war das schrecklichste Szenario von allen; keines fürchtete er mehr als dieses. Eine tote Crew an Bord eines um die Erde kreisenden Shuttle. Houston konnte die meisten Manöver des Raumtransporters zwar vom Boden aus steuern, doch zur Erde bringen konnten sie ihn nur mit Hilfe der Crew. Ein funktionierendes menschliches Wesen war vonnöten, um die Schalter umzulegen, mit denen die Zündung für den Wiedereintritt ausgelöst wurde. Eine menschliche Hand musste die Sonden für die Luftdatenmessung aktivieren und das Fahrgestell für die Landung ausfahren. Ohne dass irgendjemand am Steuerpult saß und diese Aufgaben übernahm, würde die Discovery in der Umlaufbahn bleiben, ein Geisterschiff, das lautlos um die Erde kreiste, bis es schließlich nach Monaten als Feuerball zur Erde stürzte. Dieser Albtraum zog vor Carpenters geistigem Auge vorbei, während die Sekunden verstrichen und sich um ihn herum im Kontrollraum allmählich Panik ausbreitete. Er konnte keinen Gedanken an die Raumstation verschwenden, deren Besatzung vielleicht in diesem Moment einen entsetzlich qualvollen Tod durch Druckverlust erlitt. Er musste sich auf die Discovery konzentrieren, auf seine Crew,, deren Überleben mit jeder Sekunde des Schweigens unwahrscheinlicher erschien. Dann hörten sie mit einem Mal die Stimme. Schwach, stockend. »Bodenkontrolle, hier Discovery. Houston, Houston …« »Es ist Hewitt!«, rief der Capcom. »Sprechen Sie weiter, Discovery!« »… schwerer Zwischenfall … konnten Kollision nicht verhindern. Schaden am Orbiter scheint minimal …« »Discovery, wir brauchen Bilder von der ISS.« »Ku-Antenne kann nicht eingesetzt werden … Videoanlage ausgefallen …« »Können Sie etwas über das Ausmaß des Schadens an der Station sagen?« »Beim Zusammenstoß ist ihr Sonnensegelträger abgerissen worden. Ich glaube, wir haben ihnen auch ein Loch in den Rumpf gerammt …« Carpenter drehte sich der Magen um. Sie hatten immer noch nichts von der ISS-Crew gehört. Keine Bestätigung, dass sie noch lebten. »Wie ist der Status Ihrer Crew?«, fragte der Capcom. »Kittredge reagiert kaum noch. Er ist mit dem Kopf gegen die hintere Konsole geprallt. Und die Mitteldeck-Besatzung – ich weiß nicht, was mit denen ist …« »Wie ist Ihr Status, Hewitt?« »Ich versuche … o Gott, mein Kopf …« Ein leises Schluchzen war zu hören. Dann sagte sie: »Es lebt.« »Habe nicht verstanden.« »Das Zeug, das hier rumschwebt – das aus dem Leichensack ausgetreten ist. Es fliegt um mich herum. Es ist in mir drin! Ich kann sehen, wie es sich unter meiner Haut bewegt, es lebt!«, Carpenter lief es eiskalt über den Rücken. Halluzinationen. Eine Kopfverletzung. Sie waren dabei, sie zu verlieren – ihre einzige Chance zu verlieren, den Raumtransporter heil zur Erde zu bringen. »Flight, wir nähern uns dem vorgesehenen Zündungs- zeitpunkt«, warnte der Flugdynamikoffizier. »Wir können es uns nicht leisten, ihn zu verpassen.« »Sagen Sie ihr, sie soll den Deorbit Burn einleiten«, befahl Carpenter. »Discovery«, sagte der Capcom. »Gehen Sie auf APU- Vorstufe.« Keine Antwort. »Discovery?«, wiederholte der Capcom. »Sie werden den Zündungszeitpunkt verpassen!« Die Sekunden dehnten sich zu Minuten, und Carpenters Muskeln spannten sich, und seine Nerven glühten wie Hochspannungsdrähte. Erleichtert seufzte er auf, als Hewitt endlich antwortete. »Die Mitteldeck-Besatzung ist in Landestellung. Sie sind beide bewusstlos. Ich habe sie angeschnallt. Aber ich kann Kittredge nicht in seinen Druckanzug bekommen …« »Zum Teufel mit seinem Anzug!«, rief Carpenter. »Wir dürfen den Zeitpunkt nicht verpassen. Bringen wir endlich diesen Vogel runter!« »Discovery, wir raten Ihnen, sofort mit APU-Vorstufe zu beginnen. Binden Sie ihn einfach im Steuerbordsitz fest und machen Sie sich an die Vorbereitung!« Sie hörten ein gebrochenes Stöhnen. Dann sagte Hewitt: »Mein Kopf – ich kann nicht richtig sehen …« »Wir haben verstanden, Hewitt.« Capcoms Stimme klang fast besänftigend. »Hören Sie, Jill. Wir wissen, dass Sie jetzt auf dem Kommandantenplatz sitzen. Wir wissen, dass Sie Schmerzen, haben. Aber wir können Sie per Autoland führen, von der Zündung bis zum Ausrollen. Wenn Sie nur dranbleiben.« Sie stieß einen gequälten Seufzer aus. »APU-Vorstufe abgeschlossen«, flüsterte sie. »OPD 3-0-2 wird geladen. Sagen Sie mir Bescheid, Houston.« »Klar zum Deorbit Burn«, sagte Carpenter. Der Capcom gab die Entscheidung weiter. »Klar zum Deorbit Burn, Discovery.« Und leise fügte er hinzu. »Also dann, holen wir euch endlich nach Hause.« In der höllischen Finsternis stellte Emma sich innerlich auf den Schock des Druckabfalls ein. Sie wusste genau, was sie erwartete. Wie sie sterben würde. Zuerst das Heulen der aus dem Rumpf entweichenden Luft. Dann würde es ihre Trommel- felle zerreißen, und ihre Lungen würden sich ausdehnen, bis unter fürchterlichen Schmerzen die Lungenbläschen platzten. Wenn der Druck in einem Raum bis zum Vakuum hin abfällt, sinkt gleichzeitig auch der Siedepunkt von Flüssigkeiten, bis er schließlich mit dem Gefrierpunkt zusammenfällt. Das Blut kocht, um Augenblicke später in den Adern zu Eis zu erstarren. Die roten Warnlichter und die Sirene bestätigten ihre schlimmsten Befürchtungen. Es war ein Notfall erster Stufe. Sie hatten ein Leck im Rumpf, und die Atemluft strömte ins All hinaus. Sie spürte das Knacken in ihren Ohren. Sofort evakuieren! Mit Diana tauchte sie in das Wohnmodul ein und flog durch die Dunkelheit, die nur durch die roten Lichtblitze von den Warntafeln erhellt wurde. Die Sirene war so laut, dass sie schreien mussten, um sich verständigen zu können. In ihrer Panik stieß Emma mit Luther zusammen, der sie packte, bevor sie in die andere Richtung davonschnellen konnte. »Nikolai ist schon im CRV! Du und Diana als Nächste!«, rief er., »Warte. Wo ist Griggs?« »Los, rein mit dir!« Emma drehte sich um. In dem psychedelischen Geflimmer der Warnleuchten konnte sie in dem Modul niemanden sonst erkennen. Griggs war ihnen nicht gefolgt. Ein merkwürdiger Dunst schien den düsteren Raum auszufüllen, doch von dem orkanartigen Luftstrom, mit dem sie auf das Leck zugetrieben werden sollten, war nichts zu merken. Und keine Schmerzen, stellte sie plötzlich fest. Sie hatte das Knacken in ihren Ohren gespürt, aber keine Schmerzen in der Brust, keine Symptome eines Dekompressionsschocks. Wir können diese Station retten. Wir haben noch Zeit, das Leck zu isolieren. Mit einer geübten Bewegung wendete sie, stieß sich ab und flog in Richtung Verbindungsknoten zurück. »He! Was soll das, Watson?«, schrie Luther. »Gebt das Schiff nicht auf!« Sie bewegte sich so schnell, dass sie mit dem Ellbogen an den Rand der Luke stieß. Da war er nun, der Schmerz – verursacht nicht durch den Druckabfall, sondern durch ihre eigene dumme Ungeschicklichkeit. Ihr Arm pochte, als sie sich wieder abstieß und in den Verbindungsknoten schwebte. Griggs war nicht dort, aber sie sah seinen Laptop, der an seinem Datenkabel hängend dahintrieb. Auf dem Monitor blinkte eine leuchtend rote Warnanzeige auf: »Druckabfall.« Der Luftdruck war auf sechshundertfünfzig gefallen und fiel weiter. Sie hatten nur Minuten, um den Job zu erledigen, Minuten, bis ihr Gehirn den Dienst versagen würde. Er hat sich bestimmt auf die Suche nach dem Leck gemacht, dachte sie. Er will das beschädigte Modul isolieren. Sie tauchte durch den dichter werdenden Nebel in das US- Labor. War es wirklich Nebel, oder trübte sich ihr Blick bereits, durch den Sauerstoffmangel? War es ein Warnzeichen, dass sie das Bewusstsein zu verlieren drohte? Sie schoss weiter durch die Finsternis. Die Warnlichter, die unaufhörlich wie Stroboskope blinkten, raubten ihr die Orientierung. An der gegenüber- liegenden Seite stieß sie gegen die Luke. Ihre Koordination hatte gelitten, ihre Ungeschicklichkeit nahm zu. Es gelang ihr, durch die Luke in Node 2 zu schlüpfen. Griggs war da. Er war damit beschäftigt, ein Bündel von Kabeln auseinander zu ziehen, die zwischen dem NASDA- und dem ESA-Modul verliefen. »Das Leck ist im NASDA!«, schrie er über den Lärm der Sirenen hinweg. »Wenn wir die Kabel aus dieser Luke herauskriegen und sie verschließen, können wir das Modul isolieren.« Sie tauchte auf ihn zu, um ihm mit den Kabeln zu helfen. Sie fand eines, das sich nicht lösen ließ. »Was ist das, zum Teufel?«, rief sie. Alle Kabel, die durch Luken hindurch verlegt waren, sollten eigentlich im Notfall leicht zu trennen sein. Dieses hier war jedoch durchgehend – ein Verstoß gegen die Sicherheitsvorschriften. »Es hat keine Steckverbindung!«, schrie sie. »Besorgen Sie mir ein Messer, dann schneide ich es durch!« Sie wirbelte herum und tauchte wieder in das US-Labor ein. Ein Messer. Wo finde ich jetzt ein verdammtes Messer? In dem roten Blitzlichtgewitter fiel ihr Blick auf den Medizinschrank. Ein Skalpell. Sie riss das Schubfach auf, griff in den Instrumentenkasten und eilte nach Node 2 zurück. Griggs nahm das Messer und begann das Kabel zu durchtrennen. »Wie können wir euch helfen?«, hörten sie Luther rufen. Emma drehte sich um und sah ihn zusammen mit Nikolai und Diana besorgt durch die Luke spähen., »Das Leck ist im NASDA-Modul!«, rief sie. »Wir wollen es isolieren.« Plötzlich sprühten Funken aus dem Kabel. Griggs zuckte zurück. »Scheiße, da ist Saft drauf!« »Wir müssen es aber durchschneiden!«, sagte Emma. »Und uns brutzeln lassen wie ein Stück Speck? Da halte ich aber gar nichts von.« »Und wie sollen wir dann die Luke verschließen?« »Wir ziehen uns weiter zurück ins Labor!«, sagte Luther. »Bis ins Labor! Wir versiegeln den ganzen Komplex und isolieren dieses Ende der Station!« Griggs sah auf das Funken sprühende Kabel. Er wollte Node 2 nicht verschließen, denn das bedeutete, sowohl das NASDA- als auch das ESA-Modul aufzugeben. Der dann dort eintretende völlige Druckverlust würde diese Teile der Station unbrauchbar machen. Und es bedeutete, den Andockknoten für das Shuttle aufzugeben, der ebenfalls von Node 2 abzweigte. »Wir verlieren weiter Druck, Leute«, rief Diana, die den Wert von einem tragbaren Druckmessgerät ablas. »Wir sind jetzt bei sechshundertfünfundzwanzig Hektopascal! Jetzt kommt endlich da raus, damit wir das Scheißding abriegeln können!« Emma spürte schon, dass ihr Atem schneller ging und sie nach Luft zu ringen begann. Hypoxie – Sauerstoffmangel. Sie würden alle das Bewusstsein verlieren, wenn sie nicht sehr schnell handelten. Sie zupfte Griggs am Ärmel. »Kommen Sie! Es ist die einzige Möglichkeit, die Station zu retten!« Er nickte benommen und folgte Emma in das US-Labor. Luther versuchte die Luke zu schließen, doch die Klappe rührte sich nicht von der Stelle. Da sie jetzt außerhalb von Node 2 waren, mussten sie die Klappe zuziehen statt zudrücken und somit gegen den Strom der entweichenden Luft ankämpfen. Und, das in einer Atmosphäre mit rapidem Druckverlust. »Wir müssen dieses Modul auch aufgeben!«, schrie Luther. »Wir ziehen uns nach Node 1 zurück und schließen die nächste Luke!« »Nein, verdammt noch mal!«, erwiderte Griggs. »Ich gebe nicht auch noch dieses Modul auf!« »Wir haben keine Wahl. Ich kriege diese Klappe nicht zu!« »Dann lassen Sie mich ran!« Griggs fasste den Griff und zog mit aller Kraft daran, doch die Klappe bewegte sich nur wenige Zentimeter, bevor er erschöpft loslassen musste. »Sie bringen uns noch alle um, nur weil Sie dieses Scheißmodul retten wollen!«, rief Luther. Es war Nikolai, der plötzlich mit der Lösung herausplatzte. »Die Mir! Wir müssen das Leck füttern! Das Leck füttern!« Er schoss aus dem Labor heraus auf das russische Ende der Station zu. Die Mir. Alle wussten sofort, wovon er sprach. 1997. Die Kollision der Progress mit dem Spektr-Modul der Mir. Der Rumpf der Station war beschädigt worden, und die kostbare Atemluft war aus der russischen Raumstation in den Weltraum geströmt. Die Russen hatten mit ihrer jahrelangen Erfahrung in der bemannten Raumfahrt sofort eine Notlösung parat gehabt: das Leck füttern. Zusätzlicher Sauerstoff wird in das Modul gepumpt, um den Druck anzuheben. Dadurch gewannen sie nicht nur wertvolle Zeit; möglicherweise konnten sie das Tempo des Druckabfalls auch so weit herabmindern, dass die Luke sich schließen ließ. Nikolai kam mit zwei Sauerstofftanks ins Labor zurückgeschwebt. Hastig drehte er die Ventile bis zum Anschlag auf. Selbst durch den Höllenlärm der Sirenen hindurch konnten sie das Zischen des entweichenden Gases hören. Nikolai warf beide Tanks in Node 2. Das Leck füttern. So sorgten sie für, einen Druckanstieg auf der anderen Seite der Luke. Wir lassen allerdings auch Sauerstoff in einen Raum strömen, in dem sich ein beschädigtes Strom führendes Kabel befindet, dachte Emma. Die Funken. Das kann zu einer Explosion führen. »Jetzt!«, rief Nikolai. »Versucht die Luke zu schließen!« Luther und Griggs packten gemeinsam den Griff und begannen zu ziehen. Sie würden nie erfahren, ob es an ihren vereinten letzten Kräften gelegen hatte oder daran, dass es ihnen gelungen war, den Druckabfall auf der anderen Seite zu bremsen; jedenfalls begann sich die Klappe langsam zu schließen. Sobald sie einrastete, verriegelte Griggs sie. Einen Moment lang hingen er und Luther einfach nur schlaff in der Luft, zu erschöpft, um ein Wort zu sagen. Dann drehte Griggs sich zu den anderen; sein schweißnasses Gesicht glänzte im flackernden Licht. »Jetzt stellen wir erst mal diesen Scheißlärm ab.« Der Laptop schwebte immer noch in Node 1, wo er ihn zurückgelassen hatte. Er tippte hastig eine Reihe von Befehlen ein, während er gebannt auf den leuchtenden Monitor starrte. Zur allgemeinen Erleichterung brach das Sirenengeheul abrupt ab. Auch die roten Blinklichter erloschen, und zurück blieb nur ein schwaches gelbliches Leuchten, das von den Alarmkonsolen ausging. Endlich konnten sie sich unterhalten, ohne zu schreien. »Luftdruck ist wieder auf sechshundertneunzig und steigt weiter«, verkündete Griggs und lachte erleichtert auf. »Sieht aus, als wären wir aus dem Schneider!« »Warum haben wir immer noch eine Stufe-3-Warnung?«, fragte Emma und wies auf das gelbe Licht auf dem Bildschirm. Eine Stufe-3-Warnung konnte dreierlei bedeuten: Ihr Reserve- Steuerungscomputer war defekt, eines ihrer Gyrometer zur Bewegungskontrolle war ausgefallen, oder sie hatten die S- Band-Funkverbindung zur Bodenkontrolle verloren., Griggs drückte noch ein paar Tasten. »Es ist das S-Band. Es ist weg. Die Discovery muss unseren P-1-Träger getroffen und die Antenne abgerissen haben. Sieht aus, als hätten sie auch unsere Backbord-Sonnensegel abgebrochen. Wir haben ein Photovoltaik-Modul eingebüßt. Deshalb haben wir auch immer noch einen teilweisen Stromausfall.« »In Houston drehen sie sicher schon durch, weil sie nicht wissen, was hier vorgeht«, sagte Emma. »Und jetzt können sie uns nicht erreichen. Was ist mit der Discovery? Wie ist es denen ergangen?« Diana, die schon am Funkgerät herumdrehte, sagte: »Die Discovery antwortet nicht. Vielleicht sind sie außerhalb des UKW-Bereichs.« Oder sie waren alle tot und konnten deshalb nicht antworten. »Kriegen wir die Beleuchtung wieder hin?«, fragte Luther. »Wenn wir die Primärenergieversorgung über Kreuz verlegen?« Griggs haute wieder in die Tasten. Das Schöne am Konzept der ISS war unter anderem die eingebaute Redundanz. Jeder ihrer Stromkreise war dafür ausgelegt, bestimmte Nutzlasten mit Elektrizität zu versorgen, aber die Bahnen konnten nach Bedarf umgeleitet – »über Kreuz verlegt« – werden. Sie hatten zwar ein Photovoltaik-Modul verloren, aber es blieben immer noch drei, die sie anzapfen konnten. Griggs meinte: »Ich weiß, es ist eine abgedroschene Phrase, aber – es werde Licht!« Er drückte auf eine Taste, und die Be- leuchtung im Modul wurde eine Spur heller. Hell genug, um sich zurechtzufinden. »Ich habe die Energieversorgung umgeleitet. Alle entbehrlichen Nutzlastfunktionen sind vom Netz.« Er atmete tief durch und sah Nikolai an. »Wir müssen mit Houston Kontakt aufnehmen. Jetzt sind Sie gefragt, Nikolai.« Der Russe wusste sofort, was er zu tun hatte. Die Bodenkontrolle in Moskau unterhielt eine eigene, getrennte Funkverbindung zur Station. Das russische Ende der ISS war bei, der Kollision vermutlich nicht beschädigt worden. Er nickte kurz. »Hoffen wir nur, dass die in Moskau ihre Stromrechnung bezahlt haben.« ITEM 3-7-EXEC ITEM 3-8-EXEC OPS 3-0-4 PRO Die Schmerzen raubten Jill Hewitt fast den Atem, und jedes Mal, wenn sie auf der Steuerkonsole eine Taste drückte, stieß sie ein leises Wimmern aus. Ihr Kopf fühlte sich an wie eine Melone kurz vor dem Zerplatzen. Ihr Gesichtsfeld hatte sich verengt, sodass sie das Gefühl hatte, durch einen langen schwarzen Tunnel zu blicken. Die Armaturen schienen so weit entfernt, dass sie kaum dran kam. Sie brauchte den letzten Rest an Konzentration, um mit unsicheren Bewegungen ihrer Finger die richtigen Knöpfe und Tasten zu treffen. Jetzt versuchte sie verzweifelt, den Fluglageanzeiger abzulesen. Das Display verschwamm und flimmerte wie wild vor ihren Augen. Ich kann es nicht sehen. Ich kann die Koordinaten nicht ablesen … »Discovery, Sie sind an der Eintrittsgrenze«, sagte der Capcom. »Rumpfklappe auf Auto.« Jill blinzelte und griff nach dem Schalter auf der Konsole, doch er schien so weit weg … »Discovery?« Ihr zitternder Finger berührte den Schalter. Sie stellte ihn auf »Auto«. »Ausgeführt«, flüsterte sie und ließ die Schultern hängen. Die Computer hatten die Steuerung übernommen, sie flogen das Raumschiff. Sie traute sich nicht mehr zu, den Steuerhebel zu bedienen. Sie wusste nicht einmal, wie lange sie sich noch bei Bewusstsein halten konnte. Schon engte der schwarze Tunnel ihr Gesichtsfeld immer mehr ein und, verschluckte alles Licht. Jetzt hörte sie zum ersten Mal das Geräusch der Luft, die am Rumpf entlangstrich, und spürte, wie sie in ihren Sitz hineingedrückt wurde. Die Stimme des Capcom war nicht mehr zu hören. Sie war im Funkloch, das so lange andauern würde, wie das Raumschiff mit solcher Geschwindigkeit durch die Atmosphäre schoss, dass die Luftmoleküle ionisiert wurden. Dieser elektromagnetische Sturm unterbrach alle Funkwellen und machte jegliche Kommunikation unmöglich. In den nächsten zwölf Minuten gab es nichts als sie, das Schiff und das Tosen der Luft. Sie hatte sich noch nie so allein gefühlt. Sie merkte, wie der Autopilot zum ersten Mal in eine lang gezogene S-Kurve ging. Der Raumtransporter rollte zur Seite und wurde langsamer. Sie konnte sich die glühende Hitze an den Fenstern des Cockpits vorstellen, konnte die Wärme wie Sonnenstrahlen auf ihrem Gesicht spüren. Sie schlug die Augen auf. Und sah nur Dunkelheit. Wo sind die Lichter?, dachte sie. Wo ist der Lichtschein im Fenster geblieben? Sie blinzelte ein ums andere Mal. Rieb ihre Augen, als könne sie sie damit zum Sehen zwingen, als könne sie ihre Netzhäute dazu bringen, Licht in sich aufzunehmen. Sie streckte die Hand nach der Steuerkonsole aus. Wenn sie nicht die richtigen Schalter bediente, wenn sie nicht die Sonden für die Luftdatenmessung aktivierte und das Fahrgestell ausfuhr, konnte Houston das Raumschiff nicht landen. Dann würden sie es nicht schaffen, sie lebend herunterzuholen. Ihre Finger streiften über ein verwirrendes Labyrinth von Anzeigen und Knöpfen, und sie heulte vor Verzweiflung laut auf. Sie war blind., Das Raketentestgelände von White Sands lag 1247 Meter über dem Meeresspiegel, und die Luft dort war trocken und dünn. Der Flugplatz erstreckte sich über eine vor Urzeiten vom Meer bedeckte Ebene in einem Wüstental, das zwischen dem Sacramento- und dem Guadalupe-Gebirge im Osten und den San-Andres-Bergen im Westen lag. Die nächste Stadt war Almogordo in New Mexico. Die Landschaft war kahl und ausgedörrt, nur die widerstandsfähigste Wüstenvegetation konnte hier überleben. White Sands diente seit langem als Übungsgelände für Jagdflieger. Im Laufe der Jahrzehnte war es jedoch zu unterschiedlichen Zwecken genutzt worden. So hatte man hier während des Zweiten Weltkriegs ein Lager für deutsche Kriegsgefangene eingerichtet, und in der Nähe befand sich das Trinity-Versuchsgelände, wo die USA ihre erste Atombombe gezündet hatten, die nicht weit entfernt in Los Alamos gebaut worden war. Stacheldrahtzäune und anonyme Regierungsgebäude waren in diesem Wüstental aus dem Boden geschossen, und für die Bewohner des nahen Almogordo war es ein Rätsel, was dort eigentlich vor sich ging. Durch das Fernglas konnte Jack das vor Hitze flimmernde Rollfeld in der Ferne ausmachen. Der Runway 16/34 war fast genau entlang der Nord-Süd-Achse ausgerichtet. Er war nahezu fünf Kilometer lang und knapp hundert Meter breit – groß genug selbst für die schwersten Düsenflugzeuge, auch noch in dieser dünnen Luft, die lange Rollwege bei Start und Landung notwendig machte. Ein wenig westlich von der Stelle, wo sie landen sollte, wartete Jack mit dem Ärzteteam und einem kleinen Konvoi von Fahrzeugen der NASA und der United Space Alliance auf die, Ankunft der Discovery. Sie waren mit Tragen, Sauerstoff- flaschen, Beatmungsgeräten und Defibrillatoren ausgestattet – kurz, mit allem, was ein moderner Rettungswagen hergibt, und noch einigem mehr. Bei einer Landung in Kennedy würde ein Bodenteam von über hundertfünfzig Mitarbeitern den Raumtransporter in Empfang nehmen. Hier, auf diesem Rollfeld mitten in der Wüste, waren es gerade mal drei Dutzend, von denen acht zum medizinischen Personal gehörten. Einige Mitglieder der Bodencrew trugen geschlossene Schutzanzüge mit eigener Sauerstoffversorgung, die sie vor eventuell austretendem Treibstoff schützen sollten. Sie würden als Erste an den Raumtransporter herantreten und mit speziellen Sensoren die Explosionsgefahr taxieren, bevor sie den Ärzten und Schwestern erlaubten, näher zu treten. Ein fernes Grollen ließ Jack das Fernglas von den Augen nehmen und nach Osten blicken. Hubschrauber kamen herangeflogen, so viele, dass sie wie ein bedrohlicher Schwarm schwarzer Wespen aussahen. »Was ist das denn?«, fragte Bloomfeld, der die Hubschrauber ebenfalls bemerkt hatte. Jetzt starrte auch der Rest der Bodencrew zum Himmel, und ein erstauntes Murmeln erhob sich. »Vielleicht Verstärkung«, meinte Jack. Der Leiter des Konvois, der über Kopfhörer den Funkverkehr verfolgte, schüttelte den Kopf. »Die Bodenkontrolle sagt, die sind nicht von uns.« »Der Luftraum sollte doch frei gehalten werden«, sagte Bloomfeld. »Wir versuchen, die Hubschrauber zu rufen, aber sie antworten nicht.« Das Grollen hatte sich verstärkt, Jack spürte es jetzt auch in den Knochen, ein tiefes, fortgesetztes Vibrieren in seinem Brustbein. Sie drangen in den Luftraum des Raumtransporters, ein. In fünfzehn Minuten würde die Discovery aus dem Himmel herabstoßen und feststellen, dass diese Hubschrauber in ihrer Flugbahn waren. Er hörte, wie der Leiter des Konvois aufgeregt in sein Mikrofon sprach, und er spürte die Welle von Panik, die sich über die Bodencrew ausbreitete. »Sie halten ihre Position«, sagte Bloomfeld. Jack hob sein Fernglas. Er zählte fast ein Dutzend Hubschrauber. Sie hatten tatsächlich ihren Anflug abgebrochen und landeten jetzt wie eine Schar von Geiern unmittelbar östlich der Stelle, wo der Raumtransporter landen sollte. »Was glaubst du, was das zu bedeuten hat?«, fragte Bloomfeld. Noch zwei Minuten Funkstille. Noch fünfzehn Minuten bis zur Landung. Randy Carpenter verspürte einen ersten Anflug von Optimismus. Er wusste, dass sie die Discovery heil zur Erde bringen konnten. Falls es nicht zu einem katastrophalen Computerausfall kam, konnten sie den Vogel vom Boden aus steuern. Hewitt war der Schlüssel. Sie musste bei Bewusstsein bleiben, musste es schaffen, im richtigen Moment zwei Schalter umzulegen. Minimale Handgriffe, die aber von entscheidender Bedeutung waren. Bei ihrem letzten Funkkontakt vor zehn Minuten hatte Hewitt fit geklungen, obwohl es unüberhörbar war, dass sie unter starken Schmerzen litt. Sie war eine gute Pilotin mit einem eisernen Rückgrat, gestählt in der Schmiede der US-Navy. Alles, was sie tun musste, war, bei Bewusstsein zu bleiben. »Flight, wir haben gute Nachrichten von NASCOM«, meldete sich der Funkoffizier. »Die Bodenstation in Moskau hat Funkkontakt mit der ISS auf dem Regul-S-Band.« Regul war das russische S-Band-Funknetz an Bord der ISS. Es war völlig getrennt und unabhängig vom amerikanischen, Netz und lief über Bodenstationen in Russland und den russischen LUCH-Satelliten. »Der Kontakt war nur kurz. Sie haben den Sendestrahl des LUCH-Satelliten gerade so am Ende erwischt«, sagte der Funkoffizier. »Aber die Crew ist gesund und munter.« Carpenters Optimismus flackerte noch ein wenig heller auf, und er ballte seine plumpen Finger triumphierend zur Faust. »Schadensbericht?« »Sie hatten ein Leck im NASDA-Modul und mussten Node 2 und alles, was davor liegt, absperren. Sie haben auch mindestens zwei Sonnensegel und mehrere Trägersegmente verloren. Aber es ist niemand verletzt.« »Flight, wir kommen gleich aus dem Funkschatten heraus«, sagte der Capcom. Schlagartig wandte sich Carpenters Aufmerksamkeit wieder der Discovery zu. Er freute sich über die Nachrichten von der ISS, doch in erster Linie war er für das Shuttle verantwortlich. »Discovery, hören Sie mich?«, sagte der Capcom. »Discovery?« Die Minuten verstrichen. Zu viele. Plötzlich drohte Carpenter wieder in Panik zu verfallen. Der Steuerungsoffizier meldete: »Zweite S-Kurve abgeschlossen. Alle Systeme okay.« Warum antwortete Hewitt dann nicht? »Discovery«, wiederholte der Capcom, jetzt mit banger Ungeduld in der Stimme. »Hören Sie mich?« »Dritte S-Kurve eingeleitet«, sagte Guidance. Wir haben sie verloren, dachte Carpenter. Dann hörten sie ihre Stimme. Leise und schwankend. »Hier Discovery.« Der erleichterte Seufzer von Capcom war deutlich zu hören. »Discovery, willkommen zurück! Schön, Ihre Stimme zu, hören! Sie müssen jetzt die Luftmessungssonden aktivieren.« »Ich … ich versuche, die Schalter zu finden.« »Ihre Luftmessungssonden«, wiederholte der Capcom. »Ich weiß, ich weiß! Ich kann die Armaturen nicht sehen!« Carpenter hatte das Gefühl, das Blut gefriere ihm in den Adern. Gütiger Gott, sie ist blind! Und sie sitzt auf dem Platz des Kommandanten. Nicht auf ihrem eigenen. »Discovery, Sie müssen sie jetzt aktivieren!«, sagte der Capcom. »Schalttafel C-3 …« »Ich weiß, welche Schalttafel!«, rief sie. Dann war es still. Und dann war nur noch ihr von Schmerzen verkrampftes Atmen zu hören. »Die Sonden sind aktiviert«, meldete MMACS. »Sie hat’s getan! Sie hat den Schalter gefunden!« Carpenter gestattete sich wieder zu atmen. Hoffnung zu schöpfen. »Vierte S-Kurve«, sagte Guidance. »TAEM ist erreicht.« »Discovery, wie geht es Ihnen?«, fragte der Capcom. Eine Minute und dreißig Sekunden bis zur Landung. Die Discovery flog jetzt mit neunhundert Stundenkilometern in einer Höhe von achttausend Fuß und befand sich im schnellen Sinkflug. Die Piloten nannten das den »fliegenden Backstein« – schwer und ohne Antrieb glitt das Shuttle auf seinen Deltaflügeln durch die Luft. Es würde keine zweite Chance geben, keine Möglichkeit, die Landung abzubrechen und eine Schleife zu fliegen, um es noch einmal zu versuchen. Das Shuttle würde auf jeden Fall landen – so oder so. »Discovery?«, sagte der Capcom. Jack konnte es hoch am Himmel funkeln sehen. Rauchwolken schossen aus den Steuerdüsen. Es glich einem glänzenden, Silberspan, als es nach einer letzten Schleife auf die Landebahn einschwenkte; »Spitze, Mensch! Nur weiter so, Jungs!«, jauchzte Bloomfeld. Seine Begeisterung wurde von den über dreißig Mitgliedern der Bodencrew geteilt. Eine Shuttle-Landung ist immer ein festliches Ereignis, ein so bewegender Triumph, dass allen, die von der Erde aus zusehen, die Tränen in die Augen steigen. Alle Augen waren jetzt gebannt zum Himmel gerichtet, und alle Herzen klopften vor Aufregung, während sie verfolgten, wie dieses Stückchen Silber, ihr Shuttle, auf die Landebahn zuglitt. »Wunderbar! Mann, was für ein Anblick!« »Hurra!« »Voll auf den Punkt! Sauber!« Der Leiter des Konvois, der über Funk mit Houston verbunden war, fuhr plötzlich zusammen. »Ach du Scheiße«, sagte er, starr vor Schreck. »Das Fahrgestell ist nicht ausgeklappt!« Jack drehte sich zu ihm um. »Was?« »Die Crew hat das Fahrgestell nicht ausgefahren!« Jack fuhr herum und starrte dem heranbrausenden Shuttle entgegen. Es war kaum noch dreißig Meter über dem Boden und schoss mit fast fünfhundert Stundenkilometern dahin. Er konnte keine Räder entdecken. Die versammelte Menge wurde schlagartig still. Die Festtagsstimmung war ungläubigem Entsetzen gewichen. Raus mit den Rädern! Fahrt endlich die Räder aus!, wollte Jack schreien. Das Shuttle war jetzt noch gut zwanzig Meter über der Landebahn und perfekt ausgerichtet. Noch zehn Sekunden bis zur Landung. Nur die Besatzung konnte das Fahrgestell ausklappen. Kein Computer konnte den Schalter betätigen, konnte das leisten, wozu nun einmal eine Menschenhand erforderlich war. Kein, Computer konnte sie jetzt retten. Fünfzehn Meter, und immer noch dreihundert Stundenkilometer schnell. Jack wollte das Ende nicht mit ansehen, aber er konnte einfach nicht anders. Er konnte sich nicht abwenden. Er sah, wie die Discovery mit dem Heck zuerst aufschlug, wie Funken und zersplitterte Hitzeschutzkacheln aufspritzten. Er hörte die Schreie und das Stöhnen der Zuschauer, als die Nase des Shuttles kurz darauf auf den Asphalt krachte. Die Discovery begann seitlich wegzurutschen, einen Mahlstrom von Trümmerteilen im Schlepptau führend. Ein Deltaflügel brach ab und wirbelte wie eine schwarze Sense durch die Luft. Der Raumtransporter rutschte mit ohrenbetäubendem Kreischen weiter seitwärts über den Asphalt. Der andere Flügel brach ebenfalls ab, krachte auf die Landebahn und zerbarst. Die Discovery wurde über das Rollfeld hinaus in den Wüstensand getragen. Ein Wirbelsturm aus Staub erhob sich und verhinderte, dass Jack die letzten Sekunden mit ansehen konnte. Die Schreie der Menge tönten in seinen Ohren, doch er selbst brachte keinen Laut hervor. Rühren konnte er sich auch nicht; der Schock hatte ihn so gründlich gelähmt, dass er das Gefühl hatte, seinen eigenen Körper verlassen zu haben und wie ein Geist in irgendeiner albtraumhaften Dimension zu schweben. Dann verzog sich die Staubwolke allmählich, und er sah das Shuttle wie einen zerschmetterten Vogel inmitten einer entsetzlichen Trümmerlandschaft liegen. Plötzlich setzte sich der Konvoi der Bodencrew in Bewegung. Von den aufheulenden Motoren aus ihrer Trance gerüttelt, sprangen Jack und Bloomfeld auf das Sanitätsfahrzeug, und die Fahrt über den holprigen Wüstenboden zur Absturzstelle begann. Trotz des Dröhnens der Motoren konnte Jack noch ein anderes Geräusch vernehmen – ein ominöses dumpfes Grollen., Die Hubschrauber waren ebenfalls gestartet und kamen auf die Unglücksstelle zu. Ihr Fahrzeug kam abrupt zum Stehen, und Jack und Bloomfeld sprangen mit ihren Notarztkoffern in einer Wolke aus Staub heraus. Sie waren noch knapp hundert Meter von der Discovery entfernt. Die Hubschrauber waren in einem Ring um das Shuttle herum gelandet. Sie versperrten dem Konvoi den Weg. Jack rannte auf die Discovery zu und wollte sich schon ducken, um unter den schwirrenden Rotorblättern hindurchzulaufen. Doch er wurde angehalten, bevor er den Hubschrauberring erreicht hatte. »Was soll das, verdammt noch mal?«, schrie Bloomfeld, als plötzlich uniformierte Soldaten aus den Hubschraubern sprangen und sich vor der NASA-Bodencrew zu einer bewaffneten Absperrung formierten. »Zurück! Alles zurück!«, rief einer der Soldaten. Der Konvoileiter schob sich nach vorne. »Meine Leute müssen zu dem Raumtransporter!« »Ihre Leute bleiben, wo sie sind!« »Sie haben hier nichts zu befehlen! Das ist eine NASA- Operation!« »Zurück mit dem ganzen Haufen, und zwar sofort!« Plötzlich waren Gewehre da, deren Läufe auf die unbewaffnete Bodencrew gerichtet waren. Das NASA-Personal wich zögernd zurück, alle Augen auf die Gewehre gerichtet, auf die unausgesprochene Drohung eines Massakers. Jack sah an den Soldaten vorbei und erkannte, dass über der Luke der Discovery hastig ein weißes Plastikzelt errichtet wurde, das den Einstieg luftdicht von der Umgebung abschloss. Ein Dutzend Gestalten mit Kapuzen und leuchtend orangefarbenen Schutzanzügen stiegen aus zwei Helikoptern und gingen auf den Raumtransporter zu., »Das sind biologische Weltraumschutzanzüge«, sagte Bloomfeld. Die Einstiegsluke des Shuttles war jetzt vollständig unter dem Plastikzelt verborgen. Sie konnten nicht sehen, wie die Klappe geöffnet wurde. Sie konnten nicht sehen, wie diese Männer in Raumanzügen das Mitteldeck betraten. Da drin ist unsere Crew, dachte Jack. Unsere Leute, die in diesem Raumtransporter vielleicht gerade im Sterben liegen. Und wir können nicht zu ihnen. Wir haben Ärzte und Schwestern hier und einen Lastwagen voll mit medizinischem Gerät, und diese Leute lassen uns nicht unsere Arbeit tun. Er ging auf die Soldatenkette zu und trat direkt vor den Offizier, der anscheinend das Kommando hatte. »Mein medizinisches Team geht jetzt da rein«, sagte er. Der Offizier grinste hämisch. »Da bin ich aber anderer Meinung, Sir.« »Wir sind Angestellte der NASA. Wir sind Ärzte, und unser Auftrag ist es, für die Gesundheit und das Wohlergehen dieser Shuttle-Besatzung zu sorgen. Sie können uns erschießen, wenn Sie wollen. Aber dann müssen Sie auch alle anderen hier erschießen, weil die als Zeugen auftreten werden. Und ich denke nicht, dass Sie das tun.« Ein Gewehr wurde gehoben; der Lauf zielte genau auf Jacks Brust. Seine Kehle war trocken, und sein Herz hämmerte gegen seine Rippen, und dennoch ging er an dem Soldaten vorbei, duckte sich und ging unter den Rotorblättern hindurch auf das Shuttle zu. Er blickte sich nicht einmal um, als der Soldat befahl: »Halt, oder ich schieße!« Er ging weiter, den Blick starr auf das Zelt gerichtet, das vom Wind aufgebläht wurde. Er sah, wie die Männer in ihren Schutzanzügen sich umdrehten und ihn verblüfft anstarrten. Er sah, wie ein vom Wind aufgewirbeltes Staubwölkchen vor seinen Füßen vorüberhuschte. Er hatte das Zelt fast erreicht, als, er Bloomfeld rufen hörte: »Pass auf, Jack!« Der Schlag traf ihn genau an der Schädelbasis. Er sank in die Knie, und heftiger Schmerz durchzuckte blitzartig seinen Kopf. Ein zweiter Schlag traf ihn von der Seite, und er stürzte nach vorne und schmeckte den heißen Sand wie Asche in seinem Mund. Er rollte sich auf den Rücken und sah den Soldaten über ihm stehen, bereit, ihm den nächsten Schlag mit dem Gewehrkolben zu versetzen. »Das reicht«, sagte eine merkwürdig gedämpft klingende Stimme. »Lassen Sie ihn.« »Wer sind Sie?«, fragte die Stimme. »Dr. Jack McCallum.« Es war kaum mehr als ein Flüstern, was er hervorbrachte. Er setzte sich auf, und plötzlich verschwamm alles vor seinen Augen, und das Licht begann zu schwinden. Er hielt sich den Kopf und bot seine ganze Willenskraft auf, um bei Bewusstsein zu bleiben, um gegen die Schwärze anzukämpfen, die ihn zu verschlingen drohte. »Die Leute in diesem Raumtransporter sind meine Patienten«, sagte Jack. »Ich verlange, sie zu sehen.« »Das ist unmöglich.« »Sie brauchen ärztliche Hilfe …« »Sie sind tot, Dr. McCallum. Allesamt.« Jack erstarrte. Langsam hob er den Kopf und sah durch das transparente Visier in die Augen des Mannes. Er konnte ihren Ausdruck nicht deuten, konnte absolut nichts erkennen, was den tragischen Verlust von vier Menschenleben widergespiegelt hätte. »Es tut mir Leid um Ihre Astronauten«, sagte der Mann und wandte sich zum Gehen. Jack rappelte sich mühsam hoch. Er schwankte, und ihm war schwindlig, doch er schaffte es, auf den Beinen zu bleiben. »Und wer zum Teufel sind Sie?«, Der Mann hielt inne und drehte sich um. »Ich bin Dr. Isaac Roman von USAMRIID«, sagte er. »Dieser Raumtransporter ist jetzt eine Gefahrenzone. Ab sofort hat die Armee hier das Sagen.« USAMRIID. Dr. Roman hatte es wie ein Wort ausgesprochen, doch Jack wusste, wofür die Buchstaben standen. U. S. Army Medical Research Institute of Infectious Diseases – das medizinische Forschungsinstitut der US-Armee für ansteckende Krankheiten. Warum war die Armee hier? Seit wann war dies eine militärische Operation? Jack stand da, kniff die Augen gegen den umherfliegenden Staub zusammen und versuchte, diese verwirrenden Informationen zu verarbeiten, während sein Schädel von dem Schlag immer noch brummte. Eine Ewigkeit schien zu vergehen, in der eine Prozession von unwirklichen Bildern vor seinem geistigen Auge vorüberzog. Männer in orangefarbenen Schutzanzügen, die auf den Raumtransporter zugingen. Der Soldat, der ihn mit ausdruckslosen Augen anstarrte. Das Isolationszelt, das sich im Wind blähte und bewegte wie ein lebender, atmender Organismus. Er sah zu dem Ring von Soldaten hin, die seine Crew immer noch in Schach hielten. Er wandte den Blick zum Shuttle und sah die Männer in den Schutzanzügen mit der ersten Tragbahre aus dem Zelt kommen. Die Leiche steckte in einem Plastiksack, der über und über mit dem leuchtend roten Symbol für biologische Gefahrstoffe bedruckt war. Das Bild erinnerte an eine mit Blüten bestreute Bahre. Der Anblick dieser Trage schreckte Jack aus seinen Gedanken hoch. Er fragte: »Wohin bringen Sie die Leichen?« Dr. Roman drehte sich nicht einmal zu ihm um; stattdessen wies er die Männer an, die Trage zu einem wartenden Hubschrauber zu bringen. Jack wollte auf das Shuttle zugehen, doch wieder stellte sich ihm ein Soldat in den Weg, den Gewehrkolben zum Schlag erhoben., »He!«, rief plötzlich jemand von der Bodencrew. »Wagen Sie es, ihn noch einmal zu schlagen, und Sie haben dreißig Zeugen gegen sich!« Der Soldat drehte sich um und sah sich den aufgebrachten Mitarbeitern der NASA und der United Space Alliance gegenüber, die jetzt näher rückten und empört ihre Stimmen erhoben. »Sie glauben wohl, Sie sind hier in Nazideutschland!« »… wehrlose Zivilisten zusammenschlagen …« »Wer seid ihr denn, zum Teufel?« Nervös rückten die Soldaten enger zusammen, während die Bodencrew rufend und schimpfend weiter vorrückte und ihre stampfenden Schritte den Wüstensand aufwirbelten. Ein Gewehrschuss krachte. Die Menge verstummte augenblicklich. Irgendetwas ist hier ganz und gar nicht in Ordnung, dachte Jack. Irgendetwas, was wir nicht verstehen. Diese Soldaten waren ohne weiteres bereit zu schießen. Zu töten. Auch der Leiter des Konvois hatte das begriffen. In Panik stieß er hervor: »Ich stehe in Funkverbindung mit Houston! In diesem Moment hören uns im Kontrollzentrum hundert Männer und Frauen zu!« Langsam ließen die Soldaten die Waffen sinken und sahen ihren Offizier an. Lange Zeit sagte niemand etwas, und nur das Pfeifen des Winds und das Trommeln aufgewirbelter Sandkörn- chen auf dem Blech der Hubschrauber durchbrach die Stille. Dr. Roman stand plötzlich neben Jack. »Ihre Leute begreifen die Lage nicht«, sagte er. »Erklären Sie uns die Lage.« »Wir haben es mit einer ernsthaften Gefahr biologischer Verseuchung zu tun. Der Sicherheitsrat des Weißen Hauses hat das Biologische Einsatzkommando der Armee mobilisiert – ein, Team, das durch einen Kongressbeschluss ins Leben gerufen wurde, Dr. McCallum. Wir sind auf Anweisung der Regierung hier.« »Was für eine Gefahr ist das?« Roman zögerte. Sein Blick wanderte zu der NASA-Crew, die dicht gedrängt hinter der Soldatenkette wartete. »Um welchen Organismus handelt es sich?« Endlich erwiderte Roman durch sein Plastikvisier hindurch Jacks Blick. »Diese Information ist geheim.« »Wir sind das medizinische Team, das für die Gesundheit dieser Crew verantwortlich ist. Warum hat uns niemand informiert?« »Die NASA weiß nicht, womit sie es zu tun hat.« »Und wie kommt es, dass Sie das wissen?« Die bedeutungs- schwere Frage blieb ohne Antwort. Eine weitere Trage wurde aus dem Zelt geschafft. Und wessen Leiche ist das? fragte sich Jack. Die Gesichter der vier Crewmitglieder tauchten vor seinem geistigen Auge auf. Sie waren alle tot. Er konnte das einfach nicht begreifen. Er konnte sich nicht vorstellen, dass von diesen vor Energie sprühenden, kerngesunden Menschen nur noch zerschmetterte Knochen und zerfetzte Organe übrig sein sollten. »Wohin bringen Sie die Leichen?«, fragte er erneut. »In eine Einrichtung der Sicherheitsstufe Vier, wo sie obduziert werden.« »Wer führt die Autopsie durch?« »Ich selbst.« »Als Flugarzt der Besatzung sollte ich dabei sein.« »Weshalb? Sind Sie Pathologe?« »Nein.« »Dann wüsste ich nicht, welchen Nutzen Ihre Anwesenheit, bringen könnte.« »Wie viele tote Piloten haben Sie denn schon obduziert?«, gab Jack zurück. »Wie viele Flugunfälle haben Sie untersucht? Raumfahrttypische Verletzungen sind mein Gebiet. Dafür bin ich ausgebildet. Sie werden mich brauchen.« »Das glaube ich nicht«, erwiderte Roman. Und er ließ Jack stehen. Jack platzte fast vor Wut, als er zur NASA-Bodencrew zurückging und zu Bloomfeld sagte: »Die Armee hat hier das Sagen. Sie transportieren die Leichen ab.« »Mit welcher Befugnis?« »Er sagt, die Anweisungen kommen direkt vom Weißen Haus. Sie haben ein so genanntes Biologisches Einsatzkommando mobilisiert.« »Das ist ein Team zur Terrorismusbekämpfung«, sagte Bloomfeld. »Ich habe davon gehört. Es wurde gebildet, um gegen Bioterroristen vorzugehen.« Sie sahen zu, wie einer der Hubschrauber mit zwei der Leichen an Bord startete. Was zum Teufel geht hier wirklich vor?, fragte sich Jack. Was verbergen sie vor uns? Er wandte sich an den Leiter des Konvois. »Können Sie mich zum JSC durchstellen?« »Irgendjemand Bestimmtes?« Jack überlegte, ob es jemanden gab, dem er vertrauen konnte und der gleichzeitig so hoch in der NASA-Bürokratie rangierte, dass er die Sache auf höchster Ebene ausfechten konnte. »Verbinden Sie mich mit Gordon Obie«, sagte er. »Flugeinsatzabteilung.«, DIE AUTOPSIE, Als Gordon Obie den Videokonferenzraum betrat, war er auf eine blutige Schlacht vorbereitet, doch keiner der am Tisch versammelten NASA-Funktionäre ahnte, wie tief sein Zorn saß. Kein Wunder, denn Obie trug sein übliches Pokerface zur Schau und sagte kein Wort, als er sich neben die Pressesprecherin Gretchen Liu an den Tisch setzte. Gretchens Augen waren feucht und verquollen, und auch die anderen wirkten schockiert und verstört. Sie bemerkten nicht einmal, dass Gordon hereingekommen war. Die anderen, das waren der NASA-Verwaltungschef Leroy Cornell, der Direktor des JSC Ken Blankenship sowie ein halbes Dutzend weitere NASA-Funktionäre, die mit düsterer Miene auf die beiden Videobildschirme starrten. Auf dem einen war Colonel Lawrence Harrison vom USAMRIID zu sehen, der von dem Armeestützpunkt Fort Detrick in Maryland aus zugeschaltet war. Der andere Monitor zeigte einen ernst wirkenden, dunkelhaarigen Mann in Zivilkleidung, der als »Jared Profitt, Sicherheitsrat des Weißen Hauses« vorgestellt wurde. Er sah nicht wie ein Bürokrat aus. Mit seinen traurigen Augen und seinen hageren, fast asketischen Gesichtszügen wirkte er vielmehr wie ein mittelalterlicher Mönch, der gegen seinen Willen in ein modernes Zeitalter mit Anzügen und Krawatten versetzt worden war. Blankenship hatte das Wort, und seine Ausführungen waren an Colonel Harrison gerichtet. »Ihre Soldaten haben meine Leute nicht nur daran gehindert, ihre Pflicht zu erfüllen, sondern sie auch mit Waffengewalt bedroht. Einer unserer Flugärzte wurde angegriffen – mit einem Gewehrkolben zu Boden geschlagen. Wir haben drei Dutzend Zeugen …« »Dr. McCallum hat unseren Sicherheitskordon durchbrochen., Er wurde aufgefordert, stehen zu bleiben, und hat sich der Anordnung widersetzt«, erwiderte Colonel Harrison. »Wir hatten eine Gefahrenzone zu sichern.« »Die US Army ist also neuerdings bereit, Zivilisten anzugreifen und sogar auf sie zu schießen?« »Ken, lassen Sie uns die Sache doch einmal aus dem Blickwinkel des USAMRIID betrachten«, sagte Cornell und legte die Hand besänftigend auf Blankenships Unterarm. Reine Diplomatie, dachte Gordon angewidert. Cornell war vielleicht der Sprecher der NASA beim Weißen Haus und ihr bestes Pferd im Stall, wenn es darum ging, beim Kongress Geld locker zu machen, aber viele NASA-Mitarbeiter hatten ihm nie wirklich vertraut. Sie konnten keinem Mann vertrauen, der mehr wie ein Politiker als wie ein Ingenieur dachte. »Die Sicherung einer Gefahrenzone ist ein triftiger Grund, zu gewaltsamen Mitteln zu greifen«, sagte Cornell. »Und Dr. McCallum hat die Absperrung durchbrochen.« »Die Folgen hätten katastrophal sein können«, kam Harrisons Stimme über die Lautsprecher. »Unsere Aufklärung meldet, dass Marburg-Viren möglicherweise absichtlich in die Raumstation geschmuggelt wurden. Das Marburg-Virus ist mit Ebola verwandt.« »Wie soll es denn an Bord gelangt sein?«, fragte Blankenship. »Jedes Protokoll wird aus Sicherheitsgründen noch einmal überprüft. Alle Labortiere werden auf Krankheiten untersucht. Wir schicken keine biologischen Gefahrstoffe ins All.« »Es ist klar, dass Ihre Behörde das so sieht. Aber Sie erhalten Ihre experimentellen Nutzlasten von Wissenschaftlern aus dem ganzen Land. Sie mögen deren Protokolle überprüfen, aber Sie können unmöglich jede einzelne Bakterien- oder Gewebekultur untersuchen, die vor dem Start angeliefert wird. Die biologischen Materialien werden, damit sie am Leben bleiben, direkt in das Shuttle verladen. Wie, wenn nun eines dieser, Experimente kontaminiert war? Bedenken Sie doch, wie leicht es ist, eine harmlose Kultur gegen einen gefährlichen Organismus wie Marburg auszutauschen.« »Wollen Sie damit sagen, dies war ein Sabotageakt gegen die Raumstation?«, fragte Blankenship. »Ein Fall von Bioterrorismus?« »Genau das will ich damit sagen. Lassen Sie mich einmal beschreiben, was mit Ihnen geschieht, wenn Sie sich mit diesem Virus infizieren. Zuerst bekommen Sie Muskelschmerzen und Fieber. Die Schmerzen sind so ungeheuer stark, dass Sie kaum eine Berührung ertragen. Eine intramuskuläre Injektion lässt Sie vor Schmerzen laut aufschreien. Dann laufen Ihre Augen rot an. Sie bekommen Leibschmerzen und müssen sich unentwegt übergeben. Sie fangen an, Blut zu erbrechen. Zuerst ist es wegen der Verdauungsprozesse noch schwarz, später sprudelt es hellrot aus Ihnen heraus, als hätte man Ihnen eine Pumpe eingebaut. Ihre Leber schwillt an und zerreißt. Ihre Nieren versagen. Ihre inneren Organe werden eines nach dem anderen zerstört und verwandeln sich in einen fauligen schwarzen Brei. Und dann fällt plötzlich Ihr Blutdruck mit katastrophaler Geschwindigkeit ab. Und dann sind Sie tot.« Harrison machte eine Kunstpause. »Damit haben wir es zu tun, meine Damen und Herren.« »Das ist doch Blödsinn!«, platzte Gordon Obie heraus. Alle Augen richteten sich verblüfft auf ihn. Die Sphinx hatte gesprochen. Wenn Obie während einer Sitzung überhaupt etwas sagte, was selten genug vorkam, waren es gewöhnlich in monotonem Tonfall vorgebrachte Informationen und Daten und keine emotionalen Ausbrüche. Die Runde war geschockt. »Dürfte ich fragen, wer das gesagt hat?«, wollte Colonel Harrison wissen. »Mein Name ist Gordon Obie, Direktor der Flugeinsatz- abteilung.« »Ah. Der Oberastronaut.«, »Könnte man so sagen.« »Und warum ist das bitte Blödsinn?« »Ich glaube nicht, dass es sich um das Marburg-Virus handelt. Ich weiß nicht, was es ist, aber ich weiß, dass Sie uns nicht die Wahrheit sagen.« Colonel Harrisons Gesicht erstarrte zu einer ausdruckslosen Maske. Er schwieg. Jared Profitt ergriff das Wort. Seine Stimme klang genauso, wie Gordon es erwartet hatte: dünn, aber durchdringend. Er setzte nicht auf Einschüchterung wie Harrison, sondern zog es vor, an die Intelligenz und Vernunft seines Gegenübers zu appellieren. »Ich habe Verständnis für Ihre Enttäuschung, Mr. Obie«, sagte Profitt. »Es gibt einiges, was wir Ihnen aus Sicherheitsgründen vorenthalten müssen. Aber bei so etwas Gefährlichem wie Marburg dürfen wir keinerlei Risiken eingehen.« »Wieso schließen Sie unsere Flugärzte von der Autopsie aus, wenn Sie schon wissen, dass es Marburg ist? Haben Sie Angst, wir könnten die Wahrheit herausfinden?« »Gordon«, sagte Cornell leise, »wieso besprechen wir das nicht unter vier Augen?« Gordon ignorierte ihn und redete weiter auf den Bildschirm ein. »Um welche Krankheit handelt es sich wirklich? Eine Infektion? Ein Toxin? Vielleicht etwas, was mit einer militärischen Nutzlast an Bord gelangt ist?« Es war eine Weile still. Dann polterte Harrison los: »Das ist mal wieder die NASA-Paranoia! Sie geben immer gerne dem Militär die Schuld, wenn irgendetwas schief läuft!« »Warum weigern Sie sich, meinen Flugarzt an der Autopsie teilnehmen zu lassen?« »Sprechen wir von Dr. McCallum?«, fragte Profitt. »Ja. McCallum ist Flug- und Raumfahrtmediziner sowie, ausgebildeter Pathologe. Er ist nicht nur Flugarzt, sondern auch ein ehemaliges Mitglied des Astronautenkorps. Angesichts der Tatsache, dass Sie sich weigern, ihn oder irgendeinen anderen unserer Mediziner an den Autopsien teilnehmen zu lassen, muss ich mich fragen, was Sie eigentlich vor der NASA verbergen wollen.« Colonel Harrison blickte zur Seite, wie um sich an jemand anderen im Raum zu wenden. Als er sich wieder zur Kamera drehte, war sein Gesicht von Zorn gerötet. »Das ist doch absurd. Sie haben schließlich das Shuttle abstürzen lassen! Sie verbocken die Landung, bringen Ihre eigene Crew um und zeigen dann mit dem Finger auf die US Army?!« »Das gesamte Astronautenkorps ist über diese Angelegenheit zutiefst empört«, sagte Gordon. »Wir wollen wissen, was wirklich mit unseren Kollegen passiert ist. Wir bestehen darauf, dass Sie einen unserer Ärzte an die Leichen lassen.« Leroy Cornell versuchte noch einmal zu vermitteln. »Gordon, Sie können nicht solche unangemessenen Forderungen stellen«, sagte er leise. »Diese Leute wissen, was sie tun.« »Das weiß ich auch.« »Ich muss Sie auffordern, augenblicklich nachzugeben.« Gordon sah Cornell direkt in die Augen. Cornell vertrat die NASA gegenüber dem Weißen Haus. Er war die Stimme der NASA im Kongress. Sich ihm entgegenzustellen war gleichbedeutend mit beruflichem Selbstmord. Er tat es dennoch. »Ich spreche für die Astronauten«, sagte er. »Für meine Leute.« Er wandte sich zum Fernsehbildschirm und fixierte Colonel Harrisons versteinertes Gesicht. »Und wir stehen auch nicht an, uns mit unseren Anliegen an die Presse zu wenden. Wir machen uns die Sache nicht leicht – schließlich geht es um vertrauliche Angelegenheiten der NASA. Das Astronautenkorps ist immer verschwiegen gewesen. Aber wenn man uns dazu zwingt, werden wir auf einer öffentlichen, Untersuchung bestehen.« Gretchen Lius Kinnlade klappte herunter. »Gordon«, flüsterte sie, »was ist nur in Sie gefahren?« »Ich tue das, was ich tun muss.« Eine volle Minute sagte niemand irgendetwas. Dann überraschte Ken Blankenship alle, indem er verkündete: »Ich stelle mich auf die Seite unserer Astronauten.« »Ich auch«, sagte eine andere Stimme. »Und ich …« »Ich ebenfalls.« Gordon sah sich unter seinen um den Tisch versammelten Kollegen um. Die meisten von ihnen waren Ingenieure und technische Abteilungsleiter, deren Namen selten in der Presse auftauchten. Nicht selten standen sie in Konflikt mit den Astronauten, die sie als eingebildete Helden der Lüfte betrachteten. Die Astronauten wurden mit Ruhm und Ehre überhäuft, doch diese Männer und Frauen, die die unbemerkten und wenig glanzvollen Aufgaben verrichteten, durch die Raumfahrt überhaupt erst möglich wurde, waren das Herz und die Seele der NASA. Und nun standen sie vereint hinter Gordon. Leroy Cornell sah angeschlagen aus – der Anführer, der von seiner Truppe im Stich gelassen wurde. Er war ein stolzer Mann, und er hatte gerade eine öffentliche Demütigung erlitten. Er räusperte sich und straffte die Schultern, dann blickte er das Fernsehbild von Colonel Harrison an. »Ich habe keine andere Wahl. Ich muss mich ebenfalls hinter meine Astronauten stellen«, sagte er. »Ich bestehe darauf, dass einem unserer Flugärzte gestattet wird, als Beobachter an den Autopsien teilzunehmen.« Colonel Harrison sagte nichts. Es war Jared Profitt, der die endgültige Entscheidung traf. Jared Profitt, der offenbar tatsächlich das Sagen hatte. Er drehte sich um und wechselte ein, paar Worte mit jemandem, der nicht auf dem Bild zu sehen war. Dann sah er wieder in die Kamera und nickte. Beide Bildschirme erloschen. Die Videokonferenz war beendet. »Na, Sie haben es der US Army ja ganz schön gezeigt«, meinte Gretchen. »Haben Sie gesehen, wie sauer Harrison geguckt hat?« Nein, dachte Gordon, als er sich Harrisons Gesichtsausdruck ins Gedächtnis rief, kurz bevor das Bild verschwunden war. Das war nicht Verärgerung, was ich in seinem Gesicht gesehen habe. Es war Angst. Entgegen Jacks Vermutung waren die Leichen nicht in das USAMRIID-Hauptquartier in Fort Detrick, Maryland, überführt worden. Stattdessen hatte man sie in einen fensterlosen Betonklotz kaum hundert Kilometer vom Flugplatz White Sands gebracht, in eines der vielen neutral aussehenden Regierungs- gebäude, die in diesem ausgedörrten Wüstental hochgezogen worden waren. In einem Detail unterschied sich dieses Gebäude jedoch von den anderen: Aus dem Dach ragte eine Reihe von Lüftungsrohren heraus. Das Gelände war mit Stacheldraht umzäunt. Als sie an dem Militärposten vorbeifuhren, hörte Jack das Summen von Hochspannungsleitungen. Flankiert von seinen bewaffneten Begleitern ging Jack auf den Vordereingang zu – den einzigen Eingang, wie er bald feststellte. An der Tür prangte ein Zeichen, das ihm einen Schauer des Wiedererkennens über den Rücken jagte: die leuchtend rote Blüte des Symbols für biologische Gefahrstoffe. Was hat diese Einrichtung hier mitten in der Wüste zu suchen?, fragte er sich. Dann ließ er den Blick über den kahlen Horizont schweifen, und das beantwortete seine Frage. Das Gebäude stand genau hier, weil es hier, so weit das Auge reichte, nur von Wüste umgeben war., Er wurde durch die Tür geleitet und durch eine Reihe von nüchternen Korridoren, die tiefer in das Gebäude hineinführten. Er sah Männer und Frauen in Armeeuniformen und andere in Laborkitteln. Es gab nur künstliche Beleuchtung, und alle Gesichter sahen bläulich und krank aus. Die Wachen blieben vor einer Tür mit der Aufschrift »Umkleideraum Männer« stehen. »Gehen Sie hinein«, wurde ihm gesagt. »Folgen Sie genau den schriftlichen Anweisungen. Dann gehen Sie durch die nächste Tür. Dort werden Sie erwartet.« Jack trat ein. Der Raum enthielt eine Reihe von Spinden, einen Wäschekarren mit grüner Krankenhauskleidung in verschiedenen Größen, ein Regal mit Kopfbedeckungen aus Papier und ein Waschbecken mit Spiegel. An der Wand hing eine Liste mit Instruktionen, beginnend mit »Legen Sie Ihre Straßenkleidung VOLLSTÄNDIG ab, einschließlich Unterwäsche.« Er tat wie geheißen, legte seine Kleider in einen offenen Spind und zog sich einen grünen Kittel und eine Hose über. Anschließend ging er durch die nächste Tür, die ebenfalls mit dem biologischen Warnsymbol gekennzeichnet war, und gelangte in einen Raum mit ultravioletter Beleuchtung. Dort blieb er stehen und überlegte, was er als Nächstes tun sollte. Aus dem Lautsprecher ertönte eine Stimme: »Neben Ihnen ist ein Regal mit Socken. Ziehen Sie ein Paar an und gehen Sie durch die Tür.« Er gehorchte. Im nächsten Zimmer wartete eine Frau auf ihn, die ebenfalls grüne Krankenhauskleidung trug. In schroffem Ton und ohne die Spur eines Lächelns wies sie ihn an, sterile Handschuhe anzuziehen. Dann riss sie mit aggressiven Bewegungen Streifen von einer Rolle Klebeband und dichtete damit seine Ärmel und Hosenaufschläge ab. Die Armee hatte sich vielleicht mit Jacks Besuch abgefunden, doch man ließ keinen Zweifel daran, dass, er alles andere als ein willkommener Gast war. Die Frau setzte ihm einen Kopfhörer mit Mikrofon auf und gab ihm eine »Snoopy-Mütze«, eine Art Badekappe, die das Abrutschen des Kopfhörers verhindern sollte. »Jetzt den Anzug anlegen«, blaffte sie. Nun war also der Raumanzug an der Reihe. Dieser hier war blau und besaß integrierte Handschuhe. Als die unfreundliche Assistentin ihm die Haube aufsetzte, durchfuhr ihn plötzlich ein schrecklicher Gedanke. In ihrem Zorn auf ihn könnte die Frau die Sache sabotieren und dafür sorgen, dass er nicht vollständig gegen Kontamination geschützt war. Sie machte den Verschluss an der Brust zu, verband einen Schlauch, der an der Wand hing, mit dem Anzug, und Jack spürte, wie die Luft zischend hineinströmte. Jetzt war es zu spät, sich darüber Gedanken zu machen, was passieren könnte. Er war bereit, den Schritt in die heiße Zone zu wagen. Die Frau zog den Schlauch wieder aus dem Ventil und deutete auf die nächste Tür. Er ging hindurch und befand sich nun in der Luftschleuse. Die Tür wurde hinter ihm zugeschlagen. Ein Mann in einem Raumanzug wartete auf ihn. Er sagte nichts, sondern bedeutete Jack nur mit Gesten, er solle ihm durch die gegenüberliegende Tür folgen. Sie traten durch die Tür in einen Korridor, über den sie in den Autopsieraum gelangten. Dort sah Jack einen Tisch aus rostfreiem Stahl, auf dem eine der Leichen lag, immer noch in ihren schwarzen Plastiksack gehüllt. Zwei Männer in Raumanzügen standen bereits zu beiden Seiten des Tisches. Einer von ihnen war Dr. Roman. Er drehte sich um und erkannte Jack. »Fassen Sie nichts an. Mischen Sie sich nicht ein. Sie sind nur als Beobachter hier, Dr. McCallum, also kommen Sie uns bloß nicht in die Quere.«, Nette Begrüßung. Sein Begleiter mit dem Raumanzug schloss einen Wand- schlauch an Jacks Anzug an, und diesmal strömte die Luft mit lautem Zischen in seinen Helm. Ohne den Kopfhörer hätte er nichts von dem verstehen können, was die drei Männer sagten. Dr. Roman und seine zwei Kollegen öffneten den Leichensack. Jack stockte der Atem; er spürte, wie seine Kehle sich zusammenzog. Es war Till Hewitts Leiche. Sie hatte keinen Helm mehr auf, doch sie trug immer noch den orangefarbenen Druckanzug mit ihrem aufgestickten Namenszug. Auch ohne diesen Hinweis hätte Jack gewusst, dass es Jill war. Er erkannte sie an ihrem seidigen, kastanienbraunen Haar. Es war kurz geschnitten und hier und da leicht ergraut. Ihr Gesicht sah merkwürdig unversehrt aus. Sie hatte die Augen halb offen, und beide Lederhäute wiesen eine erschreckend grellrote Färbung auf. Roman und seine Mitarbeiter öffneten den Reißverschluss des Druckanzugs und entkleideten die Leiche vollständig. Das feuerfeste Gewebe ließ sich nicht zerschneiden; sie mussten es mühsam abziehen. Sie arbeiteten schnell und geschickt, und ihre Kommentare waren nüchtern und sachlich, ohne jede Spur von Emotionalität. Ohne ihre Kleider sah die Tote wie eine lädierte Puppe aus. Beide Hände waren durch multiple Frakturen zu einer Masse von Knochensplittern entstellt. Auch ihre Beine waren gebrochen, die Unterschenkel in unmöglichen Winkeln abgeknickt. Die Spitzen zweier gebrochener Rippen hatten sich durch die Haut nach außen gebohrt, und an den schwarzen Blutergüssen konnte man erkennen, wo ihr die Sitzgurte ins Fleisch geschnitten hatten. Jack merkte, dass er viel zu schnell atmete; er musste gegen das Entsetzen ankämpfen, das in ihm aufstieg. Er hatte etlichen Autopsien beigewohnt, bei denen die Leiche in einem, wesentlich schlechteren Zustand gewesen war. So hatte er Flieger gesehen, die so stark verbrannt waren, dass nur mehr ein verkohltes Gerippe übrig geblieben war, und Schädel, die durch den Druck des kochenden Gehirns explodiert waren. Er hatte die Leiche eines Mannes gesehen, dem der Heckrotor eines Hubschraubers das Gesicht abgeschnitten hatte. Er hatte das nach hinten umgeknickte und in zwei Teile zerbrochene Rückgrat eines Marinepiloten gesehen, den der Schleudersitz durch die geschlossene Cockpit-Abdeckung seines Flugzeugs katapultiert hatte. Dies hier war sehr, sehr viel schlimmer, weil er die Verstorbene gekannt hatte. Weil er sie als lebende, atmende Frau in Erinnerung hatte. Sein Entsetzen war mit Wut gemischt, weil diese drei Männer Jills schutzlosen Körper mit kalter Objektivität betrachteten. Für sie war sie nichts weiter als ein Stück Fleisch, das vor ihnen auf dem Tisch lag. Sie ignorierten ihre Verletzungen, ihre furchtbar verdrehten und zerschmetterten Glieder. Die Todesursache war für sie von untergeordneter Bedeutung. Sie interessierten sich vielmehr dafür, welcher mikrobiologische Trittbrettfahrer sich in ihrer Leiche verbarg. Roman setzte das Skalpell zum Y-Schnitt an. Seine andere Hand war durch einen mit Stahlgeflecht verstärkten Handschuh geschützt. Der erste Schnitt verlief von der rechten Schulter diagonal über die Brust bis zum Schwertfortsatz, der Zweite spiegelbildlich zum Ersten von der linken Schulter aus zur Brustmitte hin. Von der Stelle, an der die beiden Linien sich trafen, schnitt er den Bauch in Längsrichtung bis zum Schambein auf, wobei er den Nabel mit einem kleinen Zacken umging. Dann wurden die Rippen durchtrennt und das Brustbein gelöst. Jetzt konnten sie den knöchernen Schutzschild abheben und so die Brusthöhle freilegen. Die Todesursache war sofort offensichtlich. Wenn ein Flugzeug abstürzt, ein Auto gegen eine Mauer rast oder ein Mensch sich aus Liebeskummer aus dem zehnten Stock, stürzt, ist die so genannte Kraft der Dezeleration, die auf den Körper einwirkt, immer die Gleiche. Die Geschwindigkeit, mit der er sich bewegt hat, fällt abrupt auf Null. Durch den Aufprall können Rippen zerschmettert werden, und Knochensplitter können sich in lebenswichtige Organe bohren. Es kann zu Wirbelfrakturen mit Durchtrennung des Rückenmarks kommen, der Schädel kann gegen das Armaturenbrett oder die Instrumententafel geschleudert werden. Doch selbst wenn ein Pilot korrekt angeschnallt ist und seinen Helm trägt, kann allein die Kraft der Dezeleration tödliche Auswirkungen haben – der Rumpf mag zwar durch den Gurt gesichert sein, die inneren Organe sind es jedoch nicht. Herz, Lunge und große Blutgefäße werden in der Brusthöhle nur durch Gewebefasern an Ort und Stelle gehalten. Wenn der Rumpf nun plötzlich zum Stillstand gebracht wird, schwingt das Herz weiter wie ein Pendel, und durch die heftigen Bewegungen kann Gewebe beschädigt oder gar die Aorta zerrissen werden. Das Blut ergießt sich dann in das Mediastinum und die Pleurahöhle. Jill Hewitts Brusthöhle war ein einziger See von Blut. Roman saugte es ab und betrachtete stirnrunzelnd das Herz und die Lungenflügel. »Ich kann nicht erkennen, wo das Blut ausgetreten ist«, sagte er. »Warum nehmen wir nicht den ganzen Block raus?«, meinte sein Assistent. »Dann könnten wir besser sehen.« »Der Riss ist höchstwahrscheinlich in der aufsteigenden Aorta«, sagte Jack. »In fünfundsechzig Prozent der Fälle befindet er sich unmittelbar oberhalb der Aortaklappe.« Roman warf ihm einen verärgerten Blick zu. Bisher hatte er Jack ignorieren können; diese Einmischung aber nahm er ihm offensichtlich übel. Ohne ein Wort zu sagen, setzte er erneut das Skalpell an, um die großen Blutgefäße zu durchtrennen. »Ich rate Ihnen, das Herz zunächst in situ zu untersuchen«, meinte Jack. »Bevor Sie schneiden.«, »Wie und an welcher Stelle sie verblutet ist, interessiert mich nur am Rande«, gab Roman zurück. Es ist ihnen im Grunde egal, woran sie gestorben ist, dachte Jack. Sie wollen nur wissen, welcher Organismus möglicherweise in ihr heranwächst und sich vermehrt. Roman durchschnitt die Luftröhre, die Speiseröhre und die großen Blutgefäße und nahm dann Herz und Lunge in einem Stück heraus. Beide Lungenflügel waren mit Blutergüssen übersät. Traumatisch oder infektiös? Jack wusste es nicht. Als Nächstes untersuchte Roman die Bauchorgane. Der Dünndarm war wie die Lungen mit Schleimhauthämatomen bedeckt. Er entfernte ihn und legte die feucht glänzenden Eingeweide in eine Schüssel. Jetzt schnitt er den Magen, die Bauchspeicheldrüse und die Leber heraus. Alle Organe würden seziert und unter dem Mikroskop untersucht werden. Von dem Gewebe würde man Kulturen anlegen, um Bakterien und Viren zu identifizieren. Der Leiche fehlten nun fast alle inneren Organe. Jill Hewitt, die Marinepilotin und Triathletin, die Scotch und Poker mit hohen Einsätzen und Jim-Carrey-Filme gemocht hatte, war nur noch eine leere Hülle. Roman richtete sich auf. Er wirkte irgendwie erleichtert. Die Autopsie hatte bisher nichts Ungewöhnliches zu Tage gefördert. Falls es irgendwelche deutlichen Anzeichen für eine Marburg- Infektion gab, waren sie Jack entgangen. Roman ging um den Tisch herum zum Kopfende. Dies war der Teil, den Jack fürchtete. Er musste sich zwingen hinzusehen, als Roman Jills Kopfhaut am Haaransatz entlang von Ohr zu Ohr aufschnitt. Er zog die Haut nach vorn ab und klappte den Hautlappen um, sodass Jills kastanienbraunes Haar über ihr Kinn fiel. Mit einer Knochenzange brachen sie den Schädel auf. Sägen waren wegen des umherfliegenden Knochenstaubs bei einer Autopsie der Sicherheitsstufe 4 nicht zugelassen. Sie hoben die Schädeldecke ab., Ein faustgroßer Klumpen geronnenen Bluts fiel heraus und landete auf dem Stahltisch. »Großes subdurales Hämatom«, sagte einer von Romans Mitarbeitern. »Vom Trauma?« »Das glaube ich nicht«, erwiderte Roman. »Sie haben die Aorta gesehen – der Tod muss unmittelbar nach dem Aufprall eingetreten sein. Ich kann mir nicht vorstellen, dass das Herz lange genug gepumpt hat, um eine so ausgedehnte Blutung im Schädelinnern zu verursachen.« Vorsichtig fasste er mit seinen behandschuhten Fingern in die Schädelhöhle, um die Oberfläche des Gehirns abzutasten. Eine gallertartige Masse glitt heraus und klatschte auf den Tisch. Roman zuckte erschrocken zurück. »Was zum Teufel ist denn das?«, rief sein Assistent. Roman gab keine Antwort. Er stand nur da und starrte den mit einer blaugrünen Membran überzogenen Gewebeklumpen an. Durch den glitzernden Schleier konnte man eine Art formlosen Fleischklumpen erkennen. Er wollte eben die Membran aufschlitzen, als er plötzlich innehielt und einen Seitenblick auf Jack warf. »Es ist irgendein Tumor«, sagte er. »Oder eine Zyste. Das würde die Kopfschmerzen erklären, von denen sie sprach.« »Nein, das würde es nicht«, mischte Jack sich ein. »Ihre Kopfschmerzen haben plötzlich eingesetzt – von einer Stunde auf die andere. Ein Tumor wächst über Monate heran.« »Woher wollen Sie wissen, dass sie ihre Symptome nicht über Monate für sich behalten hat?«, konterte Roman. »Sie hat vielleicht niemandem davon erzählt, um ihre Teilnahme am Flug nicht zu gefährden.« Jack musste eingestehen, dass es so gewesen sein konnte. Die Astronauten waren so wild auf Flugeinsätze, dass man ihnen durchaus zutrauen konnte, Symptome zu verbergen, die sie von, einer Mission ausschließen würden. Roman sah seinen Kollegen an, der ihm gegenüber am Tisch stand. Der andere Mann nickte, verfrachtete den Klumpen in einen Probenbehälter und ging damit hinaus. »Wollen Sie es nicht sezieren?« »Es muss zuerst fixiert und gefärbt werden. Wenn ich hineinschneide, beschädige ich vielleicht die Zellarchitektur.« »Sie wissen ja nicht, ob es wirklich ein Tumor ist.« »Was soll es denn sonst sein?« Jack wusste keine Antwort. Er hatte noch nie etwas Ähnliches gesehen. Roman fuhr mit der Untersuchung von Jill Hewitts Schädelhöhle fort. Es war klar, dass diese Masse, was immer es auch war, starken Druck auf ihr Gehirn ausgeübt und es verformt hatte. Wie lange war sie schon dort gewesen? Monate? Jahre? Und wie war es dann möglich gewesen, dass Jills Gehirn weiterhin normal gearbeitet hatte, dass sie in der Lage gewesen war, eine so komplizierte Maschine wie das Shuttle zu fliegen? All diese Gedanken schossen Jack durch den Kopf, während er zusah, wie Roman das Gehirn herausnahm und es in eine Stahlschüssel legte. »Die Hirnmasse war kurz davor, durch das Tentorium zu brechen«, sagte Roman. Kein Wunder, dass Jill erblindet war. Kein Wunder, dass sie das Fahrgestell nicht ausgeklappt hatte. Sie war bereits bewusstlos gewesen, während ihr Gehirn beinahe nach unten aus dem Schädel herausgedrückt worden wäre wie Zahnpasta aus einer Tube. Jills Leiche, oder was davon übrig war, wurde in einem neuen Leichensack verschlossen und zusammen mit den Gefahrstoff- behältern, die ihre Organe enthielten, aus dem Autopsieraum geschoben., Die zweite Leiche wurde hereingefahren. Es war Andy Mercer. Mit neuen Gummihandschuhen über den Handschuhen seines Raumanzugs und mit einem sauberen Skalpell machte Roman sich an den Y-Schnitt. Er arbeitete jetzt schneller, als ob er sich bei Jills Autopsie nur aufgewärmt hätte und jetzt erst richtig in Fahrt käme. Mercer hatte über Bauchschmerzen und Erbrechen geklagt, erinnerte sich Jack, während er zusah, wie Romans Skalpell durch Haut und subkutanes Fett schnitt. Mercer hatte nicht wie Jill unter Kopfschmerzen gelitten, doch er hatte Fieber gehabt und etwas Blut erbrochen. Würden seine Lungen Spuren von Marburg-Befall aufweisen? Wieder trafen sich Romans diagonale Schnitte unterhalb des Schwertfortsatzes, wieder schlitzte er den Bauch mit einem flachen Schnitt bis zum Schambein auf. Wieder durchschnitt er die Rippen und löste den dreieckigen Schild, der das Herz bedeckte. Er hob das Brustbein an. Im nächsten Moment taumelte er nach Luft ringend nach hinten und ließ das Skalpell fallen. Seine Assistenten standen starr vor ungläubigem Entsetzen da. In Mercers Brusthöhle lag eine ganze Traube blaugrüner Zysten, identisch mit dem Fremdkörper aus Jill Hewitts Gehirn. Wie kleine durchscheinende Eier klumpten sie sich um das Herz. Roman stand wie gelähmt da und starrte auf den klaffenden Körper. Dann fiel sein Blick auf das schimmernde Bauchfell. Es war gedehnt, offenbar voller Blut, und wölbte sich aus dem Einschnitt heraus. Roman trat auf die Leiche zu, ohne den Blick von dem Bauchfell zu wenden. Bei seinem Schnitt durch die Bauchwand hatte die Spitze des Skalpells diese Membran leicht geritzt. Eine mit Blut vermischte Flüssigkeit sickerte aus der Wunde. Zuerst, waren es nur wenige Tropfen. Doch dann strömte vor ihren Augen die Flüssigkeit immer schneller hervor, und plötzlich erweiterte sich der Schlitz zu einem klaffenden Loch, aus dem das Blut hervorschoss und eine glitschige Masse blaugrüner Zysten mit herausspülte. Roman schrie entsetzt auf, als die Zysten in Pfützen aus Blut und Schleim auf den Boden klatschten. Eine davon glitschte über den Betonfußboden und stieß gegen Jacks Schuh. Er bückte sich, um sie mit seinem Handschuh zu greifen, doch Romans Assistenten rissen ihn vom Tisch zurück. »Schaffen Sie ihn hier raus!«, befahl Roman. »Schaffen Sie ihn sofort nach draußen!« Die zwei Männer stießen Jack auf die Tür zu. Er wehrte sich und schob die Hand weg, die ihn an der Schulter packen wollte. Der Mann taumelte ein paar Schritte zurück, stieß ein Tablett mit chirurgischen Instrumenten um und fiel der Länge nach auf den mit Blut und Zysten verschmierten Boden. Der zweite Mann riss Jacks Luftschlauch aus der Halterung und hielt das verdrehte Ende hoch. »Ich rate Ihnen, mit uns nach draußen zu gehen, Dr. McCallum«, sagte er, »solange Sie noch Luft zum Atmen haben.« »Mein Anzug! O Gott, da ist ein Riss!« Es war der Mann, der gegen die Instrumentenschale gestoßen war. Er starrte jetzt voller Entsetzen auf einen fünf Zentimeter langen Riss im Ärmel seines Raumanzugs – einem Ärmel, der über und über mit Mercers Körperflüssigkeiten bedeckt war. »Er ist nass. Ich kann es fühlen, mein innerer Ärmel ist nass …« »Los!«, fuhr Roman ihn an. »Sofort dekontaminieren!« Der Mann zog seinen Sauerstoffschlauch aus dem Anzug und stürzte voller Panik aus dem Raum. Jack folgte ihm in die Luft- schleuse, und gemeinsam betraten sie den Dekontaminierungs- raum. Wasser schoss aus den Düsen an der Decke und prasselte, wie ein schwerer Regenschauer auf ihre Schultern. Dann folgte die Desinfektionsdusche; eine grünliche Flüssigkeit sprudelte hervor und klatschte geräuschvoll gegen ihre Plastikhelme. Als die Prozedur beendet war, gingen sie durch die nächste Tür und legten ihre Anzüge ab. Der Mann riss sich sofort den nassen Krankenhauskittel vom Leib, hielt den Arm unter den Wasserhahn und drehte voll auf, um alle eventuellen Reste von Mercers Körperflüssigkeit wegzuspülen. »Haben Sie irgendwelche Hautverletzungen?«, fragte Jack. »Schnittwunden, Niednägel?« »Die Katze meiner Tochter hat mich gestern Abend gekratzt.« Jack betrachtete den Arm des Mannes und sah die Spuren der Krallen: drei mit Schorf bedeckte Kratzer an der Innenseite des Arms. Des Arms, der in dem beschädigten Ärmel gesteckt hatte. Er sah dem Mann in die Augen, und er sah die Angst darin. »Was geschieht jetzt?«, fragte Jack. »Quarantäne. Ich werde weggesperrt. Scheiße …« »Ich weiß jetzt schon, dass es nicht Marburg ist«, sagte Jack. Der Mann atmete hörbar auf. »Nein. Das ist es nicht.« »Was ist es dann? Sagen Sie mir, womit wir es zu tun haben!« Der Mann stützte sich mit beiden Händen auf das Waschbecken und starrte in das Wasser, das gurgelnd im Abfluss verschwand. Leise sagte er: »Wir wissen es nicht.«, Sullivan Obie brauste mit seiner Harley über den Mars. Um Mitternacht, wenn der Vollmond vom Himmel strahlte und die zerklüftete Wüstenlandschaft sich vor ihm ausdehnte, konnte er sich einbilden, es wäre Marswind, der sein Haar peitschte, und roter Marsstaub, der unter den Rädern knirschte. Es war ein alter Tagtraum aus seiner Kindheit, aus den Tagen, als die frühreifen Obie-Brüder selbst gebastelte Raketen abgefeuert und Mondlandefähren aus Pappe gebaut hatten und in Raumanzügen aus Stanniolpapier herumgelaufen waren. Aus den Tagen, als er und Gordie irgendwie ganz sicher gewusst hatten, dass ihre Zukunft in den Weiten des Weltraums lag. Und das ist aus diesen hochfliegenden Träumen geworden, dachte er. Im Tequilarausch durch die Wüste brettern. Er würde es niemals bis zum Mars schaffen, oder auch nur bis zum Mond. Wahrscheinlich würde er nicht einmal von der verdammten Startrampe wegkommen, sondern auf der Stelle zerfetzt werden. Ein schneller, spektakulärer Tod. Na ja, immer noch besser, als mit fünfundsiebzig an Krebs zu sterben. Er brachte die Maschine mit einem Schlenker zum Stehen und starrte über die mondbeschienenen Sanddünen hinweg zur Apogee II hinüber, die sich wie ein silberner Pfeil von der Rampe erhob und ihre Nase gen Himmel reckte. Sie hatten sie gestern dorthin transportiert. Es war eine langsame, feierliche Prozession gewesen, und die kleine Schar von Apogee-Mitarbeitern hatte gehupt und mit den Händen auf die Autodächer getrommelt, während sie dem Tieflader durch die Wüste gefolgt waren. Als sie das gute Stück schließlich aufgerichtet hatten und alle Augen im grellen Sonnenschein blinzelnd zu ihr aufgeblickt hatten, war es plötzlich ganz still geworden. Alle wussten: Das hier war die allerletzte Runde, und die Einsätze waren gemacht. Wenn die, Apogee II in drei Wochen startete, würden all ihre Hoffnungen und Träume mit an Bord sein. Zusammen mit meinem eigenen jämmerlichen Kadaver, dachte Sullivan. Es durchfuhr ihn eiskalt, als ihm klar wurde, dass er vielleicht gerade seinen Sarg betrachtete. Er jagte die Maschine hoch und donnerte zurück zur Straße, schoss über Dünen und setzte im Sprung über Senken. Er fuhr blindlings drauflos, sein Leichtsinn genährt von Tequila und der plötzlichen, unerschütterlichen Gewissheit, dass er bereits ein toter Mann war. Dass er in drei Wochen mit dieser Rakete ins Nirwana abheben würde. In der Zwischenzeit konnte ihm nichts und niemand etwas anhaben, er war unverwundbar. Die Aussicht auf den sicheren Tod hatte ihn unbesiegbar gemacht. Immer schneller und schneller flog er durch die öde Mondlandschaft seiner Kindheitsfantasien. Und jetzt sitze ich im Mondauto und rase durch das Meer der Ruhe. Jage einen Mond- hügel hoch. Hebe ab und setze zu einer weichen Landung an … Er spürte, wie der Boden unter ihm jäh abfiel. Er flog durch die Nacht, die grollende Harley zwischen den Knien, das Mondlicht in seinen Augen. Immer noch flog er. Wie weit? Wie hoch? Er schlug mit solcher Wucht auf dem Boden auf, dass er die Kontrolle verlor und zur Seite schleuderte. Er fiel, und die Harley landete auf ihm. Einen Augenblick lang lag er benommen da, eingeklemmt zwischen seiner Maschine und einem flachen Felsen. Na, das ist ja vielleicht eine bescheuerte Lage, dachte er. Dann setzten die Schmerzen ein. Tief und bohrend, als würden seine Hüften zu Splittern zermahlen. Er schrie auf und ließ sich zurückfallen, das Gesicht zum, Himmel gerichtet. Der Mond blickte spöttisch auf ihn herab. »Sein Becken ist an drei Stellen gebrochen«, sagte Bridget. »Die Ärzte haben es gestern genagelt. Sie haben mir gesagt, er muss mindestens sechs Wochen im Bett bleiben.« Casper Mulholland konnte fast hören, wie seine Träume mit einem lauten Knall wie ein Luftballon zerplatzten. »Sechs … Wochen?« »Anschließend muss er für drei bis vier Monate in die Rehaklinik.« »Vier Monate?« »Mein Gott, Casper, sag doch mal was Originelles.« »Wir sind ruiniert.« Er schlug sich mit der Hand an die Stirn, als wollte er sich dafür bestrafen, dass er zu träumen gewagt hatte, sie könnten je Erfolg haben. Da war er wieder, der alte Apogee-Fluch, und stellte ihnen kurz vor der Ziellinie ein Bein. Er ließ ihre Raketen in tausend Stücke fliegen. Er hatte ihr erstes Büro niedergebrannt. Und jetzt zog er ihren einzigen Piloten aus dem Verkehr. Casper ging im Zimmer auf und ab und dachte: Nichts, was wir angefangen haben, hat je funktioniert. Sie hatten ihre gesamten Ersparnisse investiert, ihren guten Ruf und die letzten dreizehn Jahre ihres Lebens. Es schien, als wollte Gott ihnen den guten Rat geben, endlich aufzugeben. Auszusteigen, bevor etwas wirklich Übles passierte. »Er war besoffen«, sagte Bridget. Casper blieb stehen und drehte sich zu ihr um. Sie stand mit grimmig verschränkten Armen da, und ihr rotes Haar leuchtete wie der flammende Heiligenschein eines Würgeengels. »Die Ärzte haben’s mir gesagt«, fuhr sie fort. »Eins Komma neun Promille. Voll wie eine Haubitze. Das ist nicht unser übliches Pech. Unser lieber Sully hat mal wieder Scheiße gebaut. Mein einziger Trost ist, dass er in den nächsten sechs, Wochen einen dicken Schlauch im Schwanz stecken hat.« Wortlos stapfte Casper aus dem Wartezimmer, stürmte den Flur entlang und stieß die Tür von Sullivans Krankenzimmer auf. »Du Trottel.« Sully blickte mit glasigen Morphiumaugen zu ihm auf. »Danke für deine Anteilnahme.« »Du verdienst keine. Drei Wochen bis zum Start, und du gehst hin und ziehst in der Wüste einen gottverdammten Chuck- Yeager-Stunt ab? Hättest dir auch gleich das Hirn einrennen können. Wir hätten den Unterschied weiß Gott nicht gemerkt.« Sully schloss die Augen. »Tut mir Leid.« »Dir tut’s immer nur Leid.« »Ich hab Mist gebaut. Ich weiß …« »Du hast ihnen einen bemannten Flug versprochen. Das war nicht meine Idee, es war deine. Jetzt können sie es kaum erwarten. Sie sind total begeistert. Wann haben wir es zuletzt geschafft, einen Investor zu begeistern? Das hätte die Sache wirklich rausreißen können. Wenn du bloß die Finger von der Flasche gelassen hättest …« »Ich hatte Schiss.« Sully hatte so leise gesprochen, dass Casper nicht sicher war, ob er ihn richtig verstanden hatte. »Was?«, fragte er. »Wegen des Starts. Ich hatte ein … ungutes Gefühl.« Ein ungutes Gefühl. Casper ließ sich langsam auf den Stuhl neben dem Bett sinken. Sein Zorn war wie weggeblasen. Kein Mann gibt bereitwillig zu, dass er Angst hat. Die Tatsache, dass Sully, der gewohnt war, das Schicksal herauszufordern, plötzlich eingestand, dass er sich vor etwas fürchtete, erschütterte ihn zutiefst. Und weckte schließlich sein Mitgefühl. »Ihr braucht mich doch nicht für den Flug«, sagte Sully. »Sie erwarten, dass ein Pilot in dieses Cockpit steigt.«, »Ihr könntet genauso gut einen Affen auf meinen Platz setzen, die würden den Unterschied nie merken. Die Apogee braucht keinen Piloten, Cap. Alle Funktionen können vom Boden aus ferngesteuert werden.« Casper seufzte. Sie hatten jetzt keine Wahl mehr; es würde ein unbemannter Flug werden. Natürlich hatten sie einen triftigen Grund, Sully nicht in den Orbiter zu setzen, aber würden die Investoren das akzeptieren? Oder würden sie nicht vielmehr glauben, Apogee hätte den Schwanz eingezogen? Die Firma hätte nicht genug Vertrauen in ihr eigenes Produkt, um ein Menschenleben aufs Spiel zu setzen? »Ich hab wohl einfach die Nerven verloren«, sagte Sully leise. »Hab gestern Abend einfach angefangen zu trinken. Konnte nicht mehr aufhören …« Casper verstand, weshalb sein Partner Angst hatte – so wie er auch verstand, wie eine Niederlage unweigerlich zur Nächsten und wieder zur Nächsten führen kann, bis die einzige Gewissheit im Leben eines Mannes die Gewissheit des Scheiterns ist. Kein Wunder, dass Sully Schiss hatte; er hatte den Glauben an ihren Traum verloren. Den Glauben an Apogee. Vielleicht hatten sie das alle. Casper sagte: »Wir können diesen Flug immer noch durchziehen. Auch ohne einen Affen im Cockpit.« »Ja. Ihr könntet stattdessen Bridget raufschicken.« »Und wer würde dann ans Telefon gehen?« »Der Affe.« Die Männer lachten. Sie waren wie zwei alte Soldaten, die sich am Vorabend einer sicheren Niederlage gegenseitig ein wenig aufzumuntern versuchen. »Wir machen es also?«, fragte Sully »Wir ziehen den Start durch?« »Deshalb haben wir die Rakete schließlich gebaut.«, »Also gut.« Sully atmete tief durch, und ein Anflug seines alten Draufgängertums zog über sein Gesicht. »Dann machen wir’s auch gleich richtig. Presseerklärung an alle Nachrichten- agenturen. Die Mutter aller Zeltpartys, mit Champagner und allem Drum und Dran. Scheiß drauf, ladet ruhig auch meinen heiligen Bruder und seine ganzen NASA-Kumpel ein. Wenn sie auf der Rampe explodiert, legen wir wenigstens einen Abgang hin, der sich gewaschen hat.« »Jawoll. Das konnten wir schon immer gut.« Sie grinsten. Casper stand auf. »Gute Besserung, Sully«, sagte er. »Wir brauchen dich noch für die Apogee III.« Als er in das Wartezimmer zurückkam, war Bridget immer noch da. »Und was jetzt?«, fragte sie. »Wir starten planmäßig.« »Unbemannt?« Er nickte. »Wir steuern sie vom Kontrollraum aus.« Zu seiner Verblüffung reagierte sie mit einem erleichterten Schnaufen. »Halleluja!« »Worüber freust du dich denn so? Unser Mann liegt im Krankenhaus.« »Genau.« Sie warf ihre Handtasche über die Schulter und wandte sich zum Gehen. »Das bedeutet, er kann nicht dabei sein und alles vermasseln.« 11. August Nikolai Rudenko schwebte in der Druckschleuse und sah zu, wie Luther sich hüftwackelnd in den unteren Rumpfteil seines Raumanzugs zwängte. Für den schmächtigen Nikolai war Luther mit seinen breiten Schultern und säulenartigen Beinen, ein exotischer Riese. Und dann seine Haut! Während Nikolai im Lauf der Monate an Bord der ISS käseweiß geworden war, hatte Luther immer noch seinen glänzenden tiefbraunen Teint; ein verblüffender Kontrast zu den blassen Gesichtern, die diese ansonsten farblose Welt bewohnten. Nikolai war bereits fertig verpackt und wartete neben Luther, um seinem Partner beim Anlegen des Oberteils seines Raumanzugs zu assistieren. Sie redeten wenig miteinander; keiner der beiden war in der Stimmung für Smalltalk. Sie hatten zusammen eine weitgehend schweigsame »Nacht« in der Druckschleuse verbracht, wo sich ihr Organismus an den niedrigeren atmosphärischen Druck von 700 Hektopascal gewöhnen konnte – zwei Drittel des normalen Drucks in der Station. In ihren Raumanzügen würde er mit knapp 300 hPa noch niedriger sein. Die Anzüge konnten nicht stärker aufgepumpt werden, weil Arme und Beine sonst zu steif und unbeweglich wurden und die Astronauten die Gelenke nicht mehr beugen konnten. Begab man sich allerdings direkt aus einem Raumschiff mit vollem Druck in einen Außenbordanzug, war der Effekt der gleiche wie beim zu schnellen Auftauchen aus den Tiefen des Ozeans. Ein Astronaut konnte von der Taucherkrankheit befallen werden. Im Blut bildeten sich Stickstoffbläschen und verstopften die Kapillargefäße, sodass die lebenswichtige Sauerstoff- versorgung von Gehirn und Rückenmark unterbunden wurde. Die Folgen konnten katastrophal sein: Lähmung oder gar ein Schlaganfall. Wie Tiefseetaucher mussten auch Astronauten ihrem Körper Zeit geben, sich allmählich an die veränderten Druckverhältnisse anzupassen. Am Abend vor einem »Weltraum- spaziergang« spülte die Crew ihre Lungen mit hundert- prozentigem Sauerstoff durch und »campte« die Nacht über in der Druckschleuse. Stundenlang waren sie in einer kleinen Kammer eingeschlossen, die ohnehin schon mit Geräten voll gestopft war. Kein Ort für Leute, die unter Klaustrophobie litten. Die Arme über dem Kopf ausgestreckt, wand sich Luther in, den starren oberen Rumpfteil hinein, der an der Wand befestigt war. Es war ein anstrengender Tanz, etwa so, als zwängte man sich in einen viel zu engen Tunnel hinein. Endlich gelang es ihm, den Kopf durch die Halsöffnung zu stecken, worauf Nikolai ihm half, den Hüftring zu schließen, mit dem die beiden Teile luftdicht verbunden wurden. Sie setzten ihre Helme auf. Als Nikolai nach unten schaute, um den Helm mit dem Rumpfteil zu verbinden, bemerkte er, dass am Rand des Halsrings etwas glitzerte. Sicher nur Spucke, dachte er und befestigte den Helm. Sie zogen ihre Handschuhe an. Nachdem sie sicher in ihren Anzügen verpackt waren, öffneten sie die Luke der Ausrüstungsschleuse, stiegen in die dahinter liegende Mannschaftsschleuse und schlossen die Luke hinter sich. Sie befanden sich jetzt in einer noch kleineren Kammer, kaum groß genug, um die beiden Männer mit ihren sperrigen tragbaren Lebenserhaltungssystemen aufzunehmen. Als Nächstes war ein dreißig Minuten dauerndes »Voratmen« angesagt. Während sie reinen Sauerstoff inhalierten und ihr Blut von den letzten Stickstoffspuren reinigten, ließ Nikolai sich mit geschlossenen Augen treiben und bereitete sich innerlich auf den bevorstehenden Weltraumspaziergang vor. Wenn es ihnen nicht gelang, die klemmende Beta-Kardanaufhängung zu reparieren und die Kollektoren wieder zur Sonne hin auszurichten, würde ihnen der Strom ausgehen. Dann waren sie lahm gelegt. Was Nikolai und Luther in den nächsten sechs Stunden erreichen konnten oder nicht, war von entscheidender Bedeutung für das Schicksal der Raumstation. Obwohl diese Verantwortung schwer auf seinen müden Schultern lastete, konnte Nikolai es kaum erwarten, die Luke zu öffnen und aus der Schleuse hinauszuschweben. Ein Weltraum- spaziergang war wie eine zweite Geburt; wie ein Fötus tauchte man aus dieser kleinen, engen Öffnung hervor und schwamm, nur von der Nabelschnur gehalten, in die endlose Weite des Alls. Wäre die Situation nicht so ernst gewesen, hätte er sich regelrecht, darauf gefreut, hätte voller Spannung dem Erlebnis absoluter Freiheit entgegengefiebert, dem Gefühl, in einem Universum ohne Grenzen dahinzutreiben, und dem unglaublichen Anblick der blauen Erdkugel, die sich tief unter ihnen langsam drehte. Doch die Bilder, die ihm in den Sinn kamen, während er mit geschlossenen Augen darauf wartete, dass die dreißig Minuten verstrichen, waren keine Bilder von Raumspaziergängen. Er sah die Gesichter der Toten. Er sah die Discovery zur Erde stürzen. Er sah die Crew, in ihren Sitzen festgeschnallt, während ihre Körper wie Puppen hin und her geschleudert wurden, bis ihre Wirbelsäulen brachen und ihre Herzen zersprangen. Obwohl die Bodenkontrolle ihnen nichts über die Einzelheiten der Katastrophe gesagt hatte, erfüllten die albtraumhaften Visionen seinen Sinn, ließen sein Herz schneller schlagen und seinen Mund trocken werden. »Eure dreißig Minuten sind um, Jungs«, erklang Emmas Stimme über den Bordlautsprecher. »Zeit für die Dekompression.« Nikolais Hände waren klamm und verschwitzt, als er die Augen wieder öffnete und sah, wie Luther die Dekompressions- pumpe in Gang setzte. Die Luft wurde aus der Schleuse herausgepumpt, und der Druck begann zu sinken. Wenn ihre Raumanzüge undichte Stellen hatten, würden sie es jetzt bemerken. »Alles okay?«, fragte Luther, während er die Anschlüsse ihrer »Nabelschnüre« überprüfte. »Ich bin bereit.« Luther öffnete das Außenventil der Druckschleuse. Dann löste er die Sperre des Handgriffs und klappte die Luke auf. Zischend entwich der letzte Rest Luft. Sie hielten, die Hände am Rahmen der Luke, noch einen Augenblick inne und starrten in ehrfürchtigem Schweigen nach draußen. Dann schwamm Nikolai hinaus in die Schwärze des Weltraums., »Jetzt kommen sie raus«, sagte Emma, die auf dem Videobildschirm verfolgte, wie die zwei Männer aus der Luke der Mannschaftsschleuse auftauchten und an ihren Nabelschnüren hängend hinausschwebten. Sie entnahmen Werkzeug aus einem außerhalb der Druckschleuse angebrachten Behälter. Dann hangelten sie sich mit Hilfe der in kurzen Abständen angebrachten Handgriffe zur Hauptträgerstruktur vor. Als sie an der direkt unterhalb der Struktur angebrachten Kamera vorbeikamen, winkte Luther. »Guckt ihr euch die Sendung auch an?«, kam seine Stimme über die UHF-Anlage. »Auf der Außenkamera können wir euch einwandfrei sehen«, sagte Griggs. »Aber eure EMU-Kameras senden nicht.« »Auch die von Nikolai nicht?« »Keine von beiden. Wir versuchen, das Problem zu identifizieren.« »Okay, also, wir klettern jetzt weiter, um uns den Schaden anzusehen.« Die beiden Männer verschwanden aus dem Aufnahmebereich der ersten Kamera. Für einen Augenblick war nichts von ihnen zu sehen. Dann sagte Griggs: »Da sind sie!« Er zeigte auf einen anderen Bildschirm, auf dem die Männer in ihren Raumanzügen zu sehen waren, wie sie sich entlang der Oberseite des Gerüsts langsam auf die zweite Kamera zuarbeiteten. Dann verschwanden sie erneut von der Bildfläche. Sie waren nun in dem Bereich, der von der beschädigten Kamera abgedeckt werden sollte. »Seid ihr bald da, Jungs?«, fragte Emma. »Gleich … gleich sind wir da«, antwortete Luther. Er klang kurzatmig. Macht langsam, dachte sie. Teilt eure Kräfte ein. Lange Zeit, scheinbar endlos lange, war nichts von der Außenbordcrew zu hören. Emma spürte, wie ihr Puls sich, beschleunigte und ihre Anspannung wuchs. Die Station war bereits angeschlagen, ihre Energieversorgung schwer beeinträchtigt. Bei diesen Reparaturen durfte nichts schief gehen. Wenn doch bloß Jack hier wäre, dachte sie. Jack war ein talentierter Bastler, der jeden Bootsmotor nachbauen oder aus ein paar Teilen vom Schrottplatz ein Kurzwellenradio zusammenschustern konnte. Im Orbit ist das wertvollste Werkzeug ein geschicktes Paar Hände. »Luther?«, fragte Griggs. Es kam keine Antwort. »Nikolai? Luther? Antwortet bitte.« »Mist«, sagte Luther. »Was ist es? Könnt ihr was erkennen?«, fragte Griggs. »Ich sehe das Problem genau vor mir, und es ist eine ziemliche Bescherung, Mann. Das ganze P-6-Ende der Hauptträgerstruktur ist verbogen. Die Discovery muss das 2-B-Segel gestreift haben, und dann hat sie sich gedreht und dabei die S-Band-Antennen abgeknickt.« »Was meinen Sie? Können Sie irgendetwas reparieren?« »Das S-Band ist kein Problem. Dafür haben wir einen Reservesatz, den können wir einbauen. Aber die Backbord- Sonnensegel – die kann man vergessen. An dem Ende müssten wir den ganzen Träger auswechseln.« »Okay.« Erschöpft rieb sich Griggs über das Gesicht. »Okay, wir haben also definitiv ein Photovoltaik-Modul weniger. Ich würde sagen, damit können wir leben. Aber die P-4-Segel müssen neu ausgerichtet werden, sonst sehen wir alt aus.« Es gab eine Pause, während der Luther und Nikolai am Hauptträger entlang zurückkletterten. Plötzlich erfasste die Kamera sie wieder: Emma sah sie in ihren unförmigen Anzügen mit den riesigen »Rucksäcken« langsam vorübergleiten wie Tiefseetaucher im Ozean. An den P-4-Segeln angelangt, hielten, sie inne, und einer der Männer schwebte an der Seite der Trägerstruktur hinunter, um den Mechanismus in Augenschein zu nehmen, der die enormen Sonnensegel mit dem Rückgrat des Trägers verband. »Die Kardanaufhängung ist verbogen«, sagte Nikolai. »Sie dreht sich nicht.« »Können Sie sie freibekommen?«, fragte Griggs. Sie hörten, wie Luther und Nikolai rasch ein paar Worte wechselten. Dann sagte Luther: »Wie elegant soll diese Reparatur denn sein?« »Wie ihr’s macht, ist egal. Wir brauchen den Saft so schnell wie möglich, sonst kriegen wir Probleme, Leute.« »Ich schätze, wir machen’s wie die Jungs von der Autowerkstatt.« Emma sah Griggs an. »Habe ich das richtig verstanden?« Es war Luther, der die Frage beantwortete. »Wir nehmen einfach einen Hammer und biegen das verdammte Teil mit ein paar Schlägen wieder hin.« Er lebte noch. Dr. Isaac Roman blickte durch das Sichtfenster auf seinen unglückseligen Kollegen, der in einem Krankenhausbett saß und fernsah. Er schaute sich doch tatsächlich Zeichentrickfilme an. Mit fast verzweifelter Konzentration verfolgte er das Kinderprogramm auf Nickelodeon. Die mit einem Raumanzug bekleidete Krankenschwester, die in das Zimmer trat, um das Tablett mit seinem unberührten Mittagessen abzuräumen, würdigte er keines Blickes. Roman drückte auf den Knopf der Gegensprechanlage. »Wie geht es Ihnen heute, Nathan?« Dr. Nathan Heisinger sah überrascht zum Fenster und bemerkte erst jetzt, dass Roman auf der anderen Seite der Glas-, scheibe stand. »Mir geht’s gut. Ich bin vollkommen gesund.« »Sie haben keinerlei Symptome?« »Ich sagte doch bereits, es geht mir gut.« Roman betrachtete ihn eine Weile eingehend. Der Mann sah recht gesund aus, doch sein Gesicht wirkte blass und angespannt. Ängstlich. »Wann kann ich die Isolierstation verlassen?«, fragte Heisinger. »Sie sind doch erst dreißig Stunden drin.« »Bei den Astronauten sind schon nach achtzehn Stunden Symptome aufgetreten.« »Das war in der Mikrogravitation. Wir wissen nicht, womit wir zu rechnen haben, und wir können kein Risiko eingehen. Das wissen Sie.« Abrupt wandte Heisinger sich wieder dem Fernseher zu, doch nicht bevor Roman das Schimmern der Tränen in seinen Augen gesehen hatte. »Meine Tochter hat heute Geburtstag.« »Wir haben ihr in Ihrem Namen ein Geschenk geschickt. Ihrer Frau hat man mitgeteilt, dass Sie nicht kommen konnten. Sie wären in Kenia mit dem Flugzeug unterwegs.« Heisinger lachte verbittert auf. »Da haben Sie ja saubere Arbeit geleistet. Und wenn ich sterbe? Was sagen Sie ihr dann?« »Dass es in Kenia passiert wäre.« »Zum Sterben ist ja wohl jeder Ort gleich gut.« Er seufzte. »Was haben Sie ihr denn geschickt?« »Ihrer Tochter? Eine Barbie-Doktorpuppe, glaube ich.« »Genau das, was sie sich gewünscht hat. Woher wussten Sie das?« Romans Handy klingelte. »Ich sehe später noch mal nach Ihnen«, sagte er und wandte sich vom Fenster ab, um den Anruf entgegenzunehmen., »Dr. Roman, hier ist Carlos. Wir haben erste Ergebnisse von den DNS-Analysen. Sie sollten mal vorbeikommen und sich das ansehen.« »Bin schon unterwegs.« Als er im Labor ankam, saß Dr. Carlos Mixtal am Computer. Über den Bildschirm floss ein ununterbrochener Strom von Daten.

GTGATTAAAGTGGTTAAAGTTGCTCATGTTCAAT TATGCAGTTGTTGCGGTTGCTTAGTGTCTTTAGC AGACACATATGAAAAGCTTTTAGATGTTTTGAAT TCAATTGAGTTGGTTTATTGTCAAACTTAGCAGATGCAAGAG

AAATTCCTGAATGCGGATATTGCTTTAGTTGAAGGCTCTGT … Es waren immer nur die gleichen vier Buchstaben, G, T, A und C – eine Nucleotidsequenz, in der jeder Buchstabe für einen der Bausteine der DNS stand, des genetischen Bauplans aller lebenden Organismen. Carlos wandte sich um, als er Romans Schritte hörte, und sein Gesichtsausdruck verriet deutlich, was in ihm vorging. Er hatte Angst. Genau wie Heisinger, dachte Roman. Alle haben Angst. Roman setzte sich neben ihn. »Ist es das?«, fragte er und deutete auf den Monitor. »Das stammt von dem Organismus, der Kenichi Hirai infiziert hat. Wir haben es aus den Überresten gewonnen, die wir … von den Wänden der Discovery abkratzen konnten.« Überreste war der angemessene Ausdruck für das, was von Hirais Leiche übriggeblieben war. Zerfetzte Gewebeklumpen, die überall an den Wänden des Orbiters geklebt hatten. »Der größte Teil der DNS lässt sich nicht identifizieren. Wir haben keine Ahnung, was darin kodiert ist. Aber diese spezielle Sequenz, die Sie hier auf dem Bildschirm sehen, konnten wir identifizieren. Es ist das Gen für das Coenzym F420.«, »Und was ist das?« »Ein Enzym, das charakteristisch für Archäen ist.« Roman lehnte sich zurück; er spürte eine leichte Übelkeit. »Jetzt haben wir also die Bestätigung«, murmelte er. »Ja. Der Organismus weist eindeutig Archäen-DNS auf.« Carlos zögerte. »Ich fürchte, wir haben schlimme Nachrichten.« »Was meinen Sie mit schlimmen Nachrichten? Ist das hier nicht schlimm genug?« Carlos drückte eine Taste, und auf dem Bildschirm erschien ein anderer Abschnitt der Nucleotidsequenz. »Das hier ist ein weiterer Gencluster, den wir gefunden haben. Ich dachte zuerst, es müsse sich um einen Fehler handeln, aber ich habe es inzwischen überprüft. Die Gene stimmen mit denen von Rana pipiens überein. Dem nördlichen Leopardfrosch.« »Was?« »Sie haben richtig gehört. Keine Ahnung, wie es an die Froschgene gekommen ist. Aber jetzt wird es wirklich unheimlich.« Carlos rief eine weitere Genomsequenz auf. »Noch ein identifizierbarer Cluster«, sagte er. Roman spürte einen kalten Schauer im Rücken. »Und was sind das für Gene?« »Die DNS ist spezifisch für Mus musculis. Die Hausmaus.« Roman starrte ihn entgeistert an. »Das ist unmöglich!« »Ich habe es nachgeprüft. Irgendwie ist es dieser Lebensform gelungen, Säugetier-DNS in ihr Genom zu integrieren. Sie hat neue enzymatische Möglichkeiten hinzugewonnen. Sie verändert sich. Entwickelt sich weiter.« Zu was?, fragte sich Roman. »Es gibt noch mehr.« Wieder drückte Carlos eine Taste, um eine weitere Nucleotidsequenz sichtbar zu machen. »Dieser Cluster stammt ebenfalls nicht von Archäen.«, »Was ist es? Auch Mäuse-DNS?« »Nein. Dieser Teil ist menschlichen Ursprungs.« Der kalte Schauer erfasste nun Romans ganzen Rücken. Seine Nackenhaare stellten sich auf. Wie benommen griff er nach dem Telefon. »Verbinden Sie mich mit dem Weißen Haus«, sagte er. »Ich muss mit Jared Profitt sprechen.« Schon beim zweiten Klingeln wurde der Hörer abgenommen. »Hier ist Profitt.« »Wir haben die DNS analysiert«, sagte Roman. »Und?« »Die Situation ist schlimmer, als wir dachten.«, Nikolai musste eine Ruhepause einlegen, seine Arme zitterten vor Überanstrengung. Die Monate im Weltraum hatten seinen Körper geschwächt und von physischer Anstrengung entwöhnt. In der Mikrogravitation gibt es kein schweres Heben und überhaupt nur wenig Anlass, die Muskeln anzustrengen. In den vergangenen fünf Stunden hatten er und Luther ununterbrochen gearbeitet; sie hatten die S-Band-Antenne repariert und die Kardanaufhängung ausgebaut und neu zusammengesetzt. Jetzt war er erschöpft. Allein die zusätzliche Anstrengung, die es kostete, in dem prall aufgepumpten Raumanzug die Arme anzuwinkeln, erschwerte selbst die einfachsten Verrichtungen. Ohnehin war das Arbeiten in dem Anzug eine Tortur. Um den menschlichen Körper gegen die extremen Außentemperaturen zu isolieren, die von 160 Grad Kälte bis zu 120 Grad Hitze reichten, und um dem Vakuum des Weltraums einen entsprechenden Druck entgegenzusetzen, war der Raumanzug aus mehreren Schichten verschiedener Materialien zusammengesetzt. Alu- miniumbeschichtetes Mylar und reißfestes Dacron sorgten für die Isolierung, darüber lag eine schützende Hülle aus neopren- gefüttertem Ortho-Fabric, und darunter trug der Astronaut wassergekühlte Unterwäsche. Er musste ein Lebenserhaltungs- system auf dem Rücken mit sich führen, das Wasser, Sauerstoff und ein Funkgerät enthielt, dazu Steuerdüsen, mit denen er im Notfall schnell die Einstiegsluke erreichen konnte. Im Grunde war der Raumanzug ein Ein-Mann-Raumschiff; er war sperrig und erschwerte jede Bewegung, sodass selbst das Festdrehen einer Schraube Kraft und Konzentration erforderte. Die Arbeit hatte Nikolai erschöpft. Seine Hände verkrampften sich in den klobigen Handschuhen, und er schwitzte. Hungrig war er auch., Er nahm einen Schluck Wasser aus dem eingebauten Röhrchen und stieß einen tiefen Seufzer aus. Obwohl das Wasser merkwürdig schmeckte, fast fischig, dachte er sich nichts dabei. In der Schwerelosigkeit schmeckte alles merkwürdig. Er nahm noch einen Schluck und spürte, wie etwas von dem Wasser auf sein Kinn tropfte. Da er nicht unter den Helm greifen konnte, um es wegzuwischen, ignorierte er es und blickte zur Erde hinunter. Sie so plötzlich in all ihrer atemberaubenden Pracht unter sich zu sehen, machte ihn schwindlig, und er empfand einen Anflug von Übelkeit. Er schloss die Augen und wartete, dass das Gefühl wieder verschwand. Es war nichts weiter als ein Anfall von Bewegungskrankheit; das kam häufig vor, wenn man unerwartet die Erde erblickte. Während sein Magen sich wieder beruhigte, wurde er auf etwas anderes aufmerksam: Das verschüttete Wasser rann seine Wange hoch. Er verzog das Gesicht, um den Tropfen abzuschütteln, doch er glitt weiter über seine Haut. Aber ich bin im schwerelosen Raum, wo es kein Oben und Unten gibt. Das Wasser durfte überhaupt nicht fließen. Er schüttelte den Kopf und klopfte mit dem Handschuh auf den Helm. Immer noch spürte er, wie der Tropfen über sein Gesicht wanderte und eine feuchte Spur hinterließ. Er bewegte sich auf sein Ohr zu. Jetzt war er schon am Rand der Kappe angelangt, die seine Sprechkombination sicherte. Bestimmt würde der Stoff die Feuchtigkeit aufsaugen und verhindern, dass der Tropfen weiterrann … Plötzlich erstarrte er. Das feuchte Etwas war unter die Kappe geschlüpft und kroch weiter auf sein Ohr zu. Das war kein Wassertropfen, der zufällig über sein Gesicht rann, sondern etwas, was sich gezielt bewegte. Etwas Lebendiges. Er warf in dem vergeblichen Versuch, das Etwas abzuschütteln, den Kopf heftig nach links und rechts. Er schlug, fest gegen seinen Helm. Und immer noch spürte er, wie es sich bewegte, wie es unter seinen Kopfhörer glitt. In Schwindel erregendem Wechsel flogen die Erde, der schwarze Raum und wieder die Erde vor seinen Augen vorbei, während er in einem verzweifelten Veitstanz wild um sich schlug. Das feuchte Etwas schlüpfte in sein Ohr. »Nikolai? Nikolai, antworten Sie bitte!«, rief Emma, die ihn auf dem Monitor beobachtete. Er drehte sich unentwegt um die eigene Achse und hämmerte wie wild gegen seinen Helm. »Luther, es sieht aus, als hätte er einen Anfall.« Auf dem Bildschirm war zu sehen, wie Luther seinem Partner zu Hilfe eilte. Nikolai hörte nicht auf, um sich zu schlagen und den Kopf hin und her zu schütteln. Über Funk konnte Emma Luthers erregte Stimme hören: »Was ist los? Was ist los?« »Mein Ohr … es ist in meinem Ohr …« »Tut es weh? Hast du Schmerzen im Ohr? Sieh mich an!« Nikolai schlug wieder mit der flachen Hand gegen seinen Helm. »Es kriecht tiefer rein!«, schrie er. »Hol es raus! Hol es raus!« »Was ist los mit ihm?«, rief Emma. »Ich weiß es nicht! Mein Gott, er dreht durch …« »Er ist gefährlich nahe an der Werkzeugaufhängung. Hol ihn da weg, ehe er seinen Anzug beschädigt!« Sie sah, wie Luther seinen Kollegen am Arm fasste. »Komm, Nikolai! Wir gehen zurück in die Druckschleuse!« Plötzlich packte Nikolai seinen Helm mit beiden Händen, als wollte er ihn herunterreißen. »Nein! Nicht!«, schrie Luther und griff in dem verzweifelten Versuch, ihn zurückzuhalten, nach Nikolais Armen. Die beiden Männer rangen miteinander, und unter ihren unkontrollierten, Bewegungen wickelten sich ihre Nabelschnüre um sie und drohten sich zu verheddern. Griggs und Diana beobachteten inzwischen mit Emma den Monitor, alle drei verfolgten entsetzt das Drama, das sich außerhalb der Station abspielte. »Luther, die Werkzeugaufhängung!«, warnte Griggs. »Passt auf eure Anzüge auf!« Kaum hatte er das gesagt, drehte Nikolai sich plötzlich in Luthers Umklammerung ruckartig herum. Sein Helm krachte gegen die Werkzeugaufhängung. Ein dünner Strahl, wie eine Art weißer Nebel, schoss aus seinem Visier hervor. »Sein Helm, Luther!«, schrie Emma. »Sieh nach seinem Helm!« Luther starrte auf Nikolais Visier. »Scheiße, er hat einen Sprung!«, rief er. »Ich kann die Luft ausströmen sehen! Er verliert Druck!« »Dreh seinen Reserve-Sauerstoff auf und bring ihn sofort rein!« Luther griff nach dem Regler an Nikolais Anzug und schaltete die Sauerstoff-Notversorgung ein. Der zusätzliche Luftstrom würde den Anzug vielleicht noch so lange mit Innendruck versorgen, dass er Nikolai lebend zurückbringen konnte. Jetzt steuerte Luther mit seinem Partner auf die Luke zu. Es kostete ihn immer noch Mühe, ihn einigermaßen unter Kontrolle zu halten. »Macht schnell«, murmelte Griggs. »Mein Gott, macht schnell!« Es vergingen kostbare Minuten, bis Luther Nikolai durch die Luke gezogen, die Klappe geschlossen und den Druck in der Schleuse wiederhergestellt hatte. Sie warteten nicht die übliche Dichtigkeitsprüfung ab, sondern pumpten den Druck gleich auf eine Atmosphäre hoch., Die innere Klappe öffnete sich, und Emma tauchte in die Ausrüstungsschleuse. Luther hatte Nikolais Helm bereits abgenommen und ver- suchte verzweifelt, seinen Kollegen vom oberen Rumpfpanzer zu befreien. Gemeinsam gelang es ihnen, den sich heftig wehrenden Nikolai aus seinem Anzug herauszumanövrieren. Emma schleppte ihn zusammen mit Griggs quer durch die Station bis zum RSM, wo die Stromversorgung noch intakt war. Er schrie die ganze Zeit und krallte ständig nach der linken Seite seiner Kopfhörerkappe. Seine Augen waren geschwollen, die Lider wölbten sich nach außen. Sie berührte seine Wangen und spürte ein leichtes Vibrieren – durch den Druckabfall hatten sich im subkutanen Gewebe Luftbläschen gebildet. Auf seinem Unterkiefer glitzerte eine Speichelspur. »Nikolai, beruhigen Sie sich!«, sagte Emma. »Es ist alles in Ordnung, verstehen Sie mich? Es wird schon wieder!« Er kreischte und riss sich die Kopfhörerkappe herunter. Sie segelte davon. »Helft mir, ihn auf den Tisch zu legen!«, sagte Emma. Alle Hände waren nötig, um den Behandlungstisch aufzu- bauen, Nikolai den wassergekühlten Innenanzug auszuziehen und ihn festzuschnallen. Während Emma seine Herz- und Lungengeräusche überprüfte und seinen Bauch untersuchte, wimmerte er in einem fort und warf den Kopf hin und her. »Es ist sein Ohr«, sagte Luther. Er hatte seinen klobigen Raumanzug abgelegt und sah mit großen Augen zu, wie Nikolai sich unter Qualen wand. »Er sagte, er hätte was ins Ohr bekommen.« Emma nahm Nikolais Gesicht genauer in Augenschein. Besonders die Speichelspur, die sich vom Kinn den Unterkiefer entlang bis zum Ohr zog. Auf der Ohrmuschel war ein feuchter Fleck. Sie schaltete das batteriebetriebene Otoskop ein und führte den, Tubus in Nikolais Gehörgang. Das Erste, was sie sah, war Blut. Ein hellroter Tropfen glitzerte im Licht des Otoskops. Dann sah sie nach dem Trommelfell. Es war durchbohrt. Statt der hell schimmernden Membran erblickte sie ein gähnendes schwarzes Loch. Ihr erster Gedanke war: Barotrauma. Hatte der plötzliche Druckabfall sein Trommelfell zerrissen? Sie überprüfte das andere Trommelfell und fand es unversehrt. Verwirrt schaltete sie das Otoskop aus und sah Luther an. »Was ist da draußen passiert?« »Ich weiß es nicht. Wir hatten eine Verschnaufpause eingelegt. Wir wollten uns kurz ausruhen und dann das Werkzeug einpacken. Gerade war er noch okay, und im nächsten Moment fing er schon an durchzudrehen.« »Ich muss mir seinen Helm ansehen.« Sie verließ das RSM und machte sich auf den Weg zurück zur Ausrüstungsschleuse. Dort öffnete sie die Klappe und sah die beiden Raumanzüge, die Luther wieder an der Wandhalterung befestigt hatte. »Was haben Sie vor, Watson?«, fragte Griggs, der ihr gefolgt war. »Ich will sehen, wie groß der Riss war. Wie schnell er an Druck verloren hat.« Sie schwebte auf den kleineren der beiden Anzüge zu, der mit »Rudenko« gekennzeichnet war, und nahm den Helm ab. Sie musterte ihn sorgfältig und fand einen feuchten Fleck an der Innenseite des gesprungenen Visiers. Aus einer der aufgesetzten Taschen ihres Anzugs nahm sie einen Wattetupfer und tunkte ihn in die Flüssigkeit. Sie war zähflüssig und gallertartig. Blaugrün. Ein eiskalter Schauer rieselte ihr über den Rücken., Kenichi war hier drin, fiel ihr plötzlich ein. An dem Tag, als er gestorben ist, haben wir ihn in dieser Druckschleuse gefunden. Er muss sie irgendwie kontaminiert haben. Voller Panik wich sie zurück und stieß in der Luke mit Griggs zusammen. »Raus!«, schrie sie. »Sofort raus hier!« »Was ist denn?« »Ich glaube, wir haben eine Biokontamination! Schließen Sie die Luke! Los, machen Sie sie zu!« Hastig zogen sie sich aus der Schleuse in den Ver- bindungsknoten zurück. Dann schlugen sie die Klappe zu und verschlossen sie sorgfältig. Sie tauschten nervöse Blicke aus. »Glauben Sie, dass etwas entwichen ist?« Emma suchte die Kapsel nach in der Luft umherschwebenden Tröpfchen ab. Auf den ersten Blick fand sie nichts. Dann glaubte sie plötzlich am äußersten Rand ihres Gesichtsfelds ein verräterisches Funkeln zu erkennen. Sie drehte sich danach um. Doch es war verschwunden. Jack saß an der Konsole des Flight Surgeon im Special-Vehicle- Operations-Kontrollraum. Er beobachtete die Uhr auf dem Großbildschirm, und mit jeder Minute, die verstrich, wuchs seine Nervosität. Die Stimmen in seinem Kopfhörer klangen zunehmend gehetzt, die Wortwechsel schnell und abgehackt. Lageberichte flogen zwischen den Controllern und dem ISS- Flugdirektor Woody Ellis hin und her. Ähnlich ausgelegt wie der Shuttle-Kontrollraum und im gleichen Gebäude unterge- bracht, war SVO im Vergleich mit diesem kleiner und stärker spezialisiert, und sein Team war ausschließlich mit Operationen der Raumstation befasst. In den sechsunddreißig Stunden, die seit der Kollision der Discovery mit der ISS vergangen waren, war die Anspannung in diesem Raum unerbittlich angestiegen und hatte sich zwischendurch immer wieder zu Momenten der, Panik gesteigert. So viele Menschen waren hier so vielen Stunden unausgesetzter Belastung ausgesetzt gewesen, dass selbst die Luft nach Krise roch, nach einem Gemisch aus Schweiß und abgestandenem Kaffee. Nikolai Rudenko hatte Dekompressionstraumata erlitten und musste unbedingt evakuiert werden. Da nur ein Rettungsboot zur Verfügung stand – das CRV –, würde die gesamte Crew zur Erde zurückkehren. Dies würde eine kontrollierte Evakuierung werden. Keine überhasteten Aktionen, keine Pannen. Keine Panik. Die NASA hatte diese Operation schon oft in der Simulation durchgespielt; allerdings war es noch nie wirklich zu einer CRV-Evakuierung gekommen. Nicht mit fünf lebenden Menschen an Bord. Nicht mit einem Menschen an Bord, den ich liebe. Jack schwitzte. Ihm war fast schlecht vor Angst. Immer wieder sah er nach der Uhr und verglich sie mit seiner Armbanduhr. Sie hatten abgewartet, bis die ISS den für die Abtrennung des Raumgleiters optimalen Punkt ihrer Umlauf- bahn erreicht hatte. Das CRV sollte auf möglichst direktem Weg zu einem Landeplatz steuern, der eine sofortige medizinische Versorgung erlaubte. Die gesamte Besatzung würde ärztliche Hilfe benötigen. Nach dem wochenlangen Aufenthalt im Weltraum waren sie schwach wie neugeborene Kätzchen, ihre Muskeln würden sie kaum tragen können. Der Zeitpunkt für die Abkopplung rückte näher. Sie würden fünfundzwanzig Minuten brauchen, um Abstand von der ISS zu gewinnen und auf GPS-Steuerung zu gehen, und weitere fünfzehn Minuten zur Vorbereitung der Wiedereintrittszündung. Und dann noch eine Stunde bis zur Landung. In weniger als zwei Stunden war Emma wieder auf der Erde. So oder so. Der Gedanke stellte sich ein, bevor er ihn unterdrücken konnte. Bevor er die Erinnerung an den schrecklichen Anblick von Jill Hewitts verstümmelter Leiche, auf dem Autopsietisch verdrängen konnte. Er ballte die Fäuste und zwang sich, seine Aufmerksamkeit wieder Nikolai Rudenkos Biotelemetriewerten zuzuwenden. Das Herz schlug schnell, aber regelmäßig; der Blutdruck war stabil. Los, macht hin. Bringen wir sie endlich nach Hause. Er hörte, wie sich Griggs von Bord der ISS meldete: »Capcom, meine Crew ist komplett im CRV versammelt, und die Luke ist geschlossen. Es ist ein bisschen sehr kuschelig hier drin, aber wir wären dann so weit.« »Halten Sie sich bereit zum Start«, erwiderte der Capcom. »Alles bereit.« »Wie geht es dem Patienten?« Jacks Herz machte einen Satz, als er Emmas Stimme hörte. »Seine vitalen Messwerte sind immer noch stabil, aber er ist dreifach desorientiert. Die Krepitationen haben sich auf seinen Hals und die obere Rumpfhälfte verlagert, und sie verursachen ihm starke Beschwerden. Ich habe ihm noch eine Dosis Morphium verabreicht.« Der plötzliche Druckabfall hatte zur Bildung von Luftbläschen unter Nikolais Haut geführt. Der Zustand war im Grunde harmlos, aber schmerzhaft. Worüber Jack sich Gedanken machte, war die Frage, ob sich Luftbläschen im Nervensystem gebildet hatten. Waren sie vielleicht der Grund für seine Verwirrtheit? »Alles klar zum Start«, sagte Woody Ellis. »Öffnen Sie die ECCLES-Verschlüsse.« »ISS«, gab der Capcom weiter. »Sie sind jetzt klar zum …« »Stop!«, unterbrach ihn eine Stimme. Jack sah verwirrt zu Flugdirektor Ellis hinüber. Der schien ebenso verwirrt. Er drehte sich zu Ken Blankenship um, dem JSC-Direktor, der soeben den Raum betreten hatte, begleitet von einem dunkelhaarigen Mann im Anzug und einem halben, Dutzend Air-Force-Offizieren. »Tut mir Leid, Woody«, sagte Blankenship. »Glauben Sie mir, es ist nicht meine Entscheidung.« »Was ist nicht Ihre Entscheidung?« »Die Evakuierung findet nicht statt.« »Wir haben einen Kranken da oben! Das CRV ist startbereit …« »Er kann nicht zurückkehren.« »Wessen Entscheidung ist das?« Der dunkelhaarige Mann trat vor. Mit einem fast entschul- digenden Unterton sagte er: »Meine. Ich bin Jared Profitt vom Sicherheitsrat des Weißen Hauses. Bitte sagen Sie Ihrer Crew, sie sollen die Luken wieder öffnen und das CRV verlassen.« »Meine Crew ist in Schwierigkeiten«, erwiderte Ellis. »Ich werde sie nach Hause bringen.« »Flight, wir müssen jetzt abkoppeln, wenn wir punktgenau landen wollen«, warf der Flugbahn-Controller ein. Ellis nickte dem Capcom zu. »Fortfahren mit CRV-Start. Wir koppeln jetzt ab.« Bevor der Capcom ein weiteres Wort sagen konnte, wurde ihm seine Sprechkombination vom Kopf gerissen. Er wurde aus seinem Stuhl gezerrt und zur Seite gestoßen. Ein Air-Force- Offizier nahm seinen Platz an der Konsole ein. »He!«, schrie Ellis. »He, was soll das?« Die Controller erstarrten an ihren Plätzen, als sie sahen, wie die Offiziere sich blitzschnell im ganzen Raum verteilten. Niemand zog eine Waffe, doch die Drohung war offensichtlich. »ISS, brechen Sie den Start ab«, sagte der neue Capcom. »Die Evakuierung fällt aus. Öffnen Sie die Luken und verlassen Sie das CRV.« Ein verdutzter Griggs antwortete: »Ich habe Sie wohl nicht richtig verstanden, Capcom.«, »Es wird keine Evakuierung geben. Verlassen Sie das CRV Wir haben Probleme mit den Navigationscomputern. Der Flight hat entschieden, dass es das Beste ist, die Evakuierung zu verschieben.« »Für wie lange?« »Auf unbestimmte Zeit.« Jack sprang auf. Er war fest entschlossen, dem Capcom die Sprechkombination zu entreißen. Jared Profitt trat vor und versperrte ihm den Weg. »Sie verstehen die Situation nicht, Sir.« »Meine Frau ist in dieser Station. Wir bringen sie nach Hause.« »Sie können nicht nach Hause. Sie sind womöglich alle infiziert.« »Womit?« Profitt antwortete nicht. In rasender Wut stürzte Jack sich auf ihn, doch zwei Air- Force-Offiziere packten ihn und zerrten ihn weg. »Womit infiziert?«, rief Jack. »Mit einem neuen Organismus«, sagte Profitt. »Einer Chimäre.« Jack blickte in Blankenships betroffenes Gesicht. Er sah die Offiziere an, die sich anschickten, die Controller an den Konsolen abzulösen. Dann bemerkte er ein weiteres vertrautes Gesicht: Leroy Cornell, der soeben hereingekommen war. Er sah blass und mitgenommen aus. In diesem Moment begriff Jack, dass die Entscheidung auf höchster Ebene getroffen worden war. Dass nichts, was er oder Blankenship oder Woody Ellis einwenden mochten, etwas daran ändern würde. Die NASA hatte hier nicht mehr das Sagen., DIE CHIMÄRE, 13. August Sie versammelten sich in Jacks Haus, wo alle Jalousien heruntergelassen waren. Sie wagten nicht, sich im JSC zu treffen, wo sie mit Sicherheit nicht unbemerkt bleiben würden. Die plötzliche feindliche Übernahme der NASA-Operationen hatte sie dermaßen geschockt, dass sie keine Ahnung hatten, wie sie vorgehen sollten. Dies war eine Krise, für die sie ausnahmsweise keine Betriebsanleitung und keine Notfallpläne hatten. Jack hatte nur eine Hand voll Leute eingeladen, alle aus dem Kreis der direkt an NASA-Einsätzen Beteiligten: Todd Cutler, Gordon Obie, die Flugdirektoren Woody Ellis und Randy Carpenter sowie Liz Gianni von der Nutzlastenstelle. Es klingelte an der Haustür, und alle blickten angespannt auf. »Er ist da«, sagte Jack und ging hinaus, um die Tür zu öffnen. Dr. Eli Petrovitch von der Abteilung Lebenswissenschaften der NASA trat mit einem Laptopfutteral unter dem Arm ins Zimmer. Er war ein dünner, zerbrechlich wirkender Mann, der seit zwei Jahren gegen ein malignes Lymphom ankämpfte. Es war deutlich zu sehen, dass er den Kampf fast verloren hatte. Die Haare waren ihm bis auf ein paar dünne weiße Strähnen ausgefallen, und seine Haut war wie gelbes Pergament, das sich über die spitzen Knochen seines Gesichts spannte. Aber aus seinen Augen leuchtete das Feuer der Begeisterung, am Leben gehalten durch die unermüdliche Neugier des Wissenschaftlers. »Haben wir sie bekommen?«, fragte Jack. Petrovitch nickte und klopfte auf seine Computertasche. Auf seinem knochigen Gesicht wirkte das Lächeln geradezu ge-, spenstisch. »Das USAMRIID war bereit, uns Einblick in einige seiner Daten zu gewähren.« »Einige?« »Nicht alle. Ein großer Teil des Genoms ist immer noch Verschlusssache. Man hat uns nur Teile der Sequenz gegeben, mit großen Lücken dazwischen. Sie zeigen uns gerade eben genug, um zu beweisen, dass die Situation ernst ist.« Er ging mit dem Laptop zum Esszimmertisch und klappte ihn auf. Alle traten näher, um zuzusehen, wie Petrovitch den Computer startete und dann eine Diskette einlegte. Über den Bildschirm flossen Daten, Zeile um Zeile voller Buchstaben in scheinbar zufälliger Folge, die in Schwindel erregendem Tempo vorbeihuschten. Es war kein Text, denn aus diesen Buchstaben setzten sich keine Wörter zusammen, sondern ein Code. Die gleichen vier Buchstaben erschienen immer wieder in wechselnder Reihenfolge: A, T, G und C. Sie standen für die Nucleotide Adenin, Thymin, Guanin und Cytosin. Die Bausteine der DNS. Diese Kette von Buchstaben war ein Genom, der chemische Bauplan eines lebenden Organismus. »Dies hier«, sagte Petrovitch, »ist ihre Chimäre. Der Organismus, der Kenichi Hirai getötet hat.« »Was ist das denn eigentlich, diese Chimäre, von der alle dauernd reden?«, fragte Randy Carpenter. »Vielleicht könnten Sie das mal erklären, wenn auch nur uns ungebildeten Ingenieuren zuliebe.« »Gewiss«, erwiderte Petrovitch. »Und es gibt keinen Grund, sich deswegen ungebildet vorzukommen. Der Begriff wird außerhalb der Molekularbiologie nur selten verwendet. Er stammt aus der griechischen Mythologie. Die Chimäre war ein sagenhaftes, angeblich unbesiegbares Wesen; eine Feuer speiende Kreatur mit dem Kopf eines Löwen, dem Rumpf einer Ziege und dem Schwanz einer Schlange. Sie wurde schließlich von einem Helden namens Bellerophon erschlagen. Es war nicht, gerade ein fairer Kampf, denn er hat gemogelt. Er ließ sich von Pegasus, dem geflügelten Pferd, tragen und beschoss die Chimäre aus der Luft mit Pfeilen.« »Diese ganze Mythologie ist ja hochinteressant«, warf Carpenter ungeduldig ein, »aber was hat das alles mit der Sache hier zu tun?« »Die griechische Chimäre war ein bizarres Lebewesen, das aus drei verschiedenen Tieren zusammengesetzt war. Löwe, Ziege und Schlange, alle zu einem einzigen Tier verbunden. Genau so ein Fall liegt auch bei diesem Chromosom vor. Eine Kreatur, die nicht weniger bizarr ist als das Monster, das von Bellerophon getötet wurde. Wir haben es hier mit einer biologischen Chimäre zu tun, deren DNS von mindestens drei nicht miteinander verwandten Arten stammt.« »Können Sie diese Arten identifizieren?«, fragte Carpenter. Petrovitch nickte. »Im Laufe der Jahre haben Forscher in der ganzen Welt eine Bibliothek von Gensequenzen für eine Vielzahl von Arten zusammengetragen, von Viren bis hin zu Elefanten. Das Sammeln dieser Daten ist allerdings ein langsamer und mühsamer Prozess. Es hat Jahrzehnte gedauert, bis auch nur das menschliche Genom entschlüsselt war. Sie können sich also vorstellen, dass für eine ganze Reihe von Arten noch keine Gensequenzen vorliegen. Große Teile des Genoms dieser Chimäre können nicht identifiziert werden, weil sie noch nicht in der Bibliothek zu finden sind. Aber hier haben Sie diejenigen, die wir bisher identifizieren konnten.« Er klickte auf »Übereinstimmungen mit bekannten Arten«. Auf dem Monitor erschien: Mus musculis (Hausmaus) Rana pipiens (nördlicher Leopardfrosch) Homo sapiens »Dieser Organismus ist also teils Maus, teils Frosch und teils, Mensch.« Er machte eine Pause. »In gewisser Weise«, sagte er, »sind wir selbst der Feind.« Im Zimmer wurde es still. »Welches unserer Gene ist auf diesem Chromosom?«, fragte Jack leise. »Welcher Teil der Chimäre ist menschlich?« »Eine interessante Frage«, sagte Petrovitch mit anerkennendem Nicken. »Sie verdient eine interessante Antwort. Sie und Dr. Cutler werden die Bedeutung dieser Liste richtig einzu- schätzen wissen.« Er gab ein paar Befehle ein. Auf dem Monitor erschien eine Liste: Amylase Lipase Phospholipase A Trypsin Chymotrypsin Elastase Enterokinase »Mein Gott«, murmelte Todd Cutler. »Das sind alles Verdauungsenzyme.« Der Organismus ist darauf programmiert, seinen Wirt aufzufressen, dachte Jack. Er benutzt diese Enzyme, um uns von innen her zu verdauen, unsere Muskeln, unsere Organe und unser Bindegewebe zu einem stinkenden Brei zu zersetzen. »Jill Hewitt – sie hat gesagt, Hirais Leiche habe sich zersetzt«, sagte Randy Carpenter. »Ich dachte, sie hätte Halluzinationen.« Plötzlich sagte Jack: »Das muss ein biotechnisch hergestellter Organismus sein! Jemand hat dieses Ding in einem Labor zusammengebastelt. Hat ein Bakterium oder ein Virus genommen und ihm Gene anderer Arten eingepflanzt, um eine, effektivere Tötungsmaschine daraus zu machen.« »Aber welches Bakterium? Welches Virus?«, sagte Petrovitch. »Das ist das Rätsel, vor dem wir stehen. Solange wir nicht mehr von dem Genom untersuchen können, finden wir auch nicht heraus, welches die Ausgangsspezies war. Das USAMRIID wei- gert sich, uns den allerwichtigsten Teil des Chromosoms dieses Organismus zu zeigen. Den Teil, der den Killer identifiziert.« Er sah Jack an. »Sie sind der Einzige hier, der den patho- logischen Befund bei der Autopsie tatsächlich gesehen hat.« »Ich habe es nur flüchtig gesehen. Sie haben mich so schnell rausgeworfen, dass ich kaum etwas erkennen konnte. Was ich gesehen habe, sah wie eine Art Zyste aus. So groß wie Perlen und eingebettet in eine blaugrüne Matrix. Sie waren in Mercers Thorax und in seiner Bauchhöhle. Und in Hewitts Schädel. Ich habe so etwas noch nie zuvor gesehen.« »Könnte es sich um Hyatidenzysten gehandelt haben?«, fragte Petrovitch. »Was ist das?«, wollte Woody wissen. »Eine Infektion mit Larven eines parasitären Bandwurms namens Echinococcus. Sie führt zu Zystenbildung in Leber und Lungen. Oder in jedem beliebigen anderen Organ.« »Glauben Sie, es könnte sich um einen Parasiten handeln?« Jack schüttelte den Kopf. »Hyatidenzysten wachsen sehr langsam. Über Jahre, nicht innerhalb weniger Tage. Ich glaube nicht, dass es ein Parasit war.« »Vielleicht waren es überhaupt keine Zysten«, meinte Todd. »Vielleicht waren es Sporen. Schimmelpilze. Aspergillus oder Cryptococcus.« Liz Gianni von der Nutzlastenabteilung meldete sich zu Wort: »Die Crew hat über einen Fall von Pilzbefall berichtet. Eines der Experimente musste deswegen abgebrochen werden.« »Welches Experiment?«, fragte Todd., »Ich müsste nachsehen. Ich weiß nur, dass es eine der Zellkulturen war.« »Aber ein einfacher Pilzbefall würde diese Todesfälle nicht erklären«, sagte Petrovitch. »Vergessen Sie nicht, dass in der Mir ständig irgendwelche Schimmelpilze herumgeflogen sind, ohne dass jemand daran gestorben wäre.« Er blickte auf den Monitor. »Dieses Genom verrät uns, dass wir es mit einer völlig neuen Lebensform zu tun haben. Ich stimme mit Jack überein. Sie muss künstlich hergestellt worden sein.« »Dann ist es also Bioterrorismus«, sagte Woody Ellis. »Irgendjemand hat unsere Station sabotiert. Sie müssen das Zeug in einer der Nutzlasten an Bord geschmuggelt haben.« Liz Gianni schüttelte energisch den Kopf. Mit ihrer aggressiven und entschlossenen Art konnte sie eine Versammlung leicht dominieren, und sie sprach jetzt mit absoluter Überzeugung: »Jede Nutzlast geht durch die Sicherheitskontrolle. Es gibt Protokolle über potenzielle Gefahrstoffe und dreiphasige Analysen aller möglichen Kontaminationsquellen. Glauben Sie mir, etwas derart Gefährliches hätten wir auf keinen Fall zugelassen.« »Vorausgesetzt, Sie wussten, dass es gefährlich ist«, sagte Ellis. »Selbstverständlich wissen wir so etwas!« »Und wenn es eine Lücke im Sicherheitssystem gab?«, meinte Jack. »Viele experimentelle Nutzlasten kommen direkt von den wissenschaftlichen Leitern, also den Forschern selbst. Wir wissen nichts über deren Sicherheitsvorkehrungen. Wir wissen nicht, ob nicht in einem ihrer Labors vielleicht ein Terrorist beschäftigt ist. Wenn sie im letzten Moment eine Bakterienkultur vertauscht hätten, würden wir das auf jeden Fall bemerkt haben?« Zum ersten Mal wirkte Liz verunsichert. »So etwas … so etwas ist sehr unwahrscheinlich.« »Aber vorkommen könnte es.«, Sie wollte es nicht aussprechen, doch ihre Augen verrieten ihre Bestürzung. »Wir werden uns jeden wissenschaftlichen Leiter einzeln vorknöpfen«, sagte sie. »Jeden Forscher, der ein Experiment rauf geschickt hat. Wenn es bei denen einen Verstoß gegen die Sicherheitsvorkehrungen gegeben hat, werde ich es verdammt noch mal rausfinden.« Das wird sie wahrscheinlich, dachte Jack. Wie die anderen Männer im Raum hatte er ein kleines bisschen Angst vor Liz Gianni. »Es gibt eine Frage, die wir uns noch nicht gestellt haben«, meldete sich Gordon Obie zum ersten Mal zu Wort. Wie immer hatte er die Sphinx gespielt, hatte sich alles schweigend angehört und die Informationen im Stillen verarbeitet. »Die Frage lautet: Warum? Warum sollte irgendjemand die Station sabotieren? Hegt irgendwer einen Groll gegen uns? Vielleicht ein fanatischer Technikfeind?« »Das biologische Äquivalent des Unabombers«, meinte Todd Cutler. »Warum hat er den Organismus dann nicht einfach im JSC freigesetzt und damit unsere Infrastruktur lahm gelegt? Das wäre leichter und sehr viel logischer gewesen.« »Sie kommen einem Fanatiker nicht mit Logik bei«, gab Todd zu bedenken. »Man kann an alles und jeden mit Logik herangehen, auch an einen Fanatiker«, erwiderte Gordon. »Man muss nur wissen, in welchem Rahmen er sich bewegt. Und das ist es, was mich stört. Deshalb habe ich meine Zweifel, ob wir es tatsächlich mit Sabotage zu tun haben.« »Was sollte es denn sonst sein, wenn nicht Sabotage?«, fragte Jack. »Es gibt noch eine andere Möglichkeit. Es könnte etwas ebenso Erschreckendes sein«, sagte Gordon, indem er Jack besorgt anblickte. »Ein Irrtum.«, Dr. Isaac Roman lief den Flur entlang, während der Funkempfänger an seinem Gürtel unentwegt piepste. Er ahnte schon, welch schrecklicher Anblick ihn erwartete. Er stellte den Piepser ab und öffnete die Tür zum Quarantänetrakt. Statt das Zimmer des Patienten zu betreten, blieb er in sicherer Entfernung vor dem Beobachtungsfenster stehen und sah zu, wie das Entsetzen seinen Lauf nahm. Die Wände waren mit Blutspritzern übersät, und Blutlachen bildeten sich auf dem Boden, wo Dr. Nathan Heisinger sich in Krämpfen wand. Zwei Schwestern und ein Arzt, alle in Raumanzügen, versuchten ihn daran zu hindern, sich selbst zu verletzen, doch seine Zuckungen waren so heftig, dass sie ihn nicht unter Kontrolle bekamen. Sein Bein schlug aus, und eine der Schwestern stürzte und rutschte ein Stück über den blutverschmierten Beton. Roman drückte auf den Knopf der Gegensprechanlage. »Ihr Anzug! Ist er beschädigt?« Sie erhob sich langsam, und er konnte ihren entsetzten Gesichtsausdruck sehen. Sie betrachtete ihre Handschuhe und Ärmel und inspizierte die Anschlussstelle des Luftschlauchs. »Nein«, sagte sie, und es klang fast wie ein Schluchzer der Erleichterung. »Keine Beschädigungen.« Blut spritzte gegen das Fenster. Roman zuckte zurück, als die roten Tropfen an der Scheibe hinunterrannen. Heisinger schlug jetzt mit dem Kopf auf den Boden, während sich sein Rückgrat abwechselnd entspannte und überdehnte. Opisthotonus. Roman hatte diese bizarre Körperhaltung erst einmal gesehen, bei einem Opfer von Strychninvergiftung. Der Körper bog sich nach hinten wie ein überspannter Bogen. Heisinger verkrampfte sich erneut und krachte mit dem Hinterkopf auf. Blutspritzer benetzten die Visiere der beiden Schwestern. »Treten Sie zurück!«, befahl Roman., »Aber er verletzt sich doch!«, sagte der Arzt. »Ich will nicht, dass sich noch jemand infiziert.« »Wenn wir diese Krämpfe unter Kontrolle bekämen …« »Sie können nichts tun, um ihn zu retten. Ich will, dass Sie alle sofort zurücktreten. Bevor Sie verletzt werden.« Widerstrebend gehorchten die beiden Schwestern seiner Anordnung. Nach einer Weile schloss sich der Arzt ihnen an. Sie standen schweigend da und verfolgten das schreckliche Geschehen zu ihren Füßen. Wieder wurde Heisinger von Konvulsionen geschüttelt, und sein Kopf zuckte zurück. Die Kopfhaut platzte auf wie eine gerissene Stoffnaht. Die Blutlache wurde zum See. »O Gott, seht euch seine Augen an!«, rief eine der Schwestern. Heisingers Augen waren wie zwei riesige Murmeln; sie schienen aus ihren Höhlen springen zu wollen. Traumatische Proptosis, dachte Roman. Der enorm gestiegene Schädelinnen- druck presste die Augäpfel nach außen, sodass die Lider weit auseinander gezerrt wurden und der Blick vollkommen starr wurde. Die Krampfanfälle ließen nicht nach, und Heisinger schlug immer heftiger mit dem Kopf auf den Fußboden. Knochen- splitter flogen durch die Luft und tickten gegen die Scheibe. Es sah aus, als versuche er, seinen Schädel aufzubrechen, um das, was auch immer darin eingesperrt war, zu befreien. Ein weiterer krachender Schlag. Wieder spritzten Blut und Knochenfragmente durch die Luft. Er hätte längst tot sein müssen. Wieso gingen die Krämpfe weiter? Aber auch Hühner zucken und flattern noch weiter, nachdem ihnen der Kopf abgehackt wurde. Heisingers Todeskampf war noch nicht vorbei. Sein Kopf hob sich vom Boden, und sein Rückgrat bog sich durch wie eine Feder, die bis zum, Zerspringen angespannt ist. Dann schlug sein Hals wie eine Peitsche nach hinten aus. Ein fürchterliches Krachen, und sein Schädel zerplatzte wie ein Ei. Knochensplitter wirbelten umher. Ein Klumpen Hirnmasse klatschte gegen die Fensterscheibe. Roman stieß einen erstickten Schrei aus und wankte ein paar Schritte rückwärts. Übelkeit stieg ihm in die Kehle. Er ließ den Kopf hängen und kämpfte um seine Selbstbeherrschung. Kämpfte gegen die Dunkelheit an, die ihn einzuhüllen drohte. Schließlich gelang es ihm, den Kopf zu heben. Er schwitzte und zitterte am ganzen Leib. Einmal, ein einziges Mal noch, sah er durch das Fenster. Nathan Heisinger lag endlich reglos da. Was von seinem Kopf übrig war, ruhte in einem See von Blut. Überall war so viel Blut, dass Roman einen Moment lang nichts anderes sah als diese rote Lache, die sich immer weiter ausbreitete. Dann fiel sein Blick auf das Gesicht des toten Mannes. Auf die blaugrüne Masse, die wabbelnd an seiner Stirn hing. Zysten. Die Chimäre. 14. August »Nikolai? Nikolai, antworten Sie bitte!« »Mein Ohr … es ist in meinem Ohr …« »Tut es weh? Hast du Schmerzen im Ohr? Sieh mich an!« »Es kriecht tiefer rein! Hol es raus! Hol es …« Jared Profitt, der wissenschaftliche Berater des Weißen Hauses in Sicherheitsfragen, drückte die AUS-Taste des Kassetten- rekorders und sah in die Gesichter der um den Tisch versammelten Männer und Frauen. Alle waren von Entsetzen gezeichnet. »Was Nikolai Rudenko zugestoßen ist, war mehr als nur ein Dekompressionsunfall«, sagte er. »Deshalb haben wir so gehandelt. Und deshalb lege ich Ihnen allen dringend nahe, diesen, Kurs bis zum Ende durchzuhalten. Es steht zu viel auf dem Spiel. Solange wir nicht mehr über diesen Organismus wissen – wie er sich fortpflanzt, wie die Infektion vor sich geht –, können wir diese Astronauten nicht zur Erde zurückkehren lassen.« Die Reaktion war betroffenes Schweigen. Selbst der NASA- Verwaltungschef Leroy Cornell, der die Sitzung mit einem scharfen Protest gegen die Übernahme seiner Behörde eröffnet hatte, saß vollkommen sprachlos da. Es war der Präsident, der die erste Frage stellte: »Was genau wissen wir über diesen Organismus?« »Dr. Isaac Roman vom USAMRIID kann das besser beantworten als ich«, erwiderte Profitt und nickte Roman zu, der nicht am Tisch saß, sondern etwas abseits, wo er von den meisten Versammelten kaum bemerkt worden war. Jetzt stand er auf, damit sie ihn besser sehen konnten; ein hochgewachsener Mann mit angegrautem Haar, dem die Erschöpfung an den Augen abzulesen war. »Ich habe, fürchte ich, nicht viel Erfreuliches zu berichten«, sagte er. »Wir haben eine Reihe von Säugetieren mit der Chimäre infiziert, darunter Hunde und Klammeraffen. Innerhalb von sechsundneunzig Stunden waren alle Versuchstiere tot. Eine Sterblichkeitsrate von hundert Prozent.« »Und es gibt kein Gegenmittel? Der Organismus spricht auf nichts an?«, fragte der Verteidigungsminister. »Auf nichts. Das ist schon erschreckend genug, aber es kommt noch schlimmer.« Es wurde sehr still im Raum, und aus den Mienen sprach Angst. Was konnte noch schlimmer sein als das? »Wir haben die DNS-Analyse bei den jüngsten Generationen von Eiern wiederholt, die wir aus den toten Affen gewonnen hatten. Die Chimäre hat sich wieder ein neues Gencluster angeeignet, das charakteristisch für die Spezies Ateles geoffroyi ist. Den Klammeraffen.«, Der Präsident erbleichte. Er sah Profitt an. »Habe ich das richtig verstanden?« »Es ist verheerend«, sagte Profitt. »Jedes Mal, wenn diese Lebensform ihren Kreislauf durch einen Wirtsorganismus nimmt, jedes Mal, wenn sie eine neue Generation hervorbringt, scheint sie sich neue DNS anzueignen. So bleibt sie uns immer mehrere Schritte voraus, indem sie neue Gene erwirbt und damit neue Fähigkeiten, die sie vorher nicht besessen hat.« »Aber wie soll das denn funktionieren?«, fragte General Moray von den Vereinigten Stabschefs. »Ein Organismus, der neue Gene aufnimmt? Der sich unentwegt erneuert? Es klingt unmöglich.« Roman erwiderte: »Es ist nicht unmöglich, Sir. Ein solcher Vorgang ist in der Natur nicht unbekannt. Bakterien teilen oft Gene miteinander und tauschen sie aus, indem sie Viren als Kuriere benutzen. Nur so können sie so schnell resistent gegen Antibiotika werden. Sie verteilen einfach die Gene, die für die Resistenz verantwortlich sind, untereinander und fügen ihren Chromosomen neue UNS hinzu. Wie jedes Lebewesen benutzen sie jede ihnen zur Verfügung stehende Waffe, um zu überleben. Um ihre Art zu erhalten. Genau das tut auch dieser Organismus.« Er ging zum Kopfende des Tisches, wo eine vergrößerte elektronenmikroskopische Aufnahme aufgestellt war. »Auf dieser Fotografie der Zelle können Sie etwas erkennen, was wie winzige Körnchen aussieht. Das sind Zusammen- ballungen von Helferviren. Kuriere, die in die Wirtszelle eindringen, ihre DNS plündern und der Chimäre Bruchstücke von genetischem Material zuführen. So kann sie ihrem Arsenal neue Waffen in Form von Genen hinzufügen.« Roman sah den Präsidenten an. »Dieser Organismus ist so ausgestattet, dass er unter allen denkbaren Umweltbedingungen überleben kann. Er muss lediglich die DNS der regionalen Fauna plündern.« Der Präsident sah aus, als wäre ihm schlecht. »Er verändert, sich also immer noch. Entwickelt sich weiter.« In der Runde erhob sich bestürztes Murmeln. Angstvolle Blicke schossen hin und her, Stühle knarrten. »Was ist mit dem Arzt, der sich infiziert hat«, fragte eine Pentagon-Mitarbeiterin. »Ich meine den, der auf der Isolierstation des USAMRIID war. Lebt er noch?« Roman zögerte; sein Blick war gequält. »Dr. Heisinger ist letzte Nacht gestorben. Ich war dabei, als es zu Ende ging, und es war … ein grauenvoller Tod. Er bekam so heftige Krämpfe, dass wir nicht wagten, uns ihm zu nähern, aus Angst, ein Raumanzug könnte beschädigt und eine weitere Person infiziert werden. Etwas Ähnliches wie diese Anfälle habe ich noch nie gesehen. Es war, als ob alle Neuronen in seinem Gehirn zusammen ein gewaltiges elektrisches Gewitter ausgelöst hätten. Er hat das Gitter an seinem Bett abgebrochen – einfach so vom Rahmen abgeknickt. Er fiel heraus und begann … mit dem Kopf auf den Boden zu schlagen. So fest, dass wir …« – er schluckte – »… dass wir hören konnten, wie der Schädel brach. Inzwischen war alles voller Blut. Er schlug unaufhörlich mit dem Kopf auf den Boden, als versuche er seinen Schädel aufzubrechen. Um den Druck abzulassen, der sich im Inneren aufbaute. Das Trauma machte alles nur noch schlimmer, denn es kam zu Gehirnblutungen. Am Ende war der Schädelinnendruck so hoch, dass seine Augäpfel aus den Höhlen quollen. Es sah aus wie bei einer Zeichentrickfigur. Oder wie ein Tier, das auf der Straße überfahren wurde.« Er holte tief Luft. »Das«, fuhr er leise fort, »war dann das Ende.« »Jetzt verstehen Sie, was für eine Epidemie uns unter Umständen droht«, sagte Profitt. »Das ist der Grund, weshalb wir es uns nicht leisten können, schwach oder nachlässig zu sein. Oder sentimental.« Wieder war es lange Zeit still. Alle blickten auf den Präsidenten. Alle warteten – hofften – auf eine eindeutige, Entscheidung. Stattdessen drehte der Präsident seinen Sessel zum Fenster und starrte hinaus. »Ich wollte auch Astronaut werden, früher«, sagte er mit trauriger Stimme. Wollten wir das nicht alle?, dachte Profitt. Welches Kind in diesem Land hat nicht davon geträumt, einmal mit einer Rakete ins All zu fliegen? »Ich war dabei, als John Glenn mit dem Shuttle gestartet ist«, sagte der Präsident. »Und ich habe geweint. Genau wie alle anderen. Weiß der Teufel, ich habe geheult wie ein kleines Kind. Weil ich stolz auf ihn war. Und stolz auf dieses Land. Einfach nur stolz darauf, ein Mensch zu sein …« Er hielt inne. Holte tief Luft und wischte sich mit der Hand über die Augen. »Verdammt, wie käme ich dazu, diese Leute zum Tode zu verurteilen?« Profitt und Roman tauschten unglückliche Blicke. »Wir haben keine andere Wahl, Sir«, sagte Profitt. »Fünf Menschenleben stehen gegen weiß Gott wie viele hier unten auf der Erde.« »Sie sind Helden. Wahrhafte Helden. Und wir lassen sie da oben einfach verrecken.« »Aller Wahrscheinlichkeit nach könnten wir sie ohnehin nicht retten, Mr. President«, sagte Roman. »Sie sind vermutlich alle infiziert. Oder werden es bald sein.« »Dann besteht die Möglichkeit, dass einige von ihnen vielleicht nicht infiziert sind?« »Wir wissen es nicht. Wir wissen nur, dass Rudenko definitiv infiziert ist. Wir nehmen an, er hat sich während der Außenbordarbeiten im Raumanzug angesteckt. Wie Sie sich vielleicht erinnern, wurde der Astronaut Hirai vor zehn Tagen in der Ausrüstungsschleuse gefunden, als er bereits unter Krämpfen litt. Das würde erklären, wie es zur Kontaminierung, des Anzugs kommen konnte.« »Warum sind die anderen noch nicht erkrankt? Warum nur Rudenko?« »Unsere Forschungen haben ergeben, dass dieser Organismus eine gewisse Inkubationszeit benötigt, bevor er das Stadium der Infektiosität erreicht. Wir vermuten, dass die größte Ansteckungs- gefahr zum Zeitpunkt des Todes des Wirtes besteht, oder auch danach, wenn die Chimäre aus der Leiche austritt. Aber wir sind uns nicht sicher. Wir können uns keinen Irrtum leisten. Wir müssen davon ausgehen, dass sie alle Überträger sind.« »Dann halten Sie sie so lange streng isoliert, bis Sie es wissen. Aber bringen Sie sie wenigstens nach Hause.« »Sir, darin liegt gerade das Risiko«, sagte Profitt. »In diesem Nach-Hause-Bringen. Das CRV ist nicht wie das Shuttle, mit dem sie einen bestimmten Landeplatz anfliegen können. Die Astronauten würden in einem Raumfahrzeug zurückkehren, das kaum steuerbar ist. Im Grunde ist es nur ein Behälter mit eingebauten Fallschirmen. Wenn nun etwas schief geht? Wenn das CRV in der Atmosphäre beschädigt wird oder beim Landeanflug abstürzt? Dann wird dieser Organismus freigesetzt, und der Wind verteilt ihn in alle Himmelsrichtungen! Inzwischen hat er so viel menschliche DNS in seinem Genom, dass wir ihn nicht mehr bekämpfen können. Er gleicht uns zu sehr. Jedes Gift, das wir gegen ihn einsetzen, würde auch Menschen töten.« Profitt machte eine Kunstpause, um die Wirkung seiner Worte zu verstärken. »Wir können nicht zulassen, dass unsere Entscheidung von Emotionen beeinflusst wird. Nicht, wenn so viel auf dem Spiel steht.« »Mr. President«, meldete sich Leroy Cornell zu Wort, »dürfte ich mit allem gebotenen Respekt darauf hinweisen, dass dieser Schritt verheerende politische Konsequenzen hätte? Die Öffentlichkeit würde es uns nie verzeihen, wenn fünf Helden im, All sterben müssten.« »Die Politik sollte uns jetzt am allerwenigsten interessieren!«, sagte Profitt. »Unsere oberste Priorität ist die öffentliche Gesundheit!« »Warum dann diese Geheimhaltung? Warum haben Sie die NASA ausgeschlossen? Sie haben uns nur Teile des Genoms dieses Organismus sehen lassen. Unsere Biologen und Mediziner sind jederzeit bereit, ihr Fachwissen zur Verfügung zu stellen. Wir sind genauso wie Sie – ja noch mehr als Sie – daran interessiert, ein Gegenmittel zu finden. Wenn das USAMRIID uns sämtliche Daten zu Verfügung stellen würde, könnten wir zusammen an einer Lösung arbeiten.« »Unsere Sorge gilt der Sicherheit«, sagte General Moray. »Ein feindliches Land könnte aus diesem Organismus eine vernichtende biologische Waffe entwickeln. Den genetischen Code der Chimäre zu verraten hieße, den Bauplan für eine solche Waffe aus der Hand zu geben.« »Heißt das, Sie wollen der NASA solche Informationen nicht anvertrauen?« General Moray sah Cornell direkt in die Augen. »Ich fürchte, die Bereitwilligkeit, mit der die NASA neuerdings ihre Technologie mit jedem dahergelaufenen Land auf diesem Erdball teilt, macht sie zu einem gewissen Sicherheitsrisiko.« Cornell lief vor Zorn rot an, sagte jedoch nichts. Profitt sah den Präsidenten an. »Sir, es ist eine Tragödie, dass wir die fünf Astronauten ihrem Schicksal überlassen müssen. Aber wir müssen Weitblick beweisen und die Möglichkeit einer noch viel größeren Tragödie ins Auge fassen. Einer weltweiten Epidemie, verursacht durch einen Organismus, den wir gerade erst zu durchschauen beginnen. Das USAMRIID arbeitet rund um die Uhr, um herauszufinden, wie ihm beizukommen ist. Bis es so weit ist, lege ich Ihnen dringend nahe, den einmal eingeschlagenen Kurs einzuhalten. Die NASA hat nicht die, Mittel, einer biologischen Katastrophe zu begegnen. Sie hat nur einen einzigen Offizier für globale Schutzmaßnahmen. Einen. Das Biologische Einsatzkommando der Armee ist genau auf diese Art von Krise vorbereitet. Was die NASA-Operationen betrifft, sollte das US-Raumfahrtkommando weiterhin die Kontrolle behalten, gestützt von der Vierzehnten Air-Force-Division. Die NASA hat zu starke persönliche und emotionale Bindungen an die Astronauten. Wir brauchen eine starke Hand am Ruder. Wir brauchen absolute Disziplin.« Profitt sah sich unter den Männern und Frauen am Tisch um. Für die wenigsten von ihnen empfand er wirklich Respekt. Einige waren nur an Prestige und Macht interessiert. Andere hatten ihren Platz an diesem Tisch nur durch politische Beziehungen bekommen. Wieder andere ließen sich zu leicht durch die öffentliche Meinung beeinflussen. Nur wenige hatten so klare und einfache Motive wie er selbst. Nur wenige hatten die gleichen Albträume erlebt wie er, waren schweißgebadet in der Dunkelheit erwacht, bis ins Mark erschüttert von Bildern der drohenden Katastrophe. »Das heißt im Grunde, dass die Astronauten nie mehr zurückkehren können«, sagte Cornell. Profitt blickte in das aschfahle Gesicht des NASA- Verwaltungschefs und empfand echtes Mitgefühl. »Wenn wir ein Gegenmittel gefunden haben, wenn wir wissen, wie wir diesen Organismus vernichten können, dann können wir darüber reden, Ihre Leute nach Hause zu holen.« »Wenn sie dann noch am Leben sind«, murmelte der Präsident. Profitt und Roman sahen einander an, doch keiner von beiden antwortete. Sie hatten das Offensichtliche schon begriffen. Sie würden das Gegenmittel nicht rechtzeitig finden. Die Astronauten würden nicht lebend zurückkehren., Jared Profitt trug auch an diesem glühend heißen Tag Jackett und Krawatte. Die Hitze spürte er kaum. Andere mochten sich über die Torturen eines Washingtoner Sommers beklagen, ihm machten die extrem hohen Temperaturen nichts aus. Es war der Winter, den er fürchtete, weil er die Kälte so schlecht vertrug. An Frosttagen bekam er blaue Lippen und zitterte noch unter mehreren Schichten von Pullovern und Schals. Selbst im Sommer hatte er im Büro immer einen Pullover dabei, um sich vor der Klimaanlage zu schützen. Heute war es weit über dreißig Grad, und die Gesichter, die ihm auf der Straße begegneten, glänzten vor Schweiß; er aber zog weder das Jackett aus, noch hielt er es für nötig, den Schlips zu lockern. Seit dieser Sitzung war ihm kalt bis in die Knochen und bis in die Tiefe seiner Seele. Er hatte sein Mittagessen dabei, verpackt in eine braune Papiertüte; genau das gleiche Essen, das er jeden Morgen mit zur Arbeit nahm. Der Weg, den er ging, war auch derselbe wie immer, in westlicher Richtung auf den Potomac zu, der Reflecting Pool zu seiner Linken. Die Routine, die vertrauten Abläufe, wirkten beruhigend auf ihn. Es gab dieser Tage nur wenige Dinge in seinem Leben, die ihm ein Gefühl der Sicherheit vermittelten. Und je älter er wurde, desto mehr hielt er an bestimmten Ritualen fest, so wie ein Mönch im Kloster, der dem täglichen Rhythmus von Arbeit, Gebet und Meditation folgt. In vielerlei Hinsicht war er wie diese Asketen vergangener Tage; ein Mensch, der nur aß, weil sein Körper es verlangte, und der nur deshalb Anzüge trug, weil es von ihm verlangt wurde. Ein Mann, dem Reichtum nichts bedeutete. Der Name Profitt hätte nicht weiter von der Lebens- wirklichkeit des Mannes entfernt sein können. Er verlangsamte seinen Schritt, als er den leicht abfallenden Rasen vor der Gedenkstätte für den Vietnamkrieg überquerte, und blickte auf die Besucher, die in einer feierlichen Prozession an der Mauer mit den Namen der Toten vorbeidefilierten. Er, wusste, was sie dachten, wenn sie vor diesen schwarzen Granittafeln standen und über die Schrecken des Krieges nachdachten: So viele Namen. So viele Tote. Und er dachte: Ihr habt ja keine Ahnung. Er fand eine freie Bank im Schatten und setzte sich hin, um zu essen. Aus seiner braunen Tüte holte er einen Apfel, ein Stück Cheddar und eine Flasche Wasser. Weder Evian noch Perrier, sondern schlichtes Leitungswasser. Er aß langsam, während er die Touristen beobachtete, die von einer Gedenkstätte zur Nächsten pilgerten. So ehren wir unsere Kriegshelden, dachte er. Statuen wurden errichtet, Namen in Marmortafeln geritzt, Flaggen gehisst. Man erschauderte beim Gedanken an die Anzahl der Menschen, die im Schlachthaus des Krieges auf beiden Seiten ihr Leben gelassen hatten. Zwei Millionen tote Soldaten und Zivilisten in Vietnam. Fünfzig Millionen Tote im Zweiten Weltkrieg. Einundzwanzig Millionen Tote im Ersten Weltkrieg. Die Zahlen waren erschütternd. Die Leute fragten sich vielleicht: Kann der Mensch einen schlimmeren Feind haben als sich selbst? Die Antwort lautete: Ja. Obwohl die Menschen den Feind nicht sehen konnten, waren sie von ihm umzingelt. Er war in ihnen – in der Luft, die sie atmeten, in allem, was sie aßen und tranken. Er war seit jeher der Fluch der Menschheit, und er würde weiterleben, wenn sie längst vom Antlitz der Erde verschwunden war. Der Feind war die Welt der Kleinstlebewesen – der Mikroben, die im Laufe der Jahrhunderte mehr Menschen getötet hatten als alle Kriege zusammen. Von 542 bis 767 nach Christus vierzig Millionen Pesttote bei der Justinianischen Pandemie. Im vierzehnten Jahrhundert wiederum fünfundzwanzig Millionen Opfer des Schwarzen Todes. Zwischen 1918 und 1919 dreißig Millionen Todesopfer bei der, Grippeepidemie. Und 1997 Amy Sorensen Profitt, gestorben an Pneumokocken- pneumonie im Alter von dreiundvierzig Jahren. Er aß seinen Apfel zu Ende, tat den Butzen in die Tüte und rollte alles zu einem ordentlichen Bündel zusammen. Trotz des frugalen Mahls fühlte er sich gesättigt. Er blieb noch eine Weile auf der Bank sitzen, während er die letzten Schlucke aus der Wasserflasche trank. Eine Touristin ging vorbei, eine Frau um die vierzig mit hellbraunem Haar. Als sie sich zufällig umdrehte und das Licht schräg auf ihr Gesicht fiel, sah sie aus wie Amy. Sie spürte, dass er sie anstarrte, und sah zu ihm hin. Einen Moment lang schauten sie einander in die Augen; sie mit misstrauischer, er mit entschuldigender Miene. Dann ging sie weiter, und er kam zu dem Schluss, dass sie Amy eigentlich gar nicht ähnlich sah. Niemand sah so aus wie sie. Das war unmöglich. Er stand auf, warf seinen Müll in einen Abfalleimer und ging den Weg zurück, den er gekommen war. Vorbei an der Mauer. Vorbei an den uniformierten Veteranen mit ihrem inzwischen ergrauten und etwas ungepflegten Haar. Sie hielten Wache, hielten die Erinnerung an die Toten lebendig. Aber auch Erinnerungen verblassen, dachte er. Ihr Bild, wie sie ihn über den Küchentisch hinweg angelächelt hatte, das Echo ihres Lachens – all das schwand mit der Zeit dahin. Nur die schmerzlichen Erinnerungen blieben lebendig. Ein Hotelzimmer in San Francisco. Ein Anruf mitten in der Nacht. Ein wirrer Bilderreigen von Flughäfen, Taxis und Telefonzellen – wie er vom einen Ende des Landes zum anderen gehetzt war, um rechtzeitig das Bethesda-Krankenhaus zu erreichen. Aber nekrotisierende Streptokokken kümmert das alles nicht, sie folgen ihrem eigenen tödlichen Zeitplan. Genau wie die Chimäre. Er tat einen Atemzug und fragte sich, wie viele Viren, wie, viele Bakterien, wie viele Sporen wohl gerade in seine Lungen gewirbelt waren. Und welche davon ihn vielleicht töten würden., 15. August »Wenn ihr mich fragt, die können uns mal«, sagte Luther. Die Funkverbindung zur Erde war ausgeschaltet, sodass die Bodenkontrolle ihre Unterhaltung nicht verfolgen konnte. »Wir gehen einfach zurück in das CRV, drücken auf die Knöpfe, und weg sind wir. Sie können uns schließlich nicht zwingen, umzukehren.« Sobald sie von der Station abgelegt hatten, konnten sie gar nicht mehr umkehren. Das CRV war im Grunde nur ein Raumgleiter mit Bremsfallschirmen. Nach der Abtrennung von der ISS konnte es maximal vier Umdrehungen um die Erde fliegen, bevor es gezwungen war, die Umlaufbahn zu verlassen und zu landen. »Man hat uns angewiesen, uns nicht von der Stelle zu rühren«, sagte Griggs. »Und daran werden wir uns halten.« »Wir sollen so einem bescheuerten Scheißbefehl folgen? Nikolai stirbt, wenn wir ihn nicht nach Hause schaffen!« Griggs sah Emma an: »Ihre Meinung, Watson?« Die letzten vierundzwanzig Stunden hatte Emma an der Seite ihres Patienten verbracht und ihn genau beobachtet. Sie konnten mit eigenen Augen sehen, dass sein Zustand kritisch war. Zuckend und zitternd lag er festgeschnallt auf dem Unter- suchungstisch, und manchmal schlugen seine Arme und Beine so heftig aus, dass Emma befürchtete, er könnte sich die Knochen brechen. Er sah aus wie ein Boxer, der nach einer gnadenlosen Abreibung aus dem Ring getragen wird. Subkutane Emphyseme hatten die Weichteile seines Gesichts aufquellen lassen; die, Augenlider waren zugeschwollen. Durch die engen Schlitze schimmerte das leuchtende, dämonische Rot seiner Lederhäute. Sie wusste nicht, wie viel Nikolai hörte oder verstand, und wagte deshalb nicht laut auszusprechen, was sie dachte. Sie bedeutete ihren Kollegen, mit ihr das russische Modul zu verlassen. Sie versammelten sich im Wohnmodul, wo Nikolai sie nicht hören konnte und sie ohne Bedenken ihre Schutzbrillen und Atemmasken ablegen konnten. »Houston muss unsere Evakuierung sofort freigeben«, sagte sie, »sonst verlieren wir ihn.« »Sie sind sich dessen durchaus bewusst«, erwiderte Griggs. »Sie können aber keine Evakuierung einleiten, solange sie nicht vom Weißen Haus genehmigt ist.« »Dann sollen wir also hier rumhängen und zugucken, wie wir alle krank werden?«, meinte Luther. »Und wenn wir uns einfach ins CRV setzen und abhauen? Was wollen sie denn dann machen – uns vielleicht abschießen?« Diana sagte leise: »Das könnten sie tun.« Die Wahrheit dessen, was sie gerade ausgesprochen hatte, ließ sie verstummen. Alle Astronauten, die je in ein Shuttle gestiegen waren und einen Countdown durchgestanden hatten, wussten genau, dass in einem Bunker im JSC ein Team von Air-Force- Offizieren saß, dessen einzige Aufgabe darin bestand, das Shuttle abzuschießen und die Crew in einen Haufen Asche zu verwandeln. Sollte während des Landeanflugs das Steuerungs- system versagen, sollte das Shuttle durch einen katastrophalen Fehler auf ein dicht besiedeltes Gebiet zurasen, war es die Pflicht dieser Sicherheitsoffiziere, auf den ominösen Knopf zu drücken. Sie hatten alle Crewmitglieder persönlich kennen gelernt; sie hatten wahrscheinlich Fotos von den Familien der Astronauten gesehen. Sie wussten ganz genau, wen sie töteten. Es war eine furchtbare Verantwortung, doch niemand zweifelte, daran, dass diese Air-Force-Offiziere ihrer Verpflichtung nachkommen würden. So wie sie auch mit an Sicherheit grenzender Wahrscheinlichkeit das CRV zerstören würden, sollten sie den Befehl dazu erhalten. Angesichts der Bedrohung durch eine neue und tödliche Epidemie fiel das Leben von fünf Astronauten kaum ins Gewicht. Luther sagte: »Ich wette, sie lassen uns in Ruhe landen. Warum denn nicht? Vier von uns sind noch gesund. Wir haben uns nichts gefangen.« »Aber wir waren dem Erreger ausgesetzt«, erwiderte Diana. »Wir haben dieselbe Luft geatmet und dasselbe Quartier geteilt. Luther, Sie und Nikolai haben zusammen in dieser Druckschleuse übernachtet.« »Ich fühle mich vollkommen gesund.« »Ich auch, und Griggs und Watson ebenso. Aber wenn es sich um eine Infektion handelt, könnten wir bereits in der Inkubationsphase sein.« »Deshalb müssen wir uns an die Befehle halten«, sagte Griggs. »Wir bleiben, wo wir sind.« Luther wandte sich an Emma. »Machst du diese Märtyrer- Scheiße etwa auch mit?« »Nein«, antwortete sie. »Das tue ich nicht.« Griggs sah sie verblüfft an. »Watson?« »Ich denke dabei nicht an mich«, sagte Emma. »Ich denke an meinen Patienten. Nikolai kann nicht sprechen, also muss ich es für ihn tun. Ich will, dass er in ein Krankenhaus kommt, Griggs.« »Sie haben gehört, was Houston gesagt hat.« »Was ich gehört habe, war widersprüchlich und konfus. Zuerst wird die Evakuierung angeordnet, dann wird sie verschoben. Zuerst sagen sie uns, es handle sich um Marburg, dann wieder, heißt es, es sei überhaupt kein Virus, sondern irgendein neuer, von Bioterroristen zusammengebastelter Organismus. Ich habe keinen blassen Schimmer, was da unten eigentlich vor sich geht. Ich weiß nur, dass mein Patient …« Sie senkte unvermittelt die Stimme. »Er ist todkrank«, fuhr sie leise fort. »Und meine oberste Pflicht ist es, ihn am Leben zu halten.« »Und meine Pflicht ist es, als Kommandeur dieser Station zu handeln«, entgegnete Griggs. »Ich muss davon ausgehen, dass Houston die Operation nach bestem Wissen und Gewissen leitet. Sie würden uns nicht in diese Gefahr bringen, wenn die Situation nicht sehr ernst wäre.« Emma konnte ihm nicht widersprechen. In der Bodenkontrolle saßen nur Leute, die sie kannte; Leute, denen sie vertraute. Und Jack ist dort, dachte sie. Keinem Menschen auf der Welt vertraute sie mehr als ihm. »Sieht aus, als hätten wir Post von unten«, sagte Diana mit einem Blick auf den Computerbildschirm. »Das ist für Watson.« Emma schwebte durch das Modul, um die Nachricht zu lesen, die auf dem Monitor aufleuchtete. Sie kam von der Lebenswissenschaftlichen Abteilung der NASA. Dr. Watson, wir sind der Meinung, Sie sollten erfahren, womit genau Sie es zu tun haben – womit wir alle es zu tun haben. Dies ist die DNS-Analyse des Organismus, der Kenichi Hirai infiziert hat. Emma rief die angehängte Datei auf. Sie brauchte eine Weile, um die Nucleotidsequenz, die über den Bildschirm flimmerte, zu interpretieren. Und noch weitere ein oder zwei Minuten, um zu glauben, was daraus folgte. Auf einem Chromosom saßen Gene von drei verschiedenen Spezies. Leopardfrosch. Maus. Und Mensch., »Was ist das für ein Organismus?«, fragte Diana. Emma antwortete leise: »Eine neue Lebensform.« Ein frankensteinsches Monster. Eine Abscheulichkeit der Natur. Ihr Blick fiel plötzlich auf das Wort »Maus«, und sie dachte: Die Mäuse im Labor. Sie sind als Erste erkrankt. Im Laufe der vergangenen anderthalb Wochen waren noch weitere gestorben. Als sie das letzte Mal nachgesehen hatte, war nur noch ein Tier, ein Weibchen, am Leben gewesen. Sie verließ das Wohnmodul und drang tiefer in den stillgelegten Teil der Station ein. Das US-Labor lag in fast völliger Dunkelheit. Sie schwebte zum Tierhabitat. Waren die Mäuse die ursprünglichen Träger des Organismus, mit denen die Chimäre an Bord der ISS gelangt war? Oder waren sie nur zufällig zu Opfern geworden, infiziert durch irgendeine andere Quelle? Und war die letzte Maus noch am Leben? Sie öffnete das Schubfach und starrte auf die einzige verbliebene Bewohnerin des Käfigs. Was sie sah, ließ ihren Mut sinken. Die Maus war tot. Sie hatte dieses Weibchen mit dem angeknabberten Ohr schon für eine Kämpferin gehalten, eine Überlebenskünstlerin, die durch ihre schiere Zähigkeit länger durchgehalten hatte als ihre Käfiggenossen. Sie wurde von einem Gefühl der Trauer überrascht, als sie den leblosen Körper betrachtete, der in der hinteren Ecke des Käfigs schwebte. Der Bauch der Maus sah bereits angeschwollen aus. Sie würde den Kadaver sofort aus dem Käfig entfernen und entsorgen müssen. Sie koppelte den Käfig mit dem Handschuhkasten, steckte die Hände durch die Öffnungen und griff nach der Maus. In dem Moment, als sich ihre Finger um den kleinen Körper schlossen, erwachte er zappelnd zu neuem Leben. Emma stieß einen überraschten Schrei aus und ließ das Tier los., Die Maus machte eine rasche Drehung und starrte sie wütend an. Die Härchen an ihrer Schnauze zitterten vor Erregung. Emma lachte irritiert auf. »Du bist also doch nicht tot«, murmelte sie. »Watson!« Sie drehte sich zur Bordsprechanlage um, aus der gerade ihr Namen erklungen war. »Ich bin im Labor.« »Kommen Sie sofort ins RSM! Nikolai hat einen Anfall.« Sie schoss aus dem Labor und eilte auf das russische Modul zu, wobei sie in der Dunkelheit immer wieder gegen die Wände stieß. Das Erste, was sie sah, als sie in das Modul hineintauchte, waren die Gesichter ihrer Mitastronauten, deren entsetzte Mienen auch durch die Schutzbrillen hindurch zu erkennen waren. Dann machten sie Platz, und Emma erblickte Nikolai. Sein linker Arm wurde von krampfhaften Zuckungen ge- schüttelt, die so heftig waren, dass der ganze Untersuchungstisch bebte. Die Krämpfe wanderten an seiner linken Körperseite entlang, und sein Bein schlug ebenfalls aus. Jetzt begann sein Becken auf und ab zu rucken. Unaufhaltsam zog sich der Krampfanfall durch seinen ganzen Körper. Die unkontrollierten Bewegungen wurden immer stärker, und die Riemen scheuerten seine Handgelenke blutig. Plötzlich hörte Emma ein widerliches Krachen: Die Knochen seines linken Unterarms waren gebrochen. Der rechte Handgelenkriemen riss, und der befreite Arm begann wild um sich zu schlagen; immer wieder krachte er mit dem Handrücken gegen die Tischkante, bis das Blut spritzte und die Knochen zersplitterten. »Haltet ihn fest! Ich pumpe ihn mit Valium voll!«, schrie Emma, während sie hektisch im Medizinschrank wühlte. Griggs und Luther packten Nikolai von beiden Seiten, doch selbst Luther war nicht stark genug, um Nikolais von der Fessel befreiten Arm zu bändigen. Er schoss wie eine Peitsche nach oben und versetzte Luther einen Schlag, der ihn zur Seite, schleuderte. Luthers Fuß traf Diana an der Wange und schlug ihr die Schutzbrille von der Nase. Plötzlich krachte Nikolai mit dem Hinterkopf auf den Tisch. Er rang gurgelnd nach Luft, und sein Brustkorb blähte sich auf. Dann hustete er einmal heftig. Schleim spritzte ihm aus dem Mund und traf Diana im Gesicht. Sie heulte angewidert auf, ließ Nikolai los und wischte sich das ungeschützte Auge, während sie vom Tisch wegtrieb. Ein Tropfen blaugrünen Schleims schwebte an Emma vorbei. Eingeschlossen in die gallertartige Masse war ein perlenartiger Kern. Erst als der Tropfen vor einem Leuchtkörper vorüberzog, dämmerte es Emma, was sie da sah. Wenn man ein Hühnerei vor eine Kerzenflamme hält, kann man durch die Schale hindurch den Inhalt erkennen. In ähnlicher Weise drang das künstliche Licht jetzt durch die normalerweise undurchsichtige Membran. Im Innern des Tropfens bewegte sich etwas. Etwas Lebendiges. Der Herzalarm heulte auf. Emma wirbelte herum und sah, dass Nikolai nicht mehr atmete. Über den Monitor zog eine flache Linie. 16. August Jack zog sich die Sprechkombination über den Kopf. Er war allein in einem Nebenraum der Bodenkontrolle, und das Funkgespräch sollte angeblich vertraulich sein, dennoch wusste er, dass seine heutige Unterhaltung mit Emma nicht wirklich privat war. Er hatte den Verdacht, dass die Air Force und das US-Raumfahrtkommando inzwischen alle Funkverbindungen zur ISS überwachten. Er sagte: »Capcom, hier Surgeon. Bin bereit für private, Konferenzschaltung.« »Roger, Surgeon«, erwiderte der Capcom. »Bodenkontrolle, stellen Sie Verbindung zur Station her.« Eine Pause trat ein, dann fuhr er fort: »Surgeon, Sie können mit der Konferenz beginnen.« Jacks Herz klopfte heftig. Er holte tief Luft und sagte: »Emma, ich bin’s.« »Er hätte überleben können, wenn wir ihn runtergebracht hätten«, hörte er Emma sagen. »Er hätte vielleicht eine Chance gehabt.« »Wir waren doch nicht diejenigen, die die Evakuierung abgebrochen haben! Die Entscheidungen der NASA sind ein ums andere Mal aufgehoben worden. Wir haben alles darangesetzt, euch so bald wie möglich nach Hause zu bringen. Wenn ihr nur durchhaltet …« »Es wird zu spät sein, Jack.« Sie sagte es ganz ruhig. Sachlich. Ihre Worte ließen ihm das Blut in den Adern gefrieren. »Diana ist infiziert«, sagte sie. »Bist du sicher?« »Ich habe gerade ihren Amylasespiegel gemessen. Er steigt an. Wir warten auf die ersten Symptome. Das Zeug ist überall im Modul herumgeflogen. Inzwischen haben wir alles aufgewischt, aber wir wissen nicht, wer noch etwas abgekriegt hat.« Sie machte eine Pause, und Jack hörte ihren zitternden Atem. »Erinnerst du dich an diese Dinger, die du in Andys und Jills Körper gesehen hast? Die du für Zysten gehalten hast? Ich habe eins davon unter dem Mikroskop seziert und gerade eben die Aufnahmen an die Lebenswissenschaften gemailt. Es sind keine Zysten, Jack. Und auch keine Sporen.« »Was ist es denn dann?« »Es sind Eier. Da ist irgendetwas drin. Da wächst etwas.« »Wächst? Willst du damit sagen, es sind Mehrzeller?«, »Ja. Genau das will ich damit sagen.« Er war wie vor den Kopf gestoßen. Er hatte geglaubt, sie hätten es mit einer Mikrobe zu tun, mit nichts Größerem als einer einzelligen Bakterie. Die tödlichsten Feinde der Menschheit waren immer schon Mikroben – Bakterien, Viren und Protozoen, allesamt zu klein für das menschliche Auge. Wenn die Chimäre mehrzellig war, war sie wesentlich höher entwickelt als alle diese Mikroben. »Das, was ich unter dem Mikroskop hatte, war noch nicht ausgebildet«, sagte sie. »Es sah am ehesten wie ein – wie ein Zellhaufen aus. Allerdings mit Gefäßbahnen. Und Kontraktions- bewegungen. Als ob das Ganze pulsierte, wie eine Kultur von Herzmuskelzellen.« »Vielleicht war es eine Kultur. Eine Zusammenballung von einzelnen Zellen.« »Nein. Nein, ich glaube, dass es ein einziger Organismus war. Und er war noch jung, in der Entwicklung begriffen.« »Und wo würde diese Entwicklung hinführen?« »Das USAMRIID weiß es«, erwiderte sie. »Diese Dinger sind in Kenichi Hirais Leiche herangewachsen. Sie haben seine Organe verdaut. Als sein Körper sich zersetzt hat, müssen sie den ganzen Orbiter voll gespritzt haben.« Den das Militär dann sofort unter Quarantäne gestellt hat, dachte Jack und erinnerte sich an die Hubschrauber und an die Männer in Raumanzügen. »Sie wachsen auch in Nikolais Leiche.« »Werft sie über Bord, Emma! Ihr dürft keine Zeit verlieren.« »Wir sind ja schon dabei. Luther ist gerade damit beschäftigt, die Leiche durch die Druckschleuse nach draußen zu befördern. Wir müssen darauf hoffen, dass das Vakuum im Weltraum dieses Ding abtötet. Es ist ein historisches Ereignis, Jack. Die erste Beisetzung im All.« Sie lachte verstört, verstummte aber, gleich darauf wieder. »Hör zu«, sagte er. »Ich bringe dich nach Hause. Und wenn ich mich selbst auf eine Rakete hocken muss, um dich da oben abzuholen.« »Sie werden uns nicht landen lassen. Das ist mir inzwischen klar.« Er hatte noch nie eine solche Resignation in ihrer Stimme gehört, und es machte ihn wütend. Verzweifelt flehte er sie an: »Bitte kneif jetzt nicht, Emma!« »Ich bin nur realistisch. Ich habe den Feind gesehen, Jack. Die Chimäre ist eine komplexe, mehrzellige Lebensform. Sie bewegt sich. Sie pflanzt sich fort. Sie setzt unsere DNS, unsere Gene gegen uns ein. Wenn das ein biotechnisch hergestellter Organismus ist, dann hat irgendein Terrorist damit die perfekte Waffe geschaffen.« »Dann muss er auch ein Gegenmittel entwickelt haben. Niemand lässt eine neue Waffe auf die Menschheit los, ohne zu wissen, wie er sich selbst dagegen schützen kann.« »Ein Fanatiker schon. Ein Terrorist, dem es nur darum geht, Menschen zu töten – viele Menschen. Und dieses Ding wäre dazu in der Lage. Es tötet nicht nur, es vermehrt sich auch. Es breitet sich aus.« Sie machte eine Pause, und als sie wieder sprach, klang ihre Stimme erschöpft. »Angesichts dieser Fakten ist es ja wohl klar, dass wir nicht nach Hause können.« Jack nahm die Sprechkombination ab und vergrub den Kopf in den Händen. Lange Zeit saß er allein in dem Raum, während Emmas Stimme ihm noch in den Ohren klang. Ich weiß nicht, wie ich dich retten soll, dachte er. Ich weiß nicht mal, womit ich anfangen soll. Er hörte nicht, wie die Tür geöffnet wurde. Erst als Liz Gianni ihn ansprach, blickte er auf., »Wir haben einen Namen«, sagte sie. Er schüttelte verwirrt den Kopf. »Was?« »Ich sagte Ihnen doch, ich würde nachsehen, welches Experiment wegen Pilzbefall abgebrochen wurde. Es hat sich herausgestellt, dass es eine Zellkultur war. Die wissenschaftliche Leiterin ist eine gewisse Dr. Helen Koenig, eine Meeresbiologin drüben in Kalifornien.« »Und was sagt sie dazu?« »Sie ist verschwunden. Sie hat vor zwei Wochen bei SeaScience gekündigt, wo sie im Labor gearbeitet hatte. Seither hat niemand mehr etwas von ihr gehört. Und jetzt kommt der Hammer, Jack. Ich habe gerade mit jemand von SeaScience gesprochen. Die Frau sagte mir, das FBI hätte am neunten August Koenigs Labor gefilzt. Sie haben alle ihre Aufzeichnungen mitgenommen.« Jack setzte sich auf. »An welchem Experiment hat Koenig gearbeitet? Was war das für eine Zellkultur, die sie zur ISS geschickt hat?« »Eine Art einzelliger Meeresorganismen. Sie heißen Archäen.«, »Es war als dreimonatiges Protokoll angelegt«, sagte Liz. »Eine Studie über das Fortpflanzungsverhalten von Archäen in der Mikrogravitation. Die ersten Ergebnisse waren verblüffend. Rapides Wachstum, Verklumpung. Die Kultur hat sich in erstaunlichem Tempo vermehrt.« Sie gingen einen der Pfade, die sich durch den Park wanden, des JSC entlang, vorbei an einem Teich mit einem Spring- brunnen, der eine Wasserfontäne in die reglose Luft spritzte. Es war unangenehm heiß und drückend, aber sie fühlten sich sicherer, wenn sie sich draußen unterhielten; hier hatten sie wenigstens die Gewissheit, dass niemand mithörte. »Zellen zeigen im Weltraum ein verändertes Verhalten«, sagte Jack. Das war auch der eigentliche Grund, weshalb man Zell- kulturen im Orbit anlegte. Auf der Erde breitet sich ein Gewebe vollkommen flach über den Kulturträger aus. Im Weltraum dagegen erlaubt die Schwerelosigkeit dem organischen Material dreidimensionales Wachstum, wodurch es Formen annehmen kann, die auf der Erde nie möglich wären. »Angesichts dieser aufregenden Entwicklungen ist es schon merkwürdig, dass das Experiment nach sechseinhalb Wochen so abrupt abgebrochen wurde«, sagte Liz. »Wer hat den Abbruch angeordnet?«, fragte Jack. »Die Anweisung kam direkt von Helen Koenig. Offenbar hat sie die Archäenproben analysiert, die mit der Atlantis zur Erde zurückgebracht worden waren, und dabei festgestellt, dass sie von Pilzen befallen waren. Daraufhin hat sie die Vernichtung der Kultur an Bord der ISS angewiesen.« »Und ihre Anordnung wurde befolgt?« »Ja. Das Sonderbare ist nur die Art, wie die Kultur zerstört, wurde. Die Crew durfte sie nicht einfach in einen Abfallbeutel stecken und sie zum kontaminierten Feuchtabfall tun, was man normalerweise bei ungefährlichen Organismen macht. Nein, Koenig verlangte von ihnen, die Kulturen im Verbrennungsofen einzuäschern und die Asche anschließend über Bord zu werfen.« Jack blieb mitten auf dem Pfad stehen und starrte Liz an. »Wenn Dr. Koenig eine Bioterroristin ist, warum sollte sie dann ihre eigene Waffe vernichten?« »Das dürfen Sie mich nicht fragen.« Er dachte eine Weile darüber nach, versuchte, dem Ganzen einen Sinn abzugewinnen, doch er gelangte zu keiner brauchbaren Antwort. »Erzählen Sie mir mehr von ihrem Experiment«, sagte er. »Was genau ist ein Archäon?« »Ich habe mit Petrovitch die Fachliteratur gewälzt. Die Archaea sind eine absonderliche Art von einzelligen Organismen, die auch als ›Extremophile‹ bekannt sind; das heißt, sie lieben extreme Umweltbedingungen. Sie wurden erst vor zwanzig Jahren entdeckt. Diese Organismen leben – und gedeihen – in der Nähe kochend heißer Vulkanspalten am Meeresboden, und man hat sie auch im ewigen Eis der Polkappen und in Felsformationen tief unter der Erdkruste gefunden. An Orten, von denen wir geglaubt hatten, dort sei kein Leben möglich.« »Sie sind also eine Art äußerst widerstandsfähiger Bakterien?« »Nein, sie bilden einen völlig eigenständigen Zweig des Lebens. Ihr Name bedeutet wörtlich ›uralt‹. Sie sind so alt, dass ihre Ursprünge bis zu den Urformen des Lebens überhaupt zurückreichen. Noch vor der Entstehung der ersten Bakterien. Archäen gehörten zu den ersten Bewohnern unseres Planeten, und sie werden vermutlich die letzten Überlebenden sein. Ganz gleich, was geschieht – sei es ein Atomkrieg oder ein Asteroideneinschlag –, sie werden noch hier sein, wenn wir, längst aufgehört haben zu existieren.« Sie machte eine Pause. »In gewisser Weise sind sie die eigentlichen Eroberer der Erde.« »Sind sie infektiös?« »Nein. Für den Menschen sind sie harmlos.« »Dann sind sie nicht unser Killerorganismus.« »Und wenn nun etwas anderes in der Kultur war? Wenn sie einen anderen Organismus hineingeschmuggelt hat, kurz bevor sie uns die Nutzlast geliefert hat? Ich finde es interessant, dass Helen Koenig gerade in dem Moment verschwunden ist, als die Krise sich zugespitzt hat.« Jack schwieg einen Moment und versuchte zu überlegen, weshalb Helen Koenig so unvermittelt die Einäscherung ihres eigenen Experiments angeordnet hatte. Er erinnerte sich daran, was Gordon Obie bei ihrem Treffen gesagt hatte. Vielleicht war dies gar kein Sabotageakt, sondern etwas anderes, etwas ebenso Beängstigendes – nämlich ein Irrtum. »Da ist noch mehr«, sagte Liz. »An diesem Experiment ist etwas, was bei mir die Alarmglocken schrillen lässt.« »Was meinen Sie?« »Die Finanzierung. Der Platz in der Raumstation ist begrenzt, weshalb die Experimente von außerhalb der NASA in ständiger Konkurrenz zueinander stehen. Die Forscher müssen einen Antrag einreichen, in dem sie die mögliche kommerzielle Nutzanwendung ihres Experiments erläutern. Der Antrag wird von uns begutachtet und verschiedenen Komitees vorgelegt, bevor wir eine Rangliste der Projekte erstellen, die ins All mitgenommen werden. Der Prozess zieht sich sehr lange hin – mindestens ein Jahr, wenn nicht länger.« »Wie lange hat es bei dem Archäen-Experiment gedauert?« »Sechs Monate.« Er runzelte die Stirn. »So schnell?« Liz nickte. »Auf der Überholspur. Es musste nicht, wie die, meisten anderen Experimente, um NASA-Gelder anstehen. Es war privat finanziert. Irgendjemand hat dafür bezahlt, dass dieses Experiment zur Raumstation geschickt wurde.« Das war im Übrigen eine der Methoden, mit der die NASA die ISS finanziell am Leben erhielt – indem sie Nutzlastraum an Bord der Station an kommerzielle Nutzer verkaufte. »Weshalb sollte eine Firma Geld – und wir reden hier von einem Haufen Geld – ausgeben, um einen im Grunde wertlosen Organismus heranzuzüchten? Aus wissenschaftlicher Neugier?« Sie schnaubte verächtlich. »Wohl kaum.« »Wer hat dafür bezahlt?« »Die Firma, bei der Dr. Koenig gearbeitet hat. SeaScience in La Jolla, Kalifornien. Sie entwickeln kommerzielle Anwendungen aus Meeresprodukten.« Die düstere Verzweiflung, die noch vor kurzem auf Jack gelastet hatte, begann sich zu lichten. Jetzt hatte er Informationen, mit denen er arbeiten konnte. Einen Aktionsplan. Endlich konnte er etwas tun. Er sagte: »Ich brauche Adresse und Telefonnummer von SeaScience. Und den Namen der Mitarbeiterin, mit der Sie gesprochen haben.« Liz nickte entschlossen. »Kein Problem, Jack.« 17. August Diana erwachte aus einem unruhigen Schlaf. Ihr Kopf schmerzte, und die Träume trübten immer noch ihren Sinn. Träume von Cornwall, von dem Haus, in dem sie als Kind gewohnt hatte. Von dem gepflegten, mit Heckenrosen überwucherten Ziegelpfad, der zur Haustür führte. In ihrem Traum hatte sie das kleine Tor aufgestoßen und hatte es quietschen gehört, wie es stets gequietscht hatte, weil den, Scharnieren ein Tropfen Öl fehlte. Sie war über den Fußpfad zu dem steinernen Cottage gegangen. Nur ein halbes Dutzend Schritte, und sie würde die Haustür öffnen. Würde rufen, dass sie zu Hause war, endlich zu Hause. Sie sehnte sich nach der Umarmung ihrer Mutter, nach ihrem Trost und ihrer Vergebung. Aber aus dem halben Dutzend Schritte wurde ein Dutzend. Zwei Dutzend. Und immer noch war das Haus weit weg, der Pfad zog sich immer mehr in die Länge, bis das Haus zur Größe einer Puppenstube geschrumpft war. Als Diana erwachte, hatte sie die Arme weit ausgestreckt; ein Schrei der Verzweiflung löste sich aus ihrer Brust. Sie öffnete die Augen und sah, wie Michael Griggs sie anstarrte. Obwohl sein Gesicht durch die Filterschutzmaske und die Brille teilweise verdeckt war, konnte sie den Ausdruck des Entsetzens darin erkennen. Sie zog den Reißverschluss ihres Schlafsacks auf und eilte in das russische Modul. Noch bevor sie ihr Gesicht im Spiegel erblickte, wusste sie, was sie dort sehen würde. Das Weiß ihres linken Auges war von einer leuchtend roten Flamme überzogen. Im Dämmerlicht des Wohnmoduls unterhielten sich Emma und Luther in gedämpftem Tonfall. Im größten Teil der Station war die Energieversorgung noch stark eingeschränkt, nur das russische Segment, das seine eigene Stromquelle hatte, war voll betriebsbereit. Die amerikanische Hälfte der ISS war nur noch ein unheimliches Labyrinth düsterer Röhren, und im Halbdunkel des Wohnmoduls war die hellste Lichtquelle der Computerbild- schirm, der momentan die Diagramme der Lebenserhaltungs- und Umweltsysteme anzeigte. Emma und Luther waren mit dem ECLSS vertraut; bei ihrem Training auf der Erde hatten sie sich alle seine Komponenten und Subsysteme gut eingeprägt. Jetzt aber hatten sie einen gewichtigen Grund, das System zu überprüfen. Sie hatten eine ansteckende Substanz an Bord, und, sie konnten nicht ausschließen, dass die gesamte Station verseucht war. Als Nikolai gehustet hatte und die Eier der Chimäre im ganzen RSM umhergeflogen waren, war die Luke offen gewesen. Innerhalb von Sekunden hatte das Zirkulations- system der ISS, das darauf ausgerichtet war, Ansammlungen verbrauchter Luft zu verhindern, die schwebenden Tröpfchen in andere Teile der Station gewirbelt. Hatte das Umweltkontroll- system die umherfliegenden Partikel seiner Funktion entsprechend eingefangen und aus der Luft herausgefiltert, oder war der tödliche Stoff jetzt überall, in allen Modulen? Der Monitor zeigte schematische Darstellungen der Luftströmungen zwischen der künstlichen Atmosphäre innerhalb der Station und der Umgebung. Der Sauerstoff kam aus mehreren voneinander unabhängigen Quellen. Die Hauptquelle war der russische Elektron-Generator, der durch Elektrolyse Wasser in Wasserstoff und Sauerstoff umwandelte. Zu den Reservequellen gehörten ein mit festem Treibstoff betriebener Generator, der mit chemischen Patronen arbeitete, sowie Sauerstofftanks, die vom Shuttle regelmäßig aufgefüllt wurden. Ein Röhrensystem verteilte den mit Stickstoff gemischten Sauerstoff in der ganzen Station, während Ventilatoren für die Luftzirkulation zwischen den Modulen sorgten. Andere Ventilatoren bliesen die Luft durch diverse Scrubber und Filter, mit denen sie von Kohlendioxid, Wasser und Verunreinigungen befreit wurde. »Diese HEPA-Filter müssten sämtliche Eier oder Larven innerhalb von fünfzehn Minuten eingefangen haben«, sagte Luther und zeigte auf das Diagramm. »Das System hat eine Effizienz von neunundneunzig Komma neun Prozent. Alles, was größer ist als ein Mikrometer, müsste herausgefiltert worden sein.« »Vorausgesetzt, die Eier sind in der Luft geblieben«, wandte Emma ein. »Das Problem ist, dass sie an Oberflächen hängen bleiben. Und ich habe gesehen, wie sie sich bewegt haben. Sie, können in Spalten hineinkriechen und sich hinter Verkleidungen verstecken, wo wir sie nicht sehen.« »Wir würden Monate brauchen, um alle Verkleidungen rauszureißen und nach ihnen zu suchen. Selbst dann würden uns wahrscheinlich noch einige entgehen.« »Aussichtslos, das können wir vergessen. Ich werde die restlichen HEPA-Filter auswechseln. Und du überprüfst morgen noch einmal die mikrobiellen Luftsampier. Das muss reichen. Wenn diese Larven in die Elektroinstallation gekrochen sind, finden wir sie niemals.« Sie seufzte; die Müdigkeit lastete so schwer auf ihr, dass schon das Denken sie anstrengte. »Egal, was wir tun, es macht am Ende vielleicht gar keinen Unterschied. Vielleicht ist es längst zu spät.« »Für Diana ist es jedenfalls zu spät«, sagte Luther leise. Am Morgen hatten sich bei Diana die skleralen Blutungen eingestellt. Sie durfte das RSM nicht mehr verlassen. Sie hatten ein Stück Plastikfolie über die Einstiegsluke gespannt, und der Zugang zum Modul war nur mit Atemmaske und Schutzbrille erlaubt. Eine sinnlose Maßnahme, dachte Emma. Sie hatten alle die gleiche Luft geatmet; sie hatten alle Nikolai angefasst. Vielleicht waren sie längst infiziert. »Wir müssen davon ausgehen, dass das russische Service- modul hoffnungslos kontaminiert ist«, sagte Emma. »Das ist das einzige bewohnbare Modul mit voller Strom- versorgung. Wir können es nicht komplett abschotten.« »Dann ist dir wohl klar, was wir tun müssen.« Luther seufzte resigniert. »Noch ein Weltraumspaziergang.« »Wir müssen die Versorgung in diesem Segment wiederher- stellen«, sagte sie. »Du musst die Reparaturen an der Beta- Kardanaufhängung abschließen, oder wir stehen am Rande einer Katastrophe. Sollte bei unserer Notstromversorgung irgendeine weitere Panne eintreten, könnten wir als Nächstes ohne, Umweltkontrolle dastehen. Oder ohne Steuerungs- und Navigationscomputer.« Das war das Szenario, das die Russen als »fliegenden Sarg« bezeichneten. Die Station würde ohne jede Möglichkeit der Orientierung hilflos im All umhertreiben. »Selbst wenn wir die Energieversorgung wiederherstellen«, meinte Luther, »das ändert nichts an unserem eigentlichen Problem. Der Biokontamination.« »Wenn es uns gelingt, sie auf den russischen Teil zu beschränken …« »Aber die Larven reifen doch schon in ihr heran! Sie ist wie eine Bombe, die jeden Moment hochgehen kann!« »Wir werfen ihren Körper über Bord, sobald sie tot ist«, sagte Emma. »Bevor irgendwelche Eier oder Larven austreten.« »Vielleicht ist es dann schon zu spät. Nikolai hat diese Eier ausgehustet, als er noch am Leben war. Wenn wir warten, bis Diana stirbt …« »Was wollen Sie damit sagen, Luther?« Griggs’ Stimme schreckte die beiden auf; sie drehten sich zu ihm um. Er starrte sie von der Luke aus an, sein Gesicht schimmerte im Halbdunkel des Moduls. »Wollen Sie etwa sagen, wir sollten sie rausschmeißen, solange sie noch am Leben ist?« Luther zog sich tiefer in die Dunkelheit zurück, als weiche er einem Angriff aus. »Um Gottes willen, das habe ich doch nicht gesagt.« »Und was haben Sie gesagt?« »Nur, dass die Larven – wir wissen doch, dass sie in ihr sind. Wir wissen, dass es nur eine Frage der Zeit ist.« »Vielleicht sind sie in uns allen. Vielleicht wachsen sie in diesem Moment in uns heran. Sollten wir etwa ihren Körper über Bord werfen?« »Wenn das verhindert, dass sie sich weiter ausbreiten, ja. Sehen Sie, wir wissen doch, dass sie sterben wird. Wir können, es nicht ändern. Wir müssen vorausdenken …« »Halten Sie den Mund!« Griggs schoss quer durch das Modul und bekam Luther am Hemd zu fassen. Beide Männer krachten gegen die Wand und prallten wieder ab. Sie wirbelten in der Luft herum; Luther versuchte sich loszureißen, aber Griggs ließ nicht locker. »Aufhören!«, schrie Emma. »Griggs, lassen Sie ihn los!« Griggs löste seinen Griff. Schwer atmend ließen die Männer voneinander ab. Emma schob sich zwischen sie. »Luther hat Recht«, sagte sie zu Griggs. »Wir müssen vorausdenken. Es gefällt uns vielleicht nicht, aber wir haben keine andere Wahl.« »Und wenn es um Sie ginge, Watson?«, fuhr Griggs sie an. »Wie würde es Ihnen gefallen, wenn wir darüber diskutierten, was wir mit Ihrer Leiche machen? Wie schnell wir sie in den Sack stecken und Sie entsorgen können?« »Ich würde erwarten, dass Sie solche Pläne machen! Es stehen drei weitere Menschenleben auf dem Spiel, und Diana weiß das. Ich tue mein Bestes, um sie am Leben zu halten, aber im Moment habe ich nicht die geringste Ahnung, was helfen könnte. Ich kann sie lediglich mit Antibiotika voll pumpen und auf Antworten aus Houston warten. Wenn Sie mich fragen, wir sind hier oben ganz auf uns gestellt. Wir müssen mit dem Schlimmsten rechnen!« Griggs schüttelte den Kopf. Seine Augen waren rot gerändert, sein Gesicht wirkte vor Kummer und Sorgen ausgezehrt. Leise sagte er: »Wie kann es denn noch schlimmer werden?« Sie antwortete nicht. Sie sah Luther an und las ihre eigenen Gedanken in seinen Augen. Das Schlimmste steht uns noch bevor. »ISS, der Surgeon steht bereit«, sagte der Capcom. »Sprechen, Sie jetzt, ISS.« »Jack?«, sagte Emma. Sie war enttäuscht, als sie stattdessen Todd Cutlers Stimme hörte. »Ich bin’s, Emma. Ich fürchte, Jack kommt heute nicht mehr ins JSC zurück. Er ist mit Gordon nach Kalifornien gefahren.« Verdammt noch mal, Jack, dachte sie. Ich brauche dich. »Wir sind uns hier unten einig über die EVA«, sagte Todd. »Jemand muss die Außenreparatur machen, und zwar bald. Meine erste Frage an dich lautet, wie ist Luther Arnes’ Zustand? Körperlich und mental? Ist er dazu in der Lage?« »Er ist müde. Wir sind alle müde. Wir haben in den vergangenen vierundzwanzig Stunden kaum geschlafen. Die Säuberungsaktion hält uns in Atem.« »Schafft er es, wenn wir ihm einen Tag zum Ausruhen geben?« »Im Moment scheint ein Ruhetag wie ein unmöglicher Traum.« »Aber würde die Zeit ausreichen?« Sie überlegte kurz. »Ich denke schon. Er muss nur etwas Schlaf nachholen.« »Okay. Und jetzt zu meiner zweiten Frage: Bist du in der Lage, eine EVA durchzuführen?« Emma war vollkommen verblüfft. »Ihr wollt, dass ich ihn begleite?« »Wir glauben nicht, dass Griggs dazu fähig ist. Er hat sich ganz von der Kommunikation mit der Bodenstation zurück- gezogen. Unser Psychologe ist der Meinung, dass er momentan zu labil ist.« »Er trauert, Todd. Und er ist sehr verbittert darüber, dass ihr uns nicht heimkehren lasst. Ihr wisst das vielleicht nicht, aber er und Diana …« »Wir wissen Bescheid. Und diese Emotionen untergraben, seine Leistungsfähigkeit entscheidend. Deshalb musst du Luther begleiten.« »Was ist mit dem Anzug? Der andere ist doch zu groß für mich!« »In der alten Sojus-Kapsel ist noch ein Orlan-M-Anzug. Er wurde für Elena Savitskaja gefertigt und vor einigen Missionen an Bord zurückgelassen. Elena hatte in etwa deine Größe und dein Gewicht. Der Anzug dürfte dir also passen.« »Es wäre meine erste EVA.« »Du hast das Schwerelosigkeitstraining absolviert. Du kriegst das schon hin. Luther braucht da draußen ganz einfach deine Hilfe.« »Und was ist mit meiner Patientin? Wer kümmert sich um sie, während ich draußen bin?« »Griggs kann ihre Zugänge wechseln und nach ihr sehen.« »Und wenn es zu einer Krise kommt? Wenn sie Krämpfe bekommt?« Todd erwiderte ruhig: »Sie wird sterben, Emma. Wir glauben nicht, dass du daran irgendetwas ändern kannst.« »Das wäre anders, wenn ihr mir brauchbare Informationen an die Hand gegeben hättet! Ihr seid doch nur daran interessiert, diese Station am Leben zu halten! Anscheinend sind euch die verdammten Sonnensegel wichtiger als die Crew. Wir brauchen ein Heilmittel, Todd, sonst werden wir hier oben alle verrecken.« »Wir haben kein Mittel. Noch nicht …« »Dann holt uns zurück, verdammt noch mal!« »Denkst du, wir überlassen euch dort oben absichtlich eurem Schicksal? Denkst du vielleicht, wir hätten eine Wahl? Hier geht es zu wie im Führerhauptquartier! Im Kontrollzentrum wimmelt es nur so von irgendwelchen Air-Force-Arschlöchern, und …« Plötzlich war es still., »Surgeon?«, rief Emma. »Todd?« Immer noch keine Antwort. »Capcom, ich habe die Verbindung zum Surgeon verloren«, sagte sie. »Können Sie sie wiederherstellen?« Eine Pause. Dann: »Halten Sie sich bereit, ISS.« Sie wartete und wartete; es kam ihr vor wie eine Ewigkeit. Als sie endlich wieder Todds Stimme hörte, klang er verzagt. Eingeschüchtert, dachte Emma. »Sie hören mit, nicht wahr?«, sagte sie. »Richtig.« »Das hier sollte doch eine vertrauliche ärztliche Besprechung sein! Eine private Frequenz!« »Nichts ist mehr privat. Vergiss das nicht.« Sie schluckte krampfhaft, unterdrückte ihre Wut. »Okay. Okay, ich höre schon auf zu schimpfen. Sag mir einfach, was ihr über diesen Organismus rausgefunden habt. Sag mir, wie ich ihn bekämpfen kann.« »Ich fürchte, da kann ich dir nicht viel sagen. Ich habe gerade mit dem USAMRIID gesprochen. Mit einem Dr. Isaac Roman, der das Projekt Chimäre leitet. Er hat keine guten Nachrichten. Er sagt, die Chimäre besitzt inzwischen so viel fremde DNS, dass sie vom Genom her mehr einem Säugetier gleicht als irgendetwas anderem. Das bedeutet, dass jedes Medikament, das wir einsetzen würden, auch unser Gewebe abtöten könnte.« »Haben sie es mit Krebsmedikamenten versucht? Dieses Ding vermehrt sich so schnell, es verhält sich fast wie ein Tumor. Könnten wir ihm vielleicht damit beikommen?« »Beim USAMRIID haben sie Antimitotika ausprobiert in der Hoffnung, sie könnten es während der Zellteilungsphase abtöten. Unglücklicherweise waren die benötigten Dosen so hoch, dass die Wirtstiere auch draufgegangen sind. Die ganze Darmschleimhaut hat sich abgelöst. Die Tiere sind innerlich verblutet.«, Der schrecklichste Tod, den man sich vorstellen kann, dachte Emma. Massive Blutungen in Magen und Darm. Blut strömt aus dem Mund und dem Rektum. Auf der Erde war sie einmal Zeugin eines solchen Todes geworden. Im Weltraum würde es noch entsetzlicher sein; riesige Blutstropfen würden wie Luftballons durch die Kabine schweben und alle Wände, alle Crewmitglieder bespritzen. »Dann hat also nichts funktioniert«, sagte sie. Todd schwieg. »Gibt es denn gar nichts? Irgendein Mittel, das den Wirt nicht tötet?« »Da war noch eine Sache, die sie erwähnt haben. Aber Roman glaubt, dass es nur ein vorübergehender Effekt ist. Kein Heilmittel.« »Was ist das für eine Behandlung?« »Eine Überdruckkammer. Man braucht mindestens zehn Atmosphären Druck. Das entspricht einer Wassertiefe von fast hundert Metern. Die infizierten Tiere, die unter diesen Hochdruckbedingungen gehalten werden, sind sechs Tage nach der Ansteckung immer noch am Leben.« »Mindestens zehn Atmosphären?« »Sobald es weniger ist, nimmt die Infektion ihren Lauf. Der Wirt stirbt.« Emma stieß einen frustrierten Schrei aus. »Selbst wenn wir unseren Luftdruck so weit hochpumpen könnten – zehn Atmosphären sind mehr, als diese Station aushalten kann.« »Schon zwei würden den Rumpf belasten«, sagte Todd. »Und man braucht auch eine Helium-Sauerstoff-Atmosphäre. Die könnt ihr auf der Station nicht herstellen. Deshalb wollte ich die Sache gar nicht erst erwähnen. In eurer Situation ist die Information vollkommen nutzlos. Wir haben schon die Möglichkeit in Betracht gezogen, eine Überdruckkammer zur, ISS raufzufliegen, aber ein Gerät, mit dem man solchen Druck erzeugen kann, ist so sperrig, dass es im Laderaum der Endeavour transportiert werden müsste. Das Problem ist, dass die Endeavour schon aus dem Hangar raus ist, wo man sie hätte beladen können. Es würde mindestens zwei Wochen dauern, eine solche Kammer im Orbiter unterzubringen und damit zu starten. Und es würde bedeuten, an der ISS anzudocken und die Endeavour und ihre Crew eurer Kontamination auszusetzen.« Er hielt inne. »Das USAMRIID meint, das käme nicht in Frage.« Emma schwieg. Ihre Frustration kochte allmählich zu Rage hoch. Ihre einzige Hoffnung, eine Überdruckkammer, setzte voraus, dass sie zur Erde zurückkehrten. Und das kam auch nicht in Frage. »Wir müssen doch irgendetwas mit dieser Information anfangen können«, sagte sie. »Erklär mir, wie diese Überdruck- therapie wirken würde. Wie kam das USAMRIID überhaupt darauf, so etwas auszuprobieren?« »Die Frage habe ich Roman auch gestellt.« »Und?« »Dass dies ein neuer und komplexer Organismus sei, auf den wir mit unkonventionellen Therapiemethoden reagieren müssten.« »Er hat deine Frage also nicht beantwortet.« »Mehr wollte er mir nicht sagen.« Zehn Atmosphären Druck waren am oberen Limit dessen, was ein Mensch aushalten konnte. Emma war begeisterte Sporttaucherin, aber sie hatte nie gewagt, tiefer als vierzig Meter zu tauchen. Tiefen von neunzig oder gar hundert Metern waren reine Tollkühnheit. Warum hatte das USAMRIID mit so extremen Druckverhältnissen experimentiert? Sie müssen einen Grund gehabt haben, dachte sie. Sie wissen etwas über diesen Organismus, was sie annehmen ließ, es könnte funktionieren. Aber sie verraten es uns nicht., Der Grund, weshalb Gordon Obic »die Sphinx« genannt wurde, war noch nie so offensichtlich gewesen wie während ihres Fluges nach San Diego. Sie hatten einen der T-38-Jets von Ellington Field requiriert, und Obie saß im Cockpit, während Jack sich in den einzigen Passagiersitz zwängte. Dass sie während des Fluges kaum ein Wort wechselten, war nicht weiter überraschend. Eine T-38 ist einer gepflegten Unterhaltung nicht gerade förderlich, sitzen doch Pilot und Passagier wie zwei Erbsen in der Schote hintereinander. Aber auch während des Tankstopps in El Paso, als sie ausgestiegen waren, um sich nach anderthalb Stunden drangvoller Enge die Beine zu vertreten, hatte Obie sich nicht in ein Gespräch verwickeln lassen. Nur einmal, als sie gerade am Rand des Rollfelds standen und Limonade aus dem Getränkeautomaten im Hangar tranken, hatte er sich zu einer spontanen Bemerkung hinreißen lassen. Er hatte in die Sonne geblinzelt, die ihren Zenit bereits überschritten hatte, und gesagt: »Wenn sie meine Frau wäre, hätte ich auch ganz schön Muffensausen.« Dann hatte er seine leere Limodose in den Abfalleimer geworfen und war zum Jet zurückgegangen. Nach der Landung in Lindbergh Field übernahm Jack das Steuer des Mietwagens, und sie fuhren über die Interstate 5 nach Norden in Richtung La Jolla. Gordon sprach fast kein Wort, er schaute einfach nur aus dem Fenster. Jack hatte immer schon vermutet, dass Gordon mehr Maschine als Mensch war, und jetzt stellte er sich vor, wie sein computergleiches Gehirn die vorüber- ziehende Landschaft registrierte, als handle es sich um irgend- welche Datenbits: HÜGEL. BRÜCKE. WOHNSIEDLUNG. Obwohl Gordon früher Astronaut gewesen war, kannte niemand im Korps ihn richtig gut. Bei gesellschaftlichen Anlässen ließ er, sich stets pflichtschuldig blicken, stand aber immer abseits, ein stiller, menschenscheuer Gast; und er trank nie etwas Härteres als seine Lieblingslimonade Dr. Peppers. Er schien selbst keinerlei Probleme mit seiner Wortkargheit zu haben; für ihn war sie ein Teil seiner Persönlichkeit, den er akzeptierte wie seine grotesk abstehenden Ohren und seinen unvorteilhaften Haarschnitt. Wenn niemand Gordon Obie wirklich kannte, dann deshalb, weil er es nicht für nötig hielt, sein Innerstes zu öffnen. Deshalb hatte seine Bemerkung in El Paso Jack auch so überrascht: Wenn sie meine Frau wäre, hätte ich auch ganz schön Muffensausen. Jack konnte sich nicht vorstellen, dass die Sphinx je Angst empfand, ebenso wenig wie er sich Gordon verheiratet vorstellen konnte. Soweit Jack wusste, war er Junggeselle. Der Nachmittagsnebel zog bereits von der See herein, als sie die kurvenreiche Küstenstraße von La Jolla entlangfuhren. Fast hätten sie die Einfahrt von SeaScience verpasst; die Abzweigung war nur mit einem kleinen Schild gekennzeichnet, und die Seitenstraße schien lediglich zu einem Eukalyptuswäldchen zu führen. Erst nachdem sie ihr einen knappen Kilometer gefolgt waren, erblickten sie das Gebäude – einen unwirklich scheinenden, fast festungsartigen Komplex aus weißem Beton, der direkt am Meer lag. Eine Frau in einem weißen Laborkittel empfing sie an der Pforte. »Rebecca Gould«, stellte sie sich vor und gab ihnen die Hand. »Ich arbeite auf dem gleichen Flur wie Helen. Wir haben heute Morgen miteinander telefoniert.« Mit ihrem kurzen Haar und ihrer stämmigen Figur hätte Rebecca ebenso gut als Mann durchgehen können. Auch ihre tiefe Stimme ließ gewisse Zweifel zu. Sie fuhren mit dem Lift ins Untergeschoss. »Ich weiß wirklich nicht, warum Sie sich die Mühe gemacht haben, hierher zu kommen«, sagte Rebecca. »Wie ich Ihnen bereits am Telefon, sagte, die Leute vom USAMRIID haben Helens Labor schon gründlich abgegrast.« Sie wies auf eine Tür. »Sie können selbst nachsehen, wie wenig sie übrig gelassen haben.« Jack und Gordon traten in das Labor und sahen sich bestürzt um. Die Schubladen der Aktenschränke waren herausgezogen und leer geräumt. Auch von Regalen und Arbeitsflächen waren alle Geräte verschwunden; weit und breit war kein einziger Reagenzglasständer zu sehen. Nur der Wandschmuck war noch an Ort und Stelle, zumeist gerahmte Reiseposter, verführerische Fotos von tropischen Stränden, Palmen und braun gebrannten Frauen, deren Haut in der Sonne glänzte. »An dem Tag, als sie hier auftauchten, war ich in meinem Labor am anderen Ende des Flurs. Ich hörte aufgeregtes Stimmengewirr und das Geräusch von zerbrechendem Glas. Ich schaute aus meiner Tür heraus und sah Männer, die Akten und Computer hinauskarrten. Sie haben alles mitgenommen. Die Brutschränke mit ihren Kulturen, die Behälter mit den Meer- wasserproben, sogar die Frösche, die sie in dem Terrarium da drüben gehalten hat. Meine Assistenten haben versucht, die Plünderer aufzuhalten, aber man hat sie gleich zum Verhör abgeschleppt. Ich habe natürlich oben in Dr. Gabriels Büro angerufen.« »Gabriel?« »Palmer Gabriel. Unser Firmenchef. Er kam selbst herunter, zusammen mit einem Anwalt von SeaScience. Sie konnten aber auch nichts ausrichten. Die Soldaten sind einfach mit ihren großen Pappkartons hier reinspaziert und haben alles weg- geschleppt. Sie haben sogar das Mittagessen der Angestellten mitgenommen!« Sie öffnete den Kühlschrank und zeigte ihnen die leeren Fächer. »Ich habe nicht die geringste Ahnung, was sie zu finden hofften.« Sie drehte sich zu Jack und Gordon um. »Ich habe auch keine Ahnung, weshalb Sie hier sind.« »Ich denke, wir sind alle auf der Suche nach Helen Koenig.«, »Ich sagte Ihnen doch, dass sie gekündigt hat.« »Wissen Sie, warum?« Rebecca zuckte mit den Achseln. »Das haben die vom USAMRIID auch ständig gefragt. Ob sie sauer auf SeaScience gewesen sei. Ob sie psychisch labil gewesen sei. Mir ist ganz bestimmt nichts dergleichen aufgefallen. Ich glaube, sie war einfach nur müde. Ausgebrannt von den Siebentagewochen hier im Labor, mit wer weiß wie vielen Arbeitsstunden jeden Tag.« »Und jetzt weiß niemand, wo sie ist.« Rebecca warf erbost den Kopf in den Nacken. »Es ist kein Verbrechen, die Stadt zu verlassen. Das bedeutet nicht, dass sie eine Bioterroristin ist. Aber das USAMRIID hat so getan, als wäre dieses Labor der Ort eines Verbrechens. Als hätte sie Ebola-Viren oder etwas in der Art gezüchtet. Helen hat über Archäen geforscht, harmlose Meeresmikroben.« »Sind Sie sicher, dass in diesem Labor keine anderen Projekte durchgeführt wurden?« »Wollen Sie wissen, ob ich Helen ausspioniert habe? Selbst- verständlich nicht. Ich habe mit meiner eigenen Arbeit genug zu tun. Aber was hätte Helen sonst noch tun sollen? Sie hat Jahre ihres Lebens in die Archäenforschung investiert. Diese spezielle Unterart, die sie zur ISS geschickt hat, war ihre Entdeckung. Sie hat das als ihren persönlichen Triumph betrachtet.« »Gibt es eine kommerzielle Nutzanwendung bei Archäen?« Rebecca zögerte. »Nicht dass ich wüsste.« »Und warum studiert man dann ihr Verhalten im Weltraum?« »Haben Sie noch nie etwas von reiner Wissenschaft gehört, Dr. McCallum? Von Forschung um ihrer selbst willen? Das sind ganz merkwürdige, faszinierende Lebewesen. Helen hat ihre Unterart im Galapagos-Graben gefunden, in der Nähe einer Vulkanspalte in sechstausend Meter Tiefe. Bei sechshundert Atmosphären Druck und in kochend heißem Wasser konnte, dieser Organismus prächtig gedeihen! Es ist ganz natürlich, sich zu fragen, was passieren würde, wenn man diese Lebensform aus ihren extremen Umweltbedingungen in eine gemäßigtere Umgebung versetzt. Wo kein tonnenschwerer Druck auf sie einwirkt. Und wo nicht einmal die Schwerkraft ihr Wachstum verzerrt.« »Entschuldigen Sie bitte«, unterbrach sie Gordon, und die beiden drehten sich zu ihm um. Er war im Labor umherspaziert, hatte in leere Schubladen geschaut und Mülleimer inspiziert. Jetzt stand er neben einem der Poster, die an der Wand hingen. Er zeigte auf einen Schnappschuss, der mit Klebeband in einer Ecke des Rahmens befestigt war. Das Foto zeigte ein großes Flugzeug auf einem Rollfeld. Unter dem Flügel posierten die beiden Piloten. »Woher stammt dieses Foto?« Rebecca zuckte mit den Achseln. »Woher soll ich das wissen? Das hier ist Helens Labor.« »Das ist eine KC-135«, sagte Gordon. Jetzt verstand Jack, weshalb das Foto Gordons Aufmerk- samkeit erregt hatte. Die KC-13 5 war das Flugzeug, das die NASA benutzte, um ihre Astronauten mit der Schwerelosigkeit vertraut zu machen. Wenn man damit große Parabelkurven flog, entstand ein Effekt wie bei einer riesigen Achterbahn; bei jedem Sturzflug wurde die Schwerkraft bis zu dreißig Sekunden lang aufgehoben. »Hat Dr. Koenig für ihre Forschungen irgendwann mal eine KC-135 benutzt?«, fragte Jack. »Ich weiß, dass sie mal vier Wochen auf irgendeinem Flugplatz in New Mexico war. Ich habe keine Ahnung, was für ein Flugzeug sie dort benutzt haben.« Jack und Gordon tauschten nachdenkliche Blicke. Vier Wochen Forschung mit einer KC-135 würden ein Vermögen kosten. »Wer hätte solche Ausgaben genehmigen können?«, fragte Jack., »Dr. Gabriel selbst hätte seine Zustimmung geben müssen.« »Könnten wir ihn sprechen?« Rebecca schüttelte den Kopf. »Bei Palmer Gabriel platzt man nicht einfach so herein. Selbst die Wissenschaftler, die hier arbeiten, bekommen ihn nur selten zu sehen. Er leitet Forschungsstätten im ganzen Land; es könnte also gut sein, dass er zurzeit gar nicht in der Stadt ist.« »Eine Frage noch«, fiel ihr Gordon ins Wort. Er war zu dem leeren Terrarium hinübergeschlendert und betrachtete das Moos und die Kieselsteine am Boden. »Was war in diesem Kasten?« »Die Frösche. Ich habe Ihnen doch davon erzählt. Sie waren Helens Hobby Das USAMRIID hat sie auch mitgenommen.« Gordon richtete sich plötzlich auf und sah sie an. »Was für Frösche?« Sie lachte verblüfft auf. »Stellt ihr NASA-Leute immer so komische Fragen?« »Ich bin nur neugierig, welche Art man sich wohl als Haustier halten würde.« »Ich glaube, es waren eine Art Leopardfrösche. Ich persönlich würde ja einen Pudel empfehlen, der ist längst nicht so schleimig.« Sie sah auf ihre Armbanduhr. »Also, meine Herren. Noch irgendwelche Fragen?« »Ich glaube, ich bin hier fertig, vielen Dank«, erwiderte Gordon. Und ohne ein weiteres Wort zu verlieren, verließ er das Labor. Sie saßen in ihrem Mietwagen. Nebelfetzen wirbelten an den Fenstern vorbei, und von der feuchten Meerluft beschlugen allmählich die Scheiben. Rana pipiens, dachte Jack. Der nördliche Leopardfrosch. Eine der drei Arten im Genom der Chimäre. »Von hier ist es ausgegangen«, sagte er. »Von diesem Labor.« Gordon nickte., »Das USAMRIID weiß seit einer Woche von diesem Ort«, sagte Jack. »Wie haben sie es herausgefunden? Woher wussten sie, dass die Chimäre aus den SeaScience-Labors stammt? Es muss doch möglich sein, sie zu zwingen, ihre Informationen mit uns zu teilen.« »Nicht, wenn die nationale Sicherheit auf dem Spiel steht.« »Die NASA ist nicht der Feind.« »Vielleicht denken sie das aber. Vielleicht glauben sie, dass die Bedrohung aus den Kreisen der NASA kommt«, meinte Gordon. Jack sah ihn an. »Einer von uns?« »Das wäre einer von zwei Gründen, weshalb das Verteidigungs- ministerium uns nicht einweihen will.« »Und der Zweite?« »Weil es Arschlöcher sind.« Jack lachte und ließ sich in seinen Sitz fallen. Eine Weile schwiegen beide. Der Tag war schon anstrengend genug ge- wesen, und noch hatten sie den Rückflug nach Houston vor sich. »Ich habe das Gefühl, ich würde mit der Luft boxen«, sagte Jack, während er sich mit der Hand über die Augen rieb. »Ich weiß nicht, gegen wen oder was ich kämpfe. Aber ich darf einfach nicht aufhören zu kämpfen.« »So eine Frau würde ich auch nicht so einfach aufgeben«, sagte Gordon. Keiner von ihnen hatte ihren Namen ausgesprochen, aber sie wussten beide, dass sie über Emma redeten. »Ich erinnere mich noch an ihren ersten Tag in Johnson«, sagte Gordon. Das trübe Licht, das durch die beschlagenen Fensterscheiben fiel, zeichnete sein unscheinbares Gesicht Grau in Grau. Er saß ganz still da und blickte unverwandt geradeaus; ein ernster, farbloser Mann. »Ich habe zu ihrer Gruppe von Astronautenanwärtern gesprochen. Ich habe mir all die neuen Gesichter in dem Raum angesehen, und da war sie, in der Mitte, der ersten Reihe. Sie hatte keine Angst, aufgerufen zu werden. Keine Angst, sich zu blamieren. Keine Angst vor gar nichts.« Er hielt inne und schüttelte einmal kurz den Kopf. »Ich habe sie nicht gerne raufgeschickt. Jedes Mal, wenn ihr Name auf einer Besatzungsliste auftauchte, hätte ich ihn am liebsten wieder gestrichen. Nicht, weil sie nicht gut gewesen wäre. Weiß Gott nicht. Ich konnte es nur kaum ertragen, sie zu dieser Startrampe rausfahren zu sehen, weil ich doch genau wusste, was alles schief gehen konnte.« Er brach plötzlich ab. Jack hatte ihn noch nie so viel auf einmal reden hören; noch nie hatte Gordon ihm gegenüber so viel von seinen Gefühlen preisgegeben. Und doch war nichts von dem, was er gesagt hatte, für Jack eine Über- raschung. Er dachte daran, auf wie viele verschiedene Arten er Emma liebte. Und welcher Mann könnte sie nicht lieben?, fragte er sich. Nicht einmal Gordon Obie ist dagegen immun. Er ließ den Motor an, und die Scheibenwischer befreiten die Windschutzscheibe von der feinen Schicht aus Kondenswasser, die ihnen die Sicht genommen hatte. Es war schon fünf Uhr; sie würden im Dunkeln nach Houston zurückfliegen. Jack lenkte den Wagen aus der Parklücke und auf die Ausfahrt zu. Sie hatten den Parkplatz gerade zur Hälfte überquert, als Gordon plötzlich rief: »Was zum Teufel ist das?« Jack trat mit aller Kraft auf die Bremse, als die schwarze Limousine durch den Nebel auf sie zugeschossen kam. Da raste auch schon ein zweiter Wagen heran und kam mit quietschenden Reifen unmittelbar vor ihnen zum Stehen, Stoßstange an Stoßstange. Vier Männer stiegen aus. Jack erstarrte, als seine Tür aufgerissen wurde und eine Stimme befahl: »Steigen Sie aus, meine Herren. Beide, wenn ich bitten darf.« »Warum?« »Sie steigen jetzt sofort aus.« Gordon sagte leise: »Ich habe den Eindruck, dass es hier nicht, viel zu verhandeln gibt.« Widerstrebend stiegen sie aus, worauf sie sofort von oben bis unten abgetastet und um ihre Brieftaschen erleichtert wurden. »Er will mit Ihnen reden. Steigen Sie hinten ein.« Der Mann wies auf eines der schwarzen Autos. Jack sah in die Gesichter der vier Männer, die sie beo- bachteten. Widerstand zwecklos – mit diesen Worten ließ sich ihre Lage wohl am besten beschreiben. Er ging mit Gordon auf die schwarze Limousine zu und nahm auf dem Rücksitz Platz. Vorne saß ein Mann. Sie sahen nur seinen Hinterkopf und seine Schultern. Er hatte dichtes, silbergraues Haar, das er zurückgekämmt trug, und war mit einem grauen Anzug bekleidet. Seine Fensterscheibe schnurrte herunter, und man reichte ihm die beiden konfiszierten Brieftaschen. Er schloss das Fenster wieder, das mit seinem dunkel getönten Glas ausreichend Schutz vor neugierigen Augen bot. Er nahm sich einige Minuten Zeit, um den Inhalt der Brieftaschen zu begutachten. Dann drehte er sich zu seinen Gästen auf der Rückbank um. Er hatte dunkle Augen, wie zwei Obsidiane, die auffallend frei von Lichtreflexen zu sein schienen. Zwei schwarze Löcher, die alles Licht verschluckten. Er warf Jack die Brieftaschen in den Schoß. »Sie sind ziemlich weit weg von Houston, meine Herren.« »Wir sind wohl in El Paso falsch abgebogen«, sagte Jack. »Was hat die NASA hier zu suchen?« »Wir wollen wissen, was wirklich in dieser Zellkultur war, die Sie zur Raumstation geschickt haben.« »Das USAMRIID war schon hier. Sie haben alles gründlich ausgeräumt. Alles haben sie mitgenommen: Dr. Koenigs Forschungsprotokolle, ihre Computer. Wenn Sie irgendwelche Fragen haben, rate ich Ihnen, sich dorthin zu wenden.« »Das USAMRIID redet nicht mit uns.«, »Das ist Ihr Problem, nicht meins.« »Helen Koenig hat für Sie gearbeitet, Dr. Gabriel. Wissen Sie nicht, was in Ihren eigenen Labors vor sich geht?« Am Gesichtsausdruck des Mannes erkannte Jack, dass er richtig geraten hatte. Dieser Mann war der Gründer von SeaScience. Palmer Gabriel. Ein engelhafter Nachname für einen Mann, dessen Augen kein Licht ausstrahlten. »Hunderte von Wissenschaftlern arbeiten unter mir«, sagte Gabriel. »Ich besitze Forschungsinstitute in Massachusetts und in Florida. Ich kann unmöglich über alles Bescheid wissen, was in meinen Labors geschieht. Und ich kann auch nicht für Verbrechen verantwortlich gemacht werden, die von irgendwelchen Mitarbeitern begangen werden.« »Das ist nicht irgendein Verbrechen. Es handelt sich um eine biotechnisch hergestellte Chimäre – einen Organismus, der eine komplette Shuttle-Besatzung getötet hat. Und der aus Ihrem Labor stammt.« »Meine Forscher haben bei ihren Projekten freie Hand. Ich mische mich nicht ein. Ich bin selbst Wissenschaftler, Dr. McCallum, und ich weiß, dass Wissenschaftler die besten Leistungen bringen, wenn sie völlig unabhängig arbeiten können. Wenn sie die Freiheit haben, sich von ihrer eigenen Neugier treiben zu lassen. Was immer Helen getan hat, war ihre eigene Angelegenheit.« »Warum hat sie über Archäen geforscht? Was hoffte sie zu finden?« Er drehte sich wieder nach vorne, und sie sahen nur noch seinen Hinterkopf mit dem elegant geschwungenen Silberhaar. »Jegliches Wissen ist nützlich. Vielleicht erkennen wir anfangs noch nicht seinen Wert. Welchen denkbaren Nutzen hat es etwa, über das Fortpflanzungsverhalten der Meeresschnecke Bescheid zu wissen? Dann finden wir heraus, welche wertvollen Hormone aus dieser unscheinbaren Meeresschnecke gewonnen, werden können. Und plötzlich ist ihr Fortpflanzungsverhalten von allergrößter Bedeutung.« »Und worin liegt die Bedeutung der Archäen?« »Das ist genau die Frage, nicht wahr? Das ist es, womit wir uns hier beschäftigen. Wir erforschen einen Organismus so lange, bis wir seinen Nutzen schließlich erkennen.« Er deutete auf das Forschungsgebäude, das jetzt von dichtem Nebel umhüllt war. »Wie Sie sehen, liegt es direkt am Meer. Alle meine Einrichtungen liegen am Meer. Das ist mein Ölfeld. Dort suche ich nach dem nächsten Krebsmedikament, nach der nächsten Wunderdroge. Es ist zweifellos sinnvoll, dort zu suchen, denn dort liegen auch unsere Wurzeln. Unsere Heimat. Alles Leben kommt aus dem Meer.« »Sie haben meine Frage nicht beantwortet. Haben die Archäen irgendeinen kommerziellen Nutzen?« »Das wird sich noch herausstellen.« »Und warum schickt man sie in den Weltraum? Hat sie bei diesen Flügen mit der KC-135 irgendetwas entdeckt? Etwas, was mit Schwerelosigkeit zu tun hat?« Gabriel ließ sein Fenster herunter und gab den Männern ein Zeichen. Die hinteren Wagentüren wurden geöffnet. »Bitte steigen Sie jetzt aus.« »Warten Sie«, sagte Jack. »Wo ist Helen Koenig?« »Ich habe nichts mehr von ihr gehört, seit sie gekündigt hat.« »Warum hat sie die Einäscherung ihrer eigenen Zellkulturen angeordnet?« Jack und Gordon wurden aus dem Wagen gezerrt und auf ihren Mietwagen zugestoßen. »Wovor hatte sie Angst?«, rief Jack. Gabriel antwortete nicht. Sein Wagenfenster schloss sich wieder, und sein Gesicht verschwand hinter dem Schutzschild aus getöntem Glas., 18. August Luther ließ den letzten Rest Luft aus der Mannschaftsschleuse in den Weltraum ab und öffnete die Ausstiegsluke. »Ich gehe zuerst«, sagte er. »Lass dir ruhig Zeit. Das erste Mal ist es immer etwas unheimlich.« Beim ersten Blick hinaus in die Leere musste Emma sich vor Schreck am Rand der Luke festhalten. Sie wusste, dieses Gefühl war ganz normal und würde vorübergehen. Dieser kurze Moment lähmender Angst überfiel fast jeden beim ersten Weltraumspaziergang. Das menschliche Gehirn akzeptiert die Weite des Raums und die Abwesenheit von Oben und Unten nicht so leicht. Millionen Jahre der Evolution hatten ihm eine panische Angst vor dem Fallen eingeprägt, und gegen diese musste Emma nun ankämpfen. Jeder Instinkt sagte ihr, wenn sie jetzt losließe, würde sie schreiend in die Tiefe stürzen, immer weiter und weiter, ohne Ende. Ihr Verstand sah natürlich ein, dass dies nicht passieren würde. Sie war durch die Schnur mit der Mannschaftsschleuse verbunden; und wenn diese reißen sollte, konnte sie immer noch ihren Satz SAFER-Steuerraketen benutzen, um sich in die Station zu retten. Um eine Katastrophe auszulösen, wäre eine höchst unwahrscheinliche Verkettung voneinander unabhängiger Zwischenfälle erforderlich. Aber genau das ist mit dieser Station passiert, dachte sie. Ein Zwischenfall nach dem anderen. Eine wahre Titanic im Weltraum. Sie konnte die Vorahnung einer weiteren Katastrophe einfach nicht abschütteln. Sie waren bereits gezwungen gewesen, das Protokoll zu, verletzen. Statt wie vorgesehen eine ganze Nacht bei reduziertem Druck in der Schleuse zu »campen«, hatten sie nur vier Stunden darin verbracht. Theoretisch sollte das als Vorbeugung gegen die Taucherkrankheit genügen, aber jede Abweichung von der normalen Vorgehensweise bedeutete einen zusätzlichen Risikofaktor. Sie holte einige Male tief Luft und spürte, wie die Lähmung von ihr abfiel. »Wie geht’s denn so?«, hörte sie Luthers Stimme im Kopfhörer. »Ich … will nur noch einen Moment die Aussicht genießen«, sagte sie. »Keine Probleme?« »Nein. Alles in bester Ordnung.« Sie ließ die Luke los und schwebte hinaus in den endlosen Raum. Diana stirbt. Mit wachsender Verbitterung starrte Griggs auf die Überwachungsbildschirme, die Luther und Emma bei der Arbeit an der Außenseite der Station zeigten. Arbeitsbienen, dachte er. Gefügige Roboter, die nach Houstons Pfeife tanzten. Viele Jahre lang war auch er eine Arbeitsbiene gewesen. Erst jetzt begriff er, was seine Rolle in dem großen Plan war. Er war wie alle anderen entbehrlich. Sie alle waren nur austauschbare ferngesteuerte Maschinen, deren wahre Funktion darin bestand, die glanzvolle NASA-Technik zu warten. Wir gehen hier vielleicht alle nacheinander drauf, aber wir halten den Scheißladen trotzdem tipptopp in Ordnung. Zu Befehl, Sir! Mit ihm brauchten sie nicht mehr zu rechnen. Die NASA hatte ihn verraten, hatte sie alle verraten. Sollten Watson und Arnes doch die braven kleinen Soldaten spielen; er hatte endgültig genug davon. Außer Diana interessierte ihn nichts mehr., Er verließ das Wohnmodul und steuerte die russische Seite der Station an. Dort angekommen schlüpfte er unter der Plastikplane hindurch, die über die Luke gespannt war, und tauchte in das RSM ein. Er machte sich nicht die Mühe, Maske und Schutzbrille aufzusetzen. Was änderte das schon? Sie würden eh alle sterben. Diana lag festgeschnallt auf dem Behandlungstisch. Ihre Augen traten aus den Höhlen, die Lider waren angeschwollen. Ihr Bauch, der immer so flach und fest gewesen war, war nun aufgedunsen. Angefüllt mit Eiern, dachte er. Er malte sich aus, wie sie in ihr heranwuchsen, wie sie sich unter dieser blassen Hülle der Haut ausbreiteten. Zärtlich berührte er ihre Wange. Sie öffnete ihre blutunterlaufenen Augen und versuchte seinen Blick zu erwidern. »Ich bin’s«, flüsterte er. Er sah, dass sie sich gegen die Fesseln an ihren Handgelenken sträubte, und nahm ihre Hand in die seine. »Du musst den Arm stillhalten, Diana. Wegen des Zugangs.« »Ich kann dich nicht sehen.« Sie schluchzte. »Ich kann gar nichts sehen.« »Ich bin hier. Ich bin ganz nahe bei dir.« »Ich will nicht so sterben.« Die Tränen traten ihm in die Augen, und die Worte lagen ihm schon auf der Zunge, falsche Worte des Trostes; dass sie nicht sterben würde, dass er es nicht zulassen würde. Doch er brachte sie nicht über die Lippen. Sie waren immer ehrlich zueinander gewesen; und auch jetzt würde er sie nicht anlügen. Und so schwieg er. Sie sagte: »Ich hätte nie gedacht …« »Was?«, ermunterte er sie sanft. »Dass es … einmal so passieren würde. Keine Chance, den Helden zu spielen. Einfach nur krank und nutzlos.« Sie lachte, kurz auf und verzog gleich darauf vor Schmerzen das Gesicht. »Unter einem Abgang mit Glanz und Gloria … hatte ich mir etwas anderes vorgestellt.« Ein Abgang mit Glanz und Gloria. So stellte jeder Astronaut sich den Tod im Weltraum vor. Ein kurzer Augenblick des Schreckens, und dann das rasche Ende. Plötzlicher Druckabfall oder ein Brand. Nie hätten sie an einen Tod wie diesen gedacht – langsam und qualvoll einzugehen, während der Körper allmählich von einer fremden Lebensform verzehrt und verdaut wurde. Von der Erde im Stich gelassen. Still und leise dem Wohl der gesamten Menschheit geopfert. Verzichtbar. Für sich selbst konnte er das akzeptieren, aber er konnte nicht akzeptieren, dass Diana verzichtbar sein sollte. Er konnte nicht akzeptieren, dass er sie verlieren würde. Es war schwer zu glauben, dass sie ihm an dem Tag, an dem sie sich zum ersten Mal beim Training im JSC begegnet waren, kalt und abweisend vorgekommen war, eine unterkühlte Blondine mit übersteigertem Selbstbewusstsein. Ihr britischer Akzent hatte ihn auch gestört; er ließ sie so überheblich klingen. Überkorrekt und kultiviert im Vergleich zu seinem breiten texanischen Dialekt. Nach einer Woche war die gegenseitige Abneigung so ausgeprägt gewesen, dass sie kaum miteinander gesprochen hatten. In der dritten Woche hatten sie auf Gordon Obies Drängen widerstrebend Frieden geschlossen. Nach acht Wochen war Griggs bei ihr zu Hause aufgetaucht. Zuerst nur auf einen Drink; zwei Profis, die ihre bevorstehende Mission diskutierten. Dann war die Fachsimpelei Gesprächen von zunehmend persönlicher Natur gewichen: Griggs’ unglückliche Ehe. Die unzähligen Interessen, die er und Diana teilten. Am Ende hatte natürlich das Unvermeidliche gestanden. Sie hatten niemandem im JSC etwas von ihrer Affäre verraten. Erst hier in der Station war ihre Beziehung für ihre Kollegen, offensichtlich geworden. Hätte es zuvor auch nur den Hauch eines Verdachts gegeben, hätte Blankenship sie sofort von der Mission abgezogen. Selbst heutzutage galt eine Scheidung noch als Fleck auf der weißen Weste eines Astronauten. Und wenn diese Scheidung das Resultat einer Liaison mit einem anderen Mitglied des Korps war – nun, dann bedeutete dies für den Betreffenden das Ende aller Flugeinsätze. Griggs wäre zu einem unsichtbaren Korpsmitglied degradiert worden, für immer zu einem Schattendasein verurteilt. Er liebte sie seit zwei Jahren. Zwei Jahre lang hatte er sich nach ihr gesehnt, wenn er neben seiner schlafenden Frau gelegen hatte, und hatte hin und her überlegt, wie sie mehr Zeit zusammen verbringen konnten. Eines Tages würden sie zusammen sein, und wenn er dafür aus der NASA ausscheiden musste. Das war der Traum, der ihm geholfen hatte, all diese unglücklichen Nächte zu überstehen. Und auch nach diesen zwei Monaten auf engstem Raum, auch nachdem sie hier und da heftig aneinander geraten waren, hatte er nicht aufgehört, sie zu lieben. Er hatte den Traum nie aufgegeben. Bis zu diesem Moment. »Welcher Tag ist heute?«, murmelte sie. »Freitag.« Er strich ihr wieder sanft über das Haar. »In Houston ist es jetzt siebzehn Uhr dreißig. Happy Hour.« Sie lächelte. »Endlich Freitag!« »Jetzt sitzen sie gerade an der Bar. Chips und Margaritas. Mensch, so einen kräftigen Drink könnte ich jetzt auch gut gebrauchen. Und dazu ein toller Sonnenuntergang. Wir beide zusammen am See …« Die Tränen, die auf ihren Wimpern glitzerten, brachen ihm fast das Herz. Er scherte sich längst nicht mehr um biologische Kontamination; es war ihm gleich, ob er selbst Gefahr lief, sich anzustecken. Mit der bloßen Hand wischte er ihr die Tränen weg. »Hast du Schmerzen?«, fragte er. »Brauchst du noch mehr Morphium?«, »Nein. Heb es lieber auf.« Jemand anderes wird es bald brauchen, waren die Worte, die sie nicht aussprach. »Sag mir, was du willst. Was ich für dich tun kann.« »Durst habe ich«, sagte sie. »All das Gerede von Margaritas.« Er lachte. »Ich werde dir eine mixen. Die alkoholfreie Variante.« »Ja, bitte.« Er schwebte zur Kombüse und öffnete den Lebensmittel- schrank. Er war mit russischen Vorräten gefüllt, nicht mit den Produkten, die Griggs aus dem US-Modul kannte. Er sah eingelegten Fisch in Vakuumverpackung. Wurstkonserven. Ein Sortiment wenig appetitanregender russischer Grundnahrungs- mittel. Und Wodka – eine kleine Flasche, die die Russen heraufgeschickt hatten, angeblich zu medizinischen Zwecken. Das ist vielleicht unser letzter gemeinsamer Drink. Er schüttelte etwas Wodka in zwei Trinkbeutel und verstaute die Flasche wieder im Schrank. Dann fügte er Wasser hinzu, wobei er ihren Drink so stark verdünnte, dass er kaum noch Alkohol enthielt. Nur einen Tropfen für den Geschmack, dachte er, um glückliche Erinnerungen zu wecken und sie an die Abende zu erinnern, an denen sie zusammen auf ihrer Veranda gesessen und den Sonnenuntergang bewundert hatten. Er schüttelte die Beutel ein paar Mal kräftig, um das Wasser mit dem Wodka zu vermischen. Dann wandte er sich zu ihr um. Ein leuchtend roter Ballon aus Blut quoll aus ihrem Mund. Sie wand sich in Krämpfen. Sie hatte die Augen verdreht, und ihre Zähne hatten sich in ihre Zunge verbissen. Ein blutiges, abgerissenes Stück Fleisch hing nur noch an einem Faden. »Diana!«, schrie er. Der Blutballon löste sich, und die seidig glänzende Kugel schwebte davon. Sofort bildete sich der Nächste, genährt von dem Blut, das aus der zerfetzten Zunge strömte. Hastig griff er nach dem Mundsperrer aus Plastik, der mit, Klebstreifen am Behandlungstisch befestigt war, und versuchte ihn zwischen ihre Zähne zu schieben, damit sie sich nicht noch mehr verletzte. Doch er bekam ihre Zähne nicht auseinander. Die Kiefermuskeln gehören zu den stärksten im gesamten menschlichen Körper, und ihre waren jetzt vollkommen verkrampft. Er griff nach der fertig aufgezogenen Valiumspritze und schob die Nadel in den Pfropfen der IV-Kanüle. Er hatte den Kolben noch nicht ganz niedergedrückt, als der Krampfanfall bereits nachzulassen begann. Er injizierte ihr die ganze Dosis. Ihre Züge entspannten sich, und ihre Kiefermuskeln erschlafften. »Diana?«, sagte er. Sie antwortete nicht. Immer noch quoll Blut in einer riesigen Blase aus ihrem Mund. Er musste einen Druckverband anlegen, um die Blutung zu stillen. Er öffnete den Verbandskasten, fand die sterilen Mullbinden und riss hastig eine Packung auf. Einige der quadratischen Kissen wirbelten davon. Er schob sich hinter ihren Kopf und öffnete vorsichtig ihren Mund, um die zerbissene Zunge freizulegen. Sie hustete und versuchte das Gesicht abzuwenden. Sie drohte an ihrem eigenen Blut zu ersticken. »Nicht bewegen, Diana.« Mit dem rechten Handgelenk drückte er ihren Unterkiefer nieder, um ihren Mund offen zu halten, während er die Gaze mit der linken Hand zusammenknüllte und das Blut wegtupfte. Plötzlich erfasste ein erneuter Krampf ihren Körper, ihre Halsmuskeln spannten sich, und ihr Kiefer schnappte zu. Er schrie auf. Seine Hand war zwischen ihren Zähnen, und der unmittelbar einsetzende Schmerz war so heftig, dass ihm die Sinne zu schwinden begannen. Er spürte, wie warmes Blut in sein Gesicht spritzte, sah einen leuchtend roten Tropfen, hervorquellen. Sein Blut, gemischt mit dem ihren. Er versuchte sich loszureißen, doch ihre Zähne hatten sich zu tief in sein Fleisch gegraben. Das Blut strömte; die rote Kugel schwoll an, bis sie fast die Größe eines Basketballs hatte. Eine Arterie ist durchtrennt! Es gelang ihm nicht, ihren Kiefer aufzustemmen; durch den Krampf hatte sich der Muskel mit übermenschlicher Kraft zusammengezogen. Ihm wurde allmählich schwarz vor Augen. In seiner Verzweiflung rammte er ihr die freie Faust in die Zähne. Ihr Kiefer entspannte sich nicht. Er schlug erneut zu. Der Blutball zerstob zu einem Dutzend kleinerer Tropfen, die ihm ins Gesicht spritzten, in die Augen. Immer noch bekam er seine Hand nicht frei. Es war jetzt überall so viel Blut, dass er darin wie in einem See zu schwimmen schien und kaum noch frei atmen konnte. Blindlings ließ er seine Faust wieder auf ihr Gesicht niederfahren und hörte Knochen splittern, doch immer noch war seine Hand zwischen ihren Zähnen gefangen. Die Schmerzen waren überwältigend, schier unerträglich. Panik erfasste ihn; blind für alles andere dachte er nur noch daran, diesen Qualen ein Ende zu bereiten. Er wusste kaum, was er tat, als er sie noch einmal schlug. Und noch einmal. Mit einem Schrei riss er seine Hand endlich los und wurde vom Tisch weggeschleudert. Rote Fäden aus Blut schlängelten und wanden sich um ihn herum, während er mit der gesunden Hand sein aufgerissenes Handgelenk umklammert hielt. Er prallte mehrmals gegen die Wände, und es dauerte eine Weile, bis er sich wieder so weit unter Kontrolle hatte, dass er klar sehen konnte. Was er sah, war Dianas zerschmettertes Gesicht, ihre blutigen Zahnstümpfe. Die Verwüstung, die seine eigene Faust angerichtet hatte. Die Wände warfen seinen Verzweiflungsschrei zurück, füllten seine Ohren mit den Klagelauten aus seinem eigenen Mund., Was habe ich getan? Was habe ich getan? Er schwebte an ihre Seite und hielt ihr zerschlagenes Gesicht in den Händen. Die Schmerzen seiner eigenen Verletzung spürte er nicht mehr; sie schwanden restlos dahin angesichts des überwältigenden Entsetzens über seine eigene Tat. Erneut heulte er laut auf, diesmal aus Wut. Mit der Faust trommelte er gegen die Wand des Moduls. Zerriss die Plastikfolie, mit der die Luke abgedeckt war. Wir sterben doch sowieso alle! Dann fiel sein Blick auf den Instrumentenkasten. Er griff hinein und bekam ein Skalpell zu fassen. Dr. Todd Cutler starrte auf seine Konsole und wurde plötzlich von Panik gepackt. Der Bildschirm zeigte die Biotelemetrie- werte von Diana Estes. Ihre EKG-Kurve war eben zu einem Sägezahnmuster aus rasch aufeinander folgenden Zacken geworden. Zu seiner Erleichterung war der Zustand nicht von Dauer. Ebenso abrupt, wie es eingesetzt hatte, wich das Muster wieder einem schnellen Sinusrhythmus. »Flight«, sagte er, »ich sehe hier ein Problem mit dem Herzrhythmus meiner Patientin. Ihr EKG hat gerade fünf Sekunden lang eine Kammertachykardie angezeigt.« »Und das bedeutet?«, fragte Woody Ellis knapp. »Ein potenziell lebensbedrohlicher Rhythmus, wenn er über längere Zeit anhält. Im Moment ist sie wieder in einem Sinusrhythmus von zirka hundertdreißig. Das ist schneller als vorher. Nicht gefährlich, aber ich mache mir trotzdem Sorgen.« »Ihr Rat, Surgeon?« »Ich würde ihr Antiarrhythmika geben. Sie braucht Lidocain oder Amiodaron, intravenös. Sie haben beide Medikamente in ihrem Notfallset.« »Arnes und Watson sind noch draußen auf EVA. Griggs wird es ihr verabreichen müssen.«, »Ich werde ihn anleiten.« »Okay Capcom, wir brauchen eine Verbindung mit Griggs.« Während sie auf Griggs’ Antwort warteten, behielt Todd den Monitor genau im Auge. Was er sah, beunruhigte ihn. Dianas Puls beschleunigte sich: 135, 140. Jetzt schlug er kurzfristig auf 160 aus; die Anzeige war plötzlich verzerrt, entweder durch Bewegungen der Patientin oder durch elektrische Störungen. Was ging dort oben vor? Capcom meldete sich: »Commander Griggs antwortet nicht.« »Sie braucht das Lidocain«, sagte Todd. »Wir kriegen ihn nicht an die Strippe.« Entweder kann er uns nicht hören, oder er weigert sich zu antworten, dachte Todd. Griggs’ seelischer Zustand hatte ihnen in der letzten Zeit Sorgen gemacht. Hatte er sich jetzt so weit in sich zurückgezogen, dass er einen dringenden Funkruf ignorierte? Plötzlich fesselte die Bildschirmanzeige wieder seine Aufmerksamkeit. Diana Estes fiel in rascher Folge immer wieder in eine Kammertachykardie. Ihre Ventrikel kontrahierten so schnell, dass sie nicht mehr effektiv pumpen konnten. Sie konnten ihren Blutdruck nicht mehr aufrechterhalten. »Sie braucht das Medikament sofort!«, stieß er hervor. »Griggs antwortet nicht«, erwiderte der Capcom. »Dann holen Sie die EVA-Crew rein!« »Nein«, fuhr der Flight dazwischen. »Sie sind in einer heiklen Phase der Reparaturen. Wir können sie jetzt nicht unterbrechen.« »Ihr Zustand wird kritisch.« »Wenn wir die EVA-Crew jetzt reinholen, ist in den nächsten vierundzwanzig Stunden nichts mehr mit Reparaturen.« Die Crew konnte nicht einfach eben mal reingehen und das Raumschiff gleich darauf wieder verlassen. Sie brauchte eine gewisse Zeit, um sich zu erholen, und dann musste der Dekompressionszyklus wiederholt werden. Obwohl Woody Ellis es nicht aussprach,, dachte er wohl das Gleiche wie alle anderen im Raum: Selbst wenn sie die Crew zur Unterstützung herbeiriefen, würde das für Diana Estes kaum etwas ändern. Ihr Tod war nicht zu verhindern. Zu Todds Entsetzen verfiel das EKG jetzt in eine dauerhafte Kammertachykardie. Es erholte sich nicht mehr. »Es geht rapide bergab mit ihr!«, rief er. »Holen Sie sofort einen von ihnen rein! Holen Sie Watson!« Eine Sekunde zögerte Ellis. Dann sagte er: »Tun Sie’s.« Warum antwortet Griggs nicht? Voller Panik hangelte Emma sich so schnell es ging von Handgriff zu Handgriff am Hauptträger entlang. In ihrem Orlan- M-Anzug kam sie sich langsam und unbeholfen vor, und ihre Hände schmerzten von der Anstrengung, die es kostete, mit den klobigen Handschuhen zuzupacken. Die Reparaturarbeiten hatten sie bereits ermüdet; jetzt wurde das Futter ihres Anzugs aufs Neue von Schweiß durchtränkt, und ihre Muskeln zitterten vor Erschöpfung. »Griggs, antworten Sie! Verdammt, antworten Sie!« Immer noch kein Ton aus der ISS. »Wie ist Dianas Zustand?«, fragte sie schwer atmend. Sie hörte Todds Stimme antworten: »Immer noch Kammerflimmern.« »Mist.« »Hetz dich nicht ab, Watson. Werd nicht unvorsichtig.« »Sie packt es nicht mehr lange. Wo zum Teufel ist Griggs?« Sie war jetzt so außer Atem, dass sie kaum noch sprechen konnte. Sie zwang sich, nur darauf zu achten, den nächsten Handgriff nicht zu verfehlen und sich nicht in ihrer Schnur zu verheddern. Als sie von dem Träger klettern und mit einem Satz, auf die Leiter springen wollte, hielt sie plötzlich irgendetwas ruckartig fest. Ihr Ärmel war an einer Ecke der Arbeitsplattform hängen geblieben. Mach langsam. Du bringst dich noch um. Vorsichtig zupfte sie den Ärmel los und stellte fest, dass die Außenhaut unversehrt war. Ihr Herz raste immer noch, während sie die Leiter herunterkletterte und sich durch die Luke in die Druckschleuse schwang. Rasch zog sie die Klappe zu und öffnete das Druckausgleichsventil. »Sag schon was, Todd«, rief sie ungeduldig, während der Druck in der Schleuse sich wieder aufbaute. »Wie ist der Rhythmus?« »Sie hat jetzt grobes Kammerflimmern. Wir kriegen Griggs immer noch nicht dran.« »Wir verlieren sie!« »Ich weiß, ich weiß!« »Okay, ich bin jetzt bei dreihundertfünfzig Hektopascal …« »Die Dichtigkeitsprüfung. Die darfst du nicht übergehen.« »Dazu habe ich keine Zeit.« »Keine Abkürzungen, Watson, ist das klar?« Sie hielt inne und holte tief Luft. Todd hatte Recht. In der unwirtlichen Umgebung des Weltalls konnte man sich keine Schlamperei leisten. Sie führte die Dichtigkeitsprüfung durch, wartete ab, bis der Druck die erforderliche Höhe erreicht hatte, und öffnete dann die Luke, die zur Ausrüstungsschleuse führte. Dort zog sie rasch die Handschuhe aus. Der russische Orlan-M- Anzug ließ sich leichter ausziehen als der amerikanische EMU, aber es brauchte immer noch einige Zeit, bis man den »Rucksack« mit dem Lebenserhaltungssystem abgeschüttelt und sich aus dem Anzug geschält hatte. Ich schaffe es nicht, rechtzeitig bei ihr zu sein, dachte sie, während sie wild mit den Beinen ruderte, um sie aus dem unteren Anzugteil zu befreien., »Status, Surgeon!«, bellte sie in ihr Mikrofon. »Feines Kammerflimmern.« Ein letaler Rhythmus, dachte sie. Das war die letzte Gelegenheit, Diana zu retten. Nur mit ihrem wassergekühlten Innenanzug bekleidet, öffnete sie die Verbindungsluke zur Station. In ihrer Ungeduld, zu ihrer Patientin zu gelangen, stieß sie sich von der Wand ab und tauchte mit dem Kopf voran durch die Luke. Etwas Nasses spritzte ihr ins Gesicht und nahm ihr die Sicht. Sie verfehlte den Handgriff und prallte gegen die gegenüberliegende Wand. Einige Sekunden lang trieb sie verwirrt umher und kniff die gereizten Augen zusammen. Was habe ich da in die Augen bekommen?, dachte sie. Doch nicht etwa die Eier. Bitte keine Eier … Allmählich konnte sie wieder klarer sehen, doch es dauerte noch eine Weile, bis sie begriff, was sie da sah. Im Halbdunkel der Kapsel schwebten überall um sie herum gewaltige Kugeln umher. Sie spürte, wie etwas Feuchtes ihre Hand berührte, und blickte auf den schwärzlichen Klecks, der sich auf ihrem Ärmel ausbreitete, auf die dunklen Flecken, die an mehreren Stellen auf ihrer Thermowäsche auftauchten. Sie hielt den Ärmel unter einen Leuchtkörper. Es war ein Blutfleck. Entsetzt starrte sie auf die riesigen Kugeln, die im Dämmerlicht in der Luft hingen. Es waren so viele … Rasch verschloss sie die Luke, um zu verhindern, dass sich die Kontamination auf die Druckschleuse ausbreitete. Den Rest der Station abzuschotten war unmöglich, die Kugeln hatten sich überall ausgebreitet. Sie tauchte in das Wohnmodul, öffnete den Schrank mit der Schutzausrüstung und setzte Schutzbrille und Maske auf. Vielleicht war das Blut ja nicht infektiös. Vielleicht konnte sie sich noch schützen., »Watson?«, erklang Cutlers Stimme. »Blut … hier ist alles voller Blut!« »Diana hat jetzt ein Absterbe-EKG – es bleibt nicht mehr viel Zeit, sie wiederzubeleben!« »Ich bin schon unterwegs!« Sie schob sich aus dem Verbindungsknoten und tauchte in das tunnelartige Zarya- Modul ein. In der russischen Sektion war es im Vergleich zu dem schwach beleuchteten US-Teil blendend hell, und die umherschwebenden Blutstropfen wirkten wie grellbunte Luftballons. Einige waren mit den Wänden kollidiert und hatten leuchtend rote Flecken hinterlassen. Als sie am anderen Ende aus der Kapsel schoss, kam ihr eine riesige Blutblase in die Quere, der sie nicht rechtzeitig ausweichen konnte. Reflexartig schloss sie die Augen, als das Blut gegen ihre Schutzbrille spritzte und ihr die Sicht nahm. Blind umhertreibend wischte sie sich mit dem Ärmel über die Brille. Als sie wieder etwas sehen konnte, starrte sie direkt in das kalkweiße Gesicht von Michael Griggs. Sie stieß einen Schrei aus. In ihrem Entsetzen ruderte sie unkontrolliert mit den Armen in der Luft umher, ohne von der Stelle zu kommen. »Watson?« Ungläubig starrte sie auf die große Blutblase, die immer noch an seiner klaffenden Halswunde hing. Daher kam also das ganze Blut – aus seiner durchschnittenen Halsschlagader. Sie zwang sich, die unversehrte Seite seines Halses zu berühren, um nach dem Puls zu tasten. Sie fand keinen. »Dianas EKG ist jetzt völlig flach!« Fassungslos wandte Emma den Blick dem Eingang zum RSM zu, wo Diana isoliert sein sollte. Die Plastikfolie war weg; das Modul war nicht mehr vom Rest der Station abgetrennt. Starr vor Angst tauchte sie in das RSM., Diana lag immer noch angeschnallt auf dem Behandlungstisch. Ihr Gesicht war bis zur Unkenntlichkeit zerschmettert, ihre Zähne bis auf die Stümpfe ausgeschlagen. Ein Blutballon quoll aus ihrem Mund. Das Schrillen des Herzmonitors riss Emma schließlich aus ihrer Trance. Eine flache Linie zog über den Bildschirm. Sie streckte die Hand aus, um den Alarm abzustellen, und erstarrte mitten in der Bewegung. Auf dem Schalter klebte ein blaugrün schimmernder, gallertartiger Klumpen. Eier. Diana bat bereits Eier ausgeschieden. Die Chimäre ist schon in der Luft. Der Monitoralarm schwoll zu einem unerträglichen Kreischen an, doch Emma verharrte regungslos und starrte nur diese Traube von Eiern an. Sie schienen plötzlich zu schimmern und unscharf zu werden. Emma kniff die Augen zusammen, und sobald sie wieder klar sehen konnte, fiel ihr das feuchte Etwas wieder ein, das ihr entgegengeschlagen war, als sie durch die Luke der Druckschleuse getaucht war. Sie hatte zu diesem Zeitpunkt keine Schutzbrille getragen, und es hatte in ihren Augen gebrannt. Sie spürte die kalte und klebrige Feuchtigkeit immer noch an der Wange. Sie griff sich ins Gesicht, und einen Moment später sah sie die Eier, die wie zitternde Perlen an ihren Fingerspitzen klebten. Das Kreischen des Herzalarms war jetzt ohrenbetäubend. Sie schaltete den Monitor aus, und das Kreischen hörte auf. Doch die Stille, die darauf folgte, war nicht weniger alarmierend. Sie konnte das Zischen der Lüftung nicht hören. Die Ventilatoren hätten die Luft ansaugen und durch die Reinigungsfilter pumpen sollen. Es ist zu viel Blut in der Luft. Es hat alle Filter verstopft. Der stetig steigende Druck in den Filtern hatte den Sensormechanismus ausgelöst, der die überhitzten Ventilatoren daraufhin automatisch abgeschaltet hatte. »Watson, bitte antworten!«, sagte Todd., »Sie sind tot.« Ihre Stimme brach und wurde zu einem Schluchzen. »Sie sind beide tot!« Jetzt war Luthers Stimme über Funk zu hören. »Ich komme rein.« »Nein«, sagte sie. »Nein …« »Halt durch, Emma. Ich bin gleich bei dir.« »Luther, du kannst nicht reinkommen! Es ist alles voller Blut und Eier! Diese Station ist nicht mehr bewohnbar. Du musst in der Druckschleuse bleiben.« »Das ist keine Dauerlösung.« »Verdammt, es gibt keine Dauerlösung!« »Pass auf, ich bin jetzt in der Mannschaftsschleuse. Ich schließe die Außenluke, beginne mit dem Druckaufbau …« »Die Ventilatoren sind alle außer Betrieb. Es gibt keine Möglichkeit, die Luft zu reinigen.« »Ich bin jetzt bei dreihundertfünfzig Hektopascal. Unterbreche für Dichtigkeitsprüfung.« »Wenn du reinkommst, steckst du dich an!« »Gehe jetzt auf vollen Druck.« »Luther, ich bin schon angesteckt! Ich habe einen Spritzer in die Augen bekommen!« Sie holte tief Luft und stieß sie mit einem Schluchzer wieder aus. »Du bist der Einzige, der übrig ist. Der Einzige, der noch eine Überlebenschance hat.« Es war lange still. »Mein Gott, Emma«, murmelte er schließlich. »Okay Okay, hör mir zu.« Sie hielt inne, um sich zu sammeln. Um logisch denken zu können. »Luther, du gehst jetzt in die Ausrüstungsschleuse. Da drin dürfte es noch einigermaßen sauber sein, du kannst also deinen Helm abnehmen. Dann schaltest du dein Funkgerät aus.« »Was?« »Tu, was ich dir sage. Ich begebe mich jetzt in Node 1. Ich, werde gleich auf der anderen Seite der Luke sein und mit dir reden.« Jetzt schaltete Todd sich ein. »Emma? Emma, brecht die Funkverbindung nicht ab …« »Tut mir Leid, Surgeon«, murmelte sie und stellte ihr Funkgerät ab. Einen Augenblick später hörte sie Luthers Stimme über die Bordsprechanlage. »Ich bin jetzt in der Ausrüstungsschleuse.« Sie konnten sich jetzt unterhalten, ohne dass die Bodenkontrolle mithörte. »Du hast noch eine einzige Möglichkeit«, sagte Emma. »Die, auf die du die ganze Zeit gedrängt hast. Mir steht sie nicht mehr offen, dir schon. Du bist noch sauber. Du wirst die Krankheit nicht auf der Erde einschleppen.« »In dem Punkt waren wir uns doch einig. Niemand wird zurückgelassen.« »Du hast noch für drei Stunden unkontaminierte Luft in deinem EMU-Anzug. Wenn du im CRV den Helm aufbehältst und gleich auf Deorbit gehst, kannst du es noch rechtzeitig schaffen.« »Und du sitzt hier fest!« »Ich sitze sowieso hier fest!« Wieder holte sie tief Luft, und ihre Stimme klang jetzt ruhiger. »Hör zu, wir wissen beide, dass das gegen die Vorschriften verstößt. Vielleicht ist es eine ganz schlechte Idee. Wie sie reagieren, kann man nur vermuten – das ist das Risiko dabei. Aber es ist deine Wahl, Luther.« »Du hättest keine Möglichkeit mehr, hier wegzukommen.« »Über mich brauchst du dir keine Gedanken mehr zu machen. Vergiss mich einfach.« Leise fügte sie hinzu: »Ich bin bereits tot.« »Emma, nein …« »Was willst du tun? Die Frage musst du beantworten. Denk nur an dich.«, Sie hörte ihn tief durchatmen. »Ich will nach Hause.« Ich auch, dachte sie, gegen ihre Tränen ankämpfend. O Gott, das will ich auch. »Setz deinen Helm auf«, sagte sie. »Ich öffne die Luke.«, Jack eilte die Treppe zu Bau 30 hoch, hielt dem Posten kurz seine Marke unter die Nase und rannte weiter in Richtung Special Vehicle Operations. Gordon Obie trat ihm am Eingang des Kontrollraums in den Weg. »Einen Augenblick, Jack. Wenn Sie da reingehen und einen Aufstand machen, fliegen Sie gleich wieder raus. Warten Sie einen Moment, bis Sie sich etwas abgeregt haben, wenn Sie ihr irgendwie helfen wollen.« »Ich will, dass meine Frau sofort zurückkommt!« »Alle wollen, dass die Crew zurückkommt! Wir geben unser Bestes, aber die Situation ist jetzt eine völlig andere. Inzwischen ist die gesamte Station kontaminiert. Das Filtersystem ist ausgefallen. Die EVA-Crew hatte keine Gelegenheit, die Reparatur der Kardanaufhängung abzuschließen, sodass die Stromversorgung immer noch eingeschränkt ist. Und jetzt reden sie nicht mehr mit uns.« »Was?« »Emma und Luther haben die Kommunikation abgebrochen. Wir wissen nicht, was da oben vor sich geht. Deshalb haben die Sie so schnell zurückgeholt – Sie sollen uns helfen, zu ihnen durchzukommen.« Jack starrte durch die offene Tür in den SVO-Kontrollraum. Er sah Männer und Frauen an ihren Konsolen, die wie immer ihre Pflicht taten, und es machte ihn plötzlich wütend, dass diese Controller so ruhig und besonnen bleiben konnten. Dass der Tod von zwei weiteren Astronauten absolut keinen Einfluss auf ihre kühle Professionalität zu haben schien. Die abgeklärte Haltung der anderen verstärkte seinen Schmerz und sein Entsetzen noch. Er betrat den Kontrollraum. Zwei Air-Force-Offiziere in, Uniform standen neben Flugdirektor Woody Ellis und überwachten die Kommunikation. Ihre Anwesenheit erinnerte auf beunruhigende Weise daran, dass die NASA hier nicht mehr das Sagen hatte. Einige der Controller warfen Jack mitfühlende Blicke zu, als er an der hinteren Konsolenreihe vorbei auf den Platz des Flight Surgeon zusteuerte. Er sagte nichts, sondern ließ sich einfach nur auf den Stuhl neben Todd Cutler fallen. Ihm war bewusst, dass gleich hinter ihm auf der Besuchergalerie weitere Air-Force-Offiziere vom US-Raumfahrtkommando standen und den Raum beobachteten. »Bist du auf dem Laufenden?«, fragte Todd leise. Jack nickte. Auf dem Monitor war kein EKG mehr zu sehen. Diana war tot, genau wie Griggs. »Die halbe Station ist immer noch auf Notstrom. Und jetzt fliegen auch noch die Eier in der Luft rum.« Und das Blut. Jack konnte sich ausmalen, wie es an Bord der Station aussah. Die gedämpfte Beleuchtung. Der Geruch des Todes. Blut an den Wänden und in den HEPA-Filtern. Ein fliegendes Horrorkabinett. »Wir müssen unbedingt mit ihr reden, Jack. Wir müssen sie dazu bringen, dass sie uns erzählt, was da oben vor sich geht.« »Warum sagen sie nichts mehr?« »Wir wissen es nicht. Vielleicht sind sie sauer auf uns. Sie haben allen Grund dazu. Vielleicht sind sie vollkommen traumatisiert.« »Nein, sie müssen einen bestimmten Grund haben.« Jack blickte auf den großen Monitor an der Stirnwand, der die Flugbahn der Station um die Erde zeigte. Was denkst du, Emma? Er setzte sich den Kopfhörer auf und sagte: »Capcom, hier Jack McCallum. Ich bin so weit.« »Roger, Surgeon. Halten Sie sich bereit, wir versuchen es noch einmal.«, Sie warteten. Die ISS antwortete nicht. In der dritten Konsolenreihe drehten zwei Controller sich plötzlich um und schauten Flugdirektor Ellis an. Jack hörte nicht, was gesprochen wurde, doch er sah, wie der Odin- Controller, der für die Computersysteme an Bord verantwortlich war, aufstand und sich vorbeugte, um den Controllern in der zweiten Reihe etwas zuzuflüstern. Jetzt nahm der OPS-Controller in der dritten Reihe seinen Kopfhörer ab, stand auf und streckte sich. Dann ging er mit beiläufiger Miene den Seitengang entlang, so als müsse er mal eben austreten. Als er an der Konsole des Surgeon vorbeikam, ließ er unauffällig einen Zettel in Todd Cutlers Schoß fallen und ging weiter Richtung Tür. Todd faltete den Zettel auseinander, las ihn und sah Jack fassungslos an. »Die Computer der Station sind auf ASCR- Modus rekonfiguriert worden«, flüsterte er. »Die Crew hat die CRV-Abkopplungssequenz eingeleitet.« Jack starrte ihn ungläubig an. ASCR oder Assured Safe Crew Return war die Computerkonfiguration, mit der die Evakuierung der Crew unterstützt werden sollte. Er sah sich rasch im Raum um. Kein Controller ließ ein Wort darüber fallen. Alles, was Jack sah, waren Reihen gestraffter Schultern; alle Augen waren starr auf die Konsolen gerichtet. Er warf einen Seitenblick auf Woody Ellis. Ellis stand absolut reglos da. Seine Körpersprache verriet alles. Er weiß, was los ist. Und auch er wird nichts sagen. Jack brach der Schweiß aus. Also deshalb sagte die Crew nichts mehr. Sie hatten ihre eigene Entscheidung getroffen, und sie zogen sie durch. Die Air Force würde nicht mehr lange im Dunkeln tappen. Mit ihrem Weltraum-Überwachungsnetz aus Radar und optischen Sensoren konnte sie Gegenstände von der Größe eines Baseballs ausmachen, wenn sie sich auf einer niedrigen Erdumlaufbahn befanden. Sobald das CRV sich abkoppelte, sobald es als unabhängiges Objekt im Orbit kreiste,, würde das Kontrollzentrum des Raumfahrtkommandos im Luftstützpunkt Cheyenne Mountain es entdecken. Die Preisfrage war: Wie würden sie reagieren? Ich hoffe bei Gott, dass du weißt, was du tust, Emma. Nach der Abkopplung des CRV dauerte es fünfundzwanzig Minuten, die Steuerungs- und Landedaten des Raumgleiters einzustellen, weitere fünfzehn Minuten wurden für die Vorbereitung der Wiedereintrittszündung gebraucht. Eine weitere Stunde bis zur Landung. Lange bevor das CRV zur Landung ansetzen konnte, hatte das US-Raumfahrtkommando es identifiziert und seine Flugbahn verfolgt. In der zweiten Reihe hob der OSO-Controller flüchtig eine Hand mit ausgestrecktem Daumen. Mit dieser Geste teilte er den anderen heimlich mit, dass der Raumgleiter abgekoppelt hatte. Ganz gleich, wie es ausgehen würde, die Crew war auf dem Weg nach Hause. Das Spiel kann beginnen. Die Spannung im Raum stieg. Jack riskierte einen Blick auf die beiden Air-Force-Offiziere, doch die Männer schienen nichts zu ahnen; einer von ihnen sah immer wieder auf die Uhr, als wäre er am liebsten woanders. Die Minuten verstrichen; es war merkwürdig still im Raum. Jack beugte sich vor; sein Herz hämmerte wild, und sein Hemd war schweißnass. Inzwischen hatte das CRV den Schutz der Raumstation verlassen, seinen Landepunkt identifiziert und sein Steuerungssystem auf die GPS-Satelliten eingestellt. Los, nun macht schon, dachte Jack. Ihr müsst jetzt auf Deorbit gehen! Das Klingeln eines Telefons zerriss die Stille. Jack blickte zur Seite und sah, wie einer der Offiziere den Hörer abnahm. Seine Züge erstarrten plötzlich, und er wandte sich an Woody Ellis. »Was geht hier vor, zum Teufel?«, Ellis schwieg. Der Offizier drückte einige Tasten an Ellis’ Konsole und starrte ungläubig auf den Monitor. Dann griff er wieder nach dem Hörer. »Ja, Sir. Ich muss das leider bestätigen. Das CRV hat abgekoppelt. Nein, Sir, ich weiß nicht, wie es … Ja, Sir, wir haben den Funkverkehr überwacht, aber …« Schwitzend und mit hochrotem Gesicht hörte sich der Offizier die Tirade an, die aus dem Hörer drang. Als er wieder auflegte, bebte er vor Zorn. »Lassen Sie es umkehren!«, befahl er. Woody Ellis antwortete mit kaum verhüllter Verachtung. »Das ist keine Sojus-Kapsel. Sie können es nicht hin und her fahren lassen wie ein verdammtes Auto.« »Dann hindern Sie es an der Landung!« »Das können wir nicht. Es ist auf einer Einbahnstraße zur Erde.« Drei weitere Air-Force-Offiziere kamen in den Raum gestürmt. Jack erkannte General Gregorian vom US-Raumfahrt- kommando – den Mann, der jetzt für die NASA-Operationen verantwortlich war. »Wie ist der Status?«, bellte Gregorian. »Das CRV hat abgekoppelt, befindet sich aber noch in der Umlaufbahn«, erwiderte der rotgesichtige Offizier. »Wann wird es in die Atmosphäre eintreten?« »Ah … diese Information liegt mir nicht vor, Sir.« Gregorian wandte sich an den Flugdirektor. »Wann genau, Mr. Ellis?« »Das kommt darauf an. Es gibt eine Reihe von Optionen.« »Halten Sie mir keine Vorträge über Raumfahrttechnik, verdammt noch mal! Ich will eine Antwort. Eine Zahl.« »Okay« Ellis richtete sich auf und sah ihm fest in die Augen. »Irgendwann zwischen einer und acht Stunden. Das liegt an der, Crew. Sie können für maximal vier Erdumdrehungen im Orbit bleiben. Sie können aber auch sofort abbrechen und innerhalb einer Stunde landen.« Gregorian griff nach dem Telefonhörer. »Mr. President, ich fürchte, es bleibt nicht viel Zeit zum Überlegen. Sie könnten die Umlaufbahn jeden Moment verlassen. Ja, Sir, ich weiß, dass es eine schwere Entscheidung ist. Aber meine Empfehlung ist immer noch dieselbe wie die von Mr. Profitt.« Welche Empfehlung?, dachte Jack mit einer Aufwallung von Panik. Ein Offizier an einer der Konsolen rief: »Sie haben die Wiedereintrittszündung eingeleitet!« »Wir haben keine Zeit zu verlieren, Sir«, sagte Gregorian. »Wir brauchen Ihre Antwort jetzt.« Eine lange Pause trat ein. Dann nickte er, offensichtlich erleichtert. »Sie haben die richtige Entscheidung getroffen. Ich danke Ihnen.« Er legte auf und wandte sich an die Air-Force-Offiziere. »Alles klar.« »Was ist klar?«, fragte Ellis. »Was haben Sie eigentlich vor?« Seine Fragen wurden ignoriert. Der Offizier griff wieder nach dem Hörer und sagte: »EKV-Einsatz vorbereiten.« Was zum Teufel ist ein EKV?, überlegte Jack. Er sah Todd an und erkannte an dessen verständnisloser Miene, dass auch er nicht wusste, was da zum Einsatz kommen sollte. Es war Topo, der Controller für die Flugbahnberechnung, der auf ihre Konsole zukam und die Frage leise beantwortete. »Exoatmospheric Kill Vehicle. Sie werden sie abfangen.« »Das Ziel muss neutralisiert werden, bevor es in die Atmosphäre eindringt.« Jack sprang bestürzt auf. »Nein!« Fast gleichzeitig erhoben sich andere Controller protestierend, von ihren Stühlen. Ihre Rufe übertönten fast die Stimme des Capcom, der aus vollem Hals schreien musste, um sich verständlich zu machen. »Ich habe die ISS dran! Ich habe die ISS dran!« ISS? Dann ist noch jemand an Bord der Station. Irgendjemand wurde zurückgelassen. Jack hielt die hohle Hand über seine Kopfhörermuschel und lauschte auf die Stimme, die über Funk kam. Es war Emma. »Houston, hier ist Watson an Bord der ISS. Mission Specialist Ames ist nicht infiziert. Ich wiederhole, er ist nicht infiziert. Er ist das einzige Crewmitglied an Bord des CRV Ich bitte Sie dringend, das Fahrzeug sicher landen zu lassen.« »Roger, ISS«, sagte der Capcom. »Sehen Sie? Es gibt keinen Grund, es abzuschießen«, sagte Ellis zu Gregorian. »Brechen Sie Ihren EKV-Einsatz ab!« »Woher wissen wir, dass Watson die Wahrheit sagt?«, konterte Gregorian. »Sie muss die Wahrheit sagen! Weshalb wäre sie sonst zurückgeblieben? Sie hat sich gerade jede Möglichkeit zur Rückkehr genommen. Das CRV war das einzige Rettungsboot, das sie hatte!« Die Worte betäubten Jack. Die hitzige Debatte zwischen Ellis und Gregorian schien in den Hintergrund zu treten. Das Schicksal des CRV interessierte Jack plötzlich nicht mehr. Er konnte nur noch an Emma denken, die jetzt allein in der Station gefangen war, ohne jede Chance, zu entkommen. Sie weiß, dass sie infiziert ist. Sie ist zum Sterben zurückgeblieben. »Das CRV hat den Deorbit Burn abgeschlossen. Es ist im Sinkflug. Die Flugbahn ist auf dem Großbildschirm zu sehen.« Über die Weltkarte an der Stirnwand des Kontrollraums bewegte sich ein kleiner Lichtfleck, der das CRV und seinen einzigen Passagier darstellte. Jetzt hörten sie ihn auch über Funk., »Hier ist Mission Specialist Luther Arnes. Ich nähere mich der Eintrittshöhe. Alle Systeme normal.« Der Air-Force-Offizier sah Gregorian an. »Wir sind immer noch bereit für den EKV-Abschuss.« »Sie müssen das nicht tun«, sagte Woody Ellis. »Er ist nicht krank! Wir können ihn nach Hause bringen!« »Das Fahrzeug selbst ist sehr wahrscheinlich kontaminiert«, erwiderte Gregorian. »Das können Sie nicht wissen!« »Ich kann dieses Risiko nicht eingehen. Ich kann nicht das Leben von Menschen auf der Erde aufs Spiel setzen.« »Um Himmels willen, das ist Mord!« »Er hat Befehle missachtet. Er wusste, wie die Antwort lauten würde!« »Die EKVs sind abgefeuert, Sir.« Im Raum wurde es totenstill. Woody Ellis starrte geschockt auf den Großbildschirm, wo jetzt mehrere Flugbahnen zu sehen waren, die alle auf einen einzigen Schnittpunkt zurasten. Die Minuten vergingen in tiefem Schweigen. Vorne im Raum begann eine Frau leise zu schluchzen. »Houston, ich stehe jetzt kurz vor dem Eintritt.« Es war wie ein Schock, im Rauschen und Knacken der Funkleitung plötzlich Luthers fröhliche Stimme zu hören. »Ich wäre echt dankbar, wenn mich da unten jemand in Empfang nehmen könnte. Alleine komme ich nämlich nicht aus diesem EMU-Teil raus.« Niemand antwortete. Niemand hatte die Nerven dazu. »Houston?«, meldete sich Luther nach einer Weile erneut. »Hallo, seid ihr noch da?« Schließlich brachte der Capcom es fertig, mit brüchiger Stimme zu antworten: »Äh, Roger, CRV Wir werden mit einem kühlen Bier auf Sie warten, Luther, alter Kamerad. Und mit, Revuetänzerinnen und dem ganzen Kram …« »Wow, ihr seid ja plötzlich viel lockerer als bei unserer letzten Unterhaltung! Okay, jetzt komme ich wohl gleich in den Funkschatten. Also, haltet das Bier schön kalt, und …« Ein lautes statisches Rauschen. Dann brach die Verbindung ab. Der Lichtfleck auf dem Großbildschirm explodierte in einem schockierenden Feuerwerk kleinster Fragmente, zerfiel in eine Staubwolke von Pixeln. Woody Ellis sackte in seinem Stuhl zusammen und ließ den Kopf in die Hände sinken. 19. August »Boden-Bord-Verbindung wird gesichert«, sagte der Capcom. »Halten Sie sich bereit, ISS.« Sprich mit mir, Jack. Bitte sprich mit mir, flehte Emma stumm, während sie im Halbdunkel des Wohnmoduls schwebte. Ohne das Geräusch der Lüftungsventilatoren war es so still, dass sie das Rauschen ihres eigenen Blutes und das Zischen ihres Atems hören konnte. Sie schreckte auf, als die Stimme des Capcom plötzlich sagte: »Boden-Bord-Verbindung gesichert. Private Konferenz- schaltung kann beginnen.« »Jack?«, sagte sie. »Ich bin da. Ich bin da, mein Schatz.« »Er war nicht infiziert! Ich habe ihnen gesagt, dass er nicht infiziert war …« »Wir haben versucht, es zu verhindern! Der Befehl kam direkt vom Weißen Haus. Sie wollten keinerlei Risiko eingehen.« »Es ist meine Schuld.« In ihrer Erschöpfung brach sie plötzlich in Tränen aus. Sie war allein und hatte Angst. Und ihre, katastrophale Fehlentscheidung ließ ihr keine Ruhe. »Ich dachte, sie würden ihn landen lassen. Ich dachte, so hätte er die größte Chance, am Leben zu bleiben.« »Warum bist du nicht mitgeflogen, Emma?« »Ich musste hier bleiben.« Sie holte tief Luft und sagte: »Ich bin infiziert.« »Du warst dem Organismus ausgesetzt. Das heißt noch nicht, dass du infiziert bist.« »Ich habe gerade meine Blutwerte gemessen. Mein Amylasespiegel ist erhöht.« Er schwieg. »Seit dem Kontakt sind acht Stunden vergangen. Ich dürfte noch zwischen vierundzwanzig und achtundvierzig Stunden haben, bis ich … meine Funktionsfähigkeit verliere.« Ihre Stimme war jetzt fester. Sie klang merkwürdig ruhig, als ob sie über den bevorstehenden Tod eines Patienten redete. Nicht über ihren eigenen. »Das gibt mir genügend Zeit, einige Dinge in Ordnung zu bringen. Die Leichen über Bord zu werfen. Ein paar von den Filtern auszuwechseln und die Ventilatoren wieder in Gang zu bringen. Das sollte es für die nächste Crew etwas leichter machen, hier aufzuräumen. Falls es eine nächste Crew gibt …« Jack sagte immer noch nichts. »Was meine eigenen Überreste betrifft …« In ihrer Stimme lag jetzt nüchterne Resignation, keine Spur von Emotionalität. »Wenn es so weit ist, ist es für die Station wohl das Beste, wenn ich nach draußen gehe. Da werde ich nichts kontaminieren, wenn ich sterbe. Wenn meine Leiche …« Sie hielt inne. »Den Orlan-Anzug kann ich auch ohne Hilfe mühelos anlegen. Ich habe Valium und Schmerzmittel zur Hand. Genug, um mich zu betäuben. Sodass ich schlafe, wenn mir der Sauerstoff ausgeht. Weißt du, Jack, das ist gar kein so schlechter, Abgang, wenn man sich das mal überlegt. Da draußen zu schweben. Die Erde und die Sterne zu sehen. Und einfach so einzuschlafen …« Jetzt konnte sie ihn hören. Er weinte. »Jack«, sagte sie leise. »Ich liebe dich. Ich weiß nicht, warum es mit uns so weit gekommen ist. Ich weiß nur, dass es zum Teil meine Schuld ist.« Sie hörte seinen zitternden Atem. »Emma, sag so was nicht!« »Es war so dumm von mir, so lange damit zu warten. Du denkst sicher, ich sage das jetzt nur, weil ich bald sterbe. Aber Jack, ich schwöre dir, in Wahrheit …« »Du wirst nicht sterben.« Er wiederholte es, diesmal mit Zorn in der Stimme. »Du wirst nicht sterben!« »Du hast von Dr. Romans Ergebnissen gehört. Nichts hat gewirkt.« »Doch. Die Überdruckkammer.« »Eine Überdruckkammer können sie nicht rechtzeitig hier hoch schaffen. Und ohne Rettungsboot kann ich nicht zurückkehren. Selbst wenn sie mich ließen.« »Es muss eine Möglichkeit geben. Irgendeine Methode, wie du den Effekt der Kammer reproduzieren kannst. Es funktioniert bei infizierten Mäusen. Es hält sie am Leben, also muss es irgendetwas bewirken. Sie sind die Einzigen, die überlebt haben.« Nein, fiel ihr plötzlich ein. Nicht die Einzigen. Langsam drehte sie sich um und starrte auf die Luke, die zum Verbindungsknoten 1 führte. Die Maus, dachte sie, ob sie noch lebt? »Emma?« »Bleib dran. Ich muss im Labor etwas nachsehen.« Sie schwamm durch Node 1 hindurch ins US-Labor. Auch hier, roch es intensiv nach Blut, und selbst im Dämmerlicht konnte sie die dunklen Flecken an den Wänden erkennen. Sie schwebte auf das Tierhabitat zu, zog den Mäusekäfig heraus und leuchtete mit einer Taschenlampe hinein. Der Strahl zeigte ihr einen erbarmungswürdigen Anblick. Der angeschwollene Körper der Maus zuckte im Todeskampf. Mit weit offenem Mund schnappte sie nach Luft und ruderte wild mit den Beinen. Du darfst nicht sterben, dachte sie. Du bist die Überlebenskünstlerin, die eine große Ausnahme. Der Beweis, dass es für mich noch Hoffnung gibt. Die Maus drehte und wand sich in Todesqualen. Ein Blutfaden sickerte zwischen ihren Hinterbeinen hervor und zerfiel in umherwirbelnde Tröpfchen. Emma wusste, was als Nächstes kam: der letzte große Krampfanfall, wenn das Gehirn schließlich zu einem Brei verdauter Proteine zerfiel. Sie sah, wie ein neuer Strom von Blut das Hinterteil der Maus rot färbte. Und dann sah sie plötzlich etwas anderes, etwas Rosiges, das zwischen den Beinen herausragte. Es bewegte sich. Die Maus zappelte erneut. Das rosafarbene Ding glitt ganz heraus, ein sich windendes, haarloses Etwas. An seinem Bauch hing eine glitzernde Schnur. Eine Nabelschnur. »Jack«, flüsterte sie. »Jack!« »Ich höre dich.« »Die Maus … das Weibchen …« »Was ist mit ihr?« »Sie war die letzten drei Wochen wieder und wieder der Chimäre ausgesetzt, und sie ist nicht erkrankt. Sie ist die Einzige, die überlebt hat.« »Sie lebt immer noch?«, »Ja. Und ich denke, ich weiß, warum. Sie war schwanger.« Der Körper der Maus krampfte sich wieder zusammen. Ein zweites Junges schlüpfte in einer schimmernden Hülle von Blut und Schleim heraus. »Es muss in der Nacht passiert sein, als Kenichi sie aus Versehen zu den Männchen gesetzt hat«, sagte sie. »Ich habe sie nicht angefasst. Ich habe nicht daran gedacht …« »Warum sollte die Schwangerschaft etwas ändern? Warum sollte sie eine Schutzwirkung haben?« Emma schwebte im Halbdunkel des Labors und suchte angestrengt nach einer Antwort. Die ungewohnten Außenbordarbeiten und der Schock von Luthers Tod hatten sie physisch völlig ausgelaugt. Sie wusste, dass Jack ebenso erschöpft war. Zwei übermüdete Gehirne, die gemeinsam gegen die tickende Zeitbombe von Emmas Infektion ankämpften. »Okay. Okay, denken wir mal über die Schwangerschaft nach«, sagte sie. »Es ist ein komplexer physiologischer Vorgang. Es ist mehr als das Heranreifen eines Fötus. Der ganze Stoffwechsel ändert sich.« »Hormone. Bei schwangeren Tieren werden verstärkt Hormone ausgeschüttet. Wenn wir diesen Zustand imitieren könnten, könnten wir die physiologischen Vorgänge reproduzieren, die in dieser Maus stattgefunden haben.« Hormontherapie. Sie dachte an die vielen verschiedenen chemischen Substanzen, die im Körper einer schwangeren Frau zirkulieren: Östrogen, Progesteron, Prolaktin, Choriongon- adotropin. »Antibabypillen«, sagte Jack. »Mit kontrazeptiven Hormonen könntest du eine Schwangerschaft nachahmen.« »Wir haben nichts dergleichen an Bord. Das gehört nicht zur medizinischen Ausstattung.« »Hast du in Dianas persönlichem Fach nachgesehen?«, »Sie hätte ohne mein Wissen keine Verhütungsmittel genommen. Ich war ihre Ärztin. Ich hätte davon erfahren.« »Sieh trotzdem nach. Mach schon, Emma.« Sie schoss aus dem Labor. Im RSM riss sie hastig die Schubladen von Dianas Schrank auf. Es kam ihr falsch vor, in den Habseligkeiten einer anderen Frau herumzuwühlen, selbst wenn die Frau tot war. Zwischen den sorgsam zusammen- gefalteten Kleidern entdeckte sie einen privaten Bonbonvorrat. Sie hatte nicht gewusst, dass Diana Süßigkeiten gemocht hatte – es gab so vieles, was sie über Diana nicht wusste und nun nie erfahren würde. In einer anderen Schublade fand sie Shampoo, Zahnpasta und Tampons. Keine Antibabypillen. Sie stieß die Schublade wieder hinein. »In dieser Station gibt es nichts, womit ich etwas anfangen könnte.« »Wenn wir morgen mit dem Shuttle starten – und dir die Hormone bringen …« »Das werden die niemals tun! Und wenn ihr mir eine ganze Apotheke raufschickt, es würde trotzdem drei Tage dauern, bis ich an das Zeug käme!« In drei Tagen war sie wahrscheinlich tot. Schwer keuchend klammerte sie sich an den blutbespritzten Schrank, ihr ganzer Körper war vor Frustration – und vor schierer Verzweiflung – völlig verspannt. »Dann müssen wir die Sache eben anders angehen«, sagte Jack. »Lass mich jetzt nicht im Stich, Emma! Du musst mir beim Nachdenken helfen.« Sie atmete hörbar aus. »Ich gehe schon nicht weg.« »Warum können Hormone eine solche Wirkung haben? Was ist der Mechanismus? Wir wissen, dass es sich dabei um chemische Signale handelt, ein internes Kommunikationssystem auf Zellebene. Sie funktionieren, indem sie die Genexpression aktivieren oder unterdrücken. Indem sie die Programmierung, der Zelle verändern …« Er spekulierte jetzt wild drauflos, ließ sich durch seinen Gedankenfluss auf die Lösung zutreiben. »Damit ein Hormon funktionieren kann, muss es einen bestimmten Rezeptor in der Zielzelle binden. Es ist wie ein Schlüssel, der auf der Suche nach dem passenden Schloss ist. Wenn wir uns die Daten von SeaScience genauer ansehen – wenn wir herausfinden, welche andere DNS Dr. Koenig auf das Genom dieses Organismus aufgepfropft hat –, vielleicht erfahren wir dann, wie wir die Vermehrung der Chimäre unterbinden können.« »Was wissen wir über Dr. Koenig? Worüber hat sie sonst noch geforscht? Das könnte uns einen Hinweis geben.« »Wir haben ihren Lebenslauf. Wir haben ihre veröffentlichten Artikel über die Archäen gesehen. Abgesehen davon ist sie uns eigentlich ein Rätsel. Genau wie SeaScience. Wir versuchen immer noch, weitere Informationen aufzutreiben.« Das nimmt kostbare Zeit in Anspruch, dachte sie. Und ich habe nicht mehr viel Zeit. Ihre Hände schmerzten, so fest hatte sie sich an Dianas Schrank geklammert. Jetzt ließ sie los und schwebte, wie auf einer Welle der Verzweiflung getragen, davon. Einzelne Gegenstände aus der Schublade flogen um sie herum durch die Luft, Zeugen von Dianas Vorliebe für Süßes. Schokoriegel. M&M’s. Eine Zellophantüte mit kandierten Bonbons. Emmas Blick blieb an der Tüte hängen. Crystallized Ginger stand darauf. Kristalle. »Jack«, sagte sie. »Ich habe eine Idee.« Ihr Herz raste, als sie aus dem russischen Modul schwamm und wieder auf das US-Labor zuschoss. Dort schaltete sie den Nutzlastcomputer ein. Das bernsteingelbe Leuchten des Monitors wirkte im Dämmerlicht des Moduls ziemlich unheimlich. Sie rief die Dateiordner mit den Betriebsanleitungen auf und klickte auf, »ESA« für European Space Agency. Hier befanden sich alle Protokolle und Referenzmaterialien für die Durchführung der Experimente der Europäischen Raumfahrtbehörde. »Was hast du im Sinn, Emma?«, erklang Jacks Stimme in ihrem Kopfhörer. »Diana hat über das Wachstum von Eiweißkristallen gearbeitet, erinnerst du dich? Pharmazeutische Forschung.« »Was für Eiweiße?«, fragte er prompt zurück, und sie wusste, dass er begriffen hatte, woran sie dachte. »Ich gehe gerade die Liste durch. Es sind Dutzende …« Die Namen der Proteine flimmerten mit Schwindel erregendem Tempo über den Bildschirm. Dann blieb der Cursor an dem Eintrag hängen, den sie gesucht hatte: »Choriongonadotropin.« »Jack«, sagte sie leise. »Ich glaube, ich habe gerade ein wenig Zeit gewonnen.« »Was hast du da?« »HCG. Diana hat die Kristalle gezüchtet. Ich müsste eine IVA machen, um dranzukommen. Sie sind im ESA-Modul, und da herrscht Vakuum. Aber wenn ich sofort mit der Druckab- senkung anfange, habe ich diese Kristalle in vier bis fünf Stunden.« »Wie viel HCG ist an Bord?« »Ich sehe mal nach.« Sie rief die Daten für das Experiment auf und überflog die Messdaten. »Emma?« »Gleich, gleich! Hier habe ich die neueste Massenzahl. Jetzt muss ich nachsehen, wie der normale HCG-Wert während der Schwangerschaft ist.« »Die Angabe kann ich dir besorgen.« »Nein, ich habe sie schon. Okay Gut, wenn ich diese Kristallmasse in normaler Salzlösung verdünne … mein, Körpergewicht mit fünfundvierzig Kilo eingebe …« Sie tippte die Zahlen ein. Sie konnte im Grunde nur wilde Vermutungen anstellen. Sie wusste weder, wie schnell das HCG metabolisiert werden würde, noch wie seine Halbwertszeit war. Endlich erschien die Antwort auf dem Monitor. »Wie viele Dosen?«, fragte Jack. Sie schloss die Augen. Es wird nicht lange reichen. Es wird mich nicht retten. »Emma?« Sie hatte die Luft angehalten, und jetzt ließ sie sie mit einem Schluchzen entweichen. »Drei Tage.«, DER URSPRUNG, Es war 1 Uhr 45, und Jack konnte vor Übermüdung kaum noch richtig sehen; die Wörter auf dem Computerbildschirm verschwammen vor seinen Augen. »Da muss es noch mehr geben«, sagte er. »Suchen Sie weiter.« Gretchen Liu, die an der Tastatur saß, sah frustriert zu Jack und Gordon auf. Sie war fest am Schlafen gewesen, als die beiden sie angerufen hatten, um sie herzubitten, und sie war ohne ihr übliches kameragerechtes Make-up und ohne ihre Kontaktlinsen gekommen. Die beiden hatten ihre sonst so schicke Pressesprecherin noch nie in so unvorteilhafter Aufmachung gesehen. Und auch noch nie mit Brille – einer Hornbrille mit dicken Gläsern, die ihre zusammengekniffenen Augen stark vergrößerten. »Wenn ich es Ihnen doch sage, mehr kann ich nicht finden. Es gibt fast nichts über Helen Koenig. Und von SeaScience nur die üblichen Pressemitteilungen der Firma selbst. Und was den Namen Palmer Gabriel betrifft, nun, Sie sehen ja selbst, dass er nicht gerade das Licht der Öffentlichkeit sucht. In den letzten fünf Jahren taucht sein Name nur einmal in den Medien auf, und zwar auf den Finanzseiten des Wall Street Journal. Wirtschaftsartikel über SeaScience und seine Produkte. Keine biographischen Angaben. Es gibt nicht einmal ein Foto von dem Mann.« Jack ließ sich in seinen Stuhl fallen und rieb sich die Augen. Die drei hatten in den vergangenen zwei Stunden zusammen im Pressebüro das gesamte Lexis-Nexis-Netz nach Artikeln über Helen Koenig und SeaScience durchkämmt. Sie hatten zahlreiche Treffer für SeaScience gelandet, Dutzende von Artikeln gefunden, in denen Produkte der Firma erwähnt wurden, von Shampoos über Pharmazeutika bis hin zu Düngemitteln. Aber über Koenig oder Gabriel hatten sie so gut, wie nichts gefunden. »Versuchen Sie es noch einmal mit dem Namen Koenig«, sagte Jack. »Wir haben es mit allen denkbaren Schreibweisen ihres Namens versucht«, erwiderte Gretchen. »Da ist nichts.« »Dann geben Sie das Wort Archäen ein.« Seufzend tippte Gretchen das Wort ein und klickte dann auf »Suchen«. Eine entmutigend lange Liste von Artikelüberschriften füllte den Monitor. »Fremdartige Erdbewohner. Wissenschaftler feiern Entdeckung neuer Lebensform« (Washington Post) »Internationale Konferenz über Archäen geplant« (Miami Herald) »Tiefseeorganismen geben Hinweise auf Ursprung des Lebens« (Philadelphia Enquirer) »Leute, das ist hoffnungslos«, sagte Gretchen. »Wir bräuchten die ganze Nacht, um alle Artikel in dieser Liste zu lesen. Warum lassen wir es nicht gut sein und gönnen uns ein paar Stunden Schlaf?« »Moment mal!«, sagte Gordon. »Gehen Sie mal auf diesen Artikel hier.« Er zeigte auf eine Überschrift am unteren Ende des Bildschirms. Wissenschaftler bei Tauchunfall im Galapagos-Archipel ums Leben gekommen (New York Times). »Galapagos«, sagte Jack. »Dort hat Dr. Koenig auch die neue Archäen-Unterart entdeckt, im Galapagos-Graben.« Gretchen klickte die Überschrift an, und der Text erschien. Die, Geschichte war zwei Jahre alt. COPYRIGHT: New York Times. RUBRIK: Nachrichten aus aller Welt. ÜBERSCHRIFT: »Wissenschaftler bei Tiefsee- Tauchunfall ums Leben gekommen.« VERFASSER: Julio Perez, NYT-Korrespondent. TEXT: Ein amerikanischer Wissenschaftler, der sich mit einem Meeresorganismus namens Archäen befasste, kam gestern ums Leben, nachdem sein Ein-Mann-Tauchboot sich in einem Unterwassercañon des Galapagos-Grabens verkeilte. Die Leiche von Dr. Stephen D. Ahearn konnte erst heute früh geborgen werden, nachdem es dem Forschungsschiff Gabriella gelungen war, das Mini-U- Boot mit Hilfe von Kabeln zu heben. »Wir wussten, dass er da unten noch am Leben war, aber wir konnten einfach nichts tun«, sagte eine Mitarbeiterin Ahearns an Bord der Gabriella. »Er saß in sechstausend Metern Tiefe in der Falle. Wir haben Stunden gebraucht, um das Boot loszubekommen und es hoch zu hieven.« Dr. Ahearn war Professor für Geologie an der University of California, San Diego. Wohnhaft war er in La Jolla, Kalifornien. »Das Schiff hieß Gabriella«, sagte Jack. Er und Gordon sahen einander an. Ihnen schoss der gleiche verblüffende Gedanke durch den Kopf. Gabriella. Palmer Gabriel. »Ich wette, das war ein Schiff von SeaScience«, sagte Jack. »Und Helen Koenig war an Bord.«, Gordons Blick wanderte zum Bildschirm zurück. »Das ist ja interessant. Was sagt Ihnen die Information, dass Ahearn Geologe war?« »Was denn schon?«, meinte Gretchen gähnend. »Was hat ein Geologe an Bord eines meeresbiologischen Forschungsschiffs zu suchen?« »Ob er sich die Steine am Meeresboden angeschaut hat?« »Machen wir eine Suche mit seinem Namen.« Gretchen seufzte. »Sie beide schulden mir eine Runde Schönheitsschlaf.« Sie tippte den Namen Stephen D. Ahearn ein und klickte auf »Suchen«. Eine Liste von insgesamt sieben Artikeln erschien. Sechs davon betrafen seinen Tiefseetod im Galapagos-Archipel. Ein Artikel stammte aus dem Jahr vor seinem Tod: »UCSD-Professor wird neueste Ergebnisse der Tektitforschung präsentieren. Als Hauptredner bei der Internationalen Geologentagung in Madrid vorgesehen« (San Diego Union) Die beiden Männer starrten auf den Bildschirm. Einen Augenblick lang waren sie sprachlos vor Staunen. Dann sagte Gordon leise: »Das ist es, Jack. Da haben wir das, was sie uns verheimlichen wollten.« Jacks Hände waren plötzlich taub, seine Kehle wie ausgetrocknet. Seine Augen fixierten ein einzelnes Wort, das Wort, das ihnen alles verriet. Tektite. Das Haus von JSC-Direktor Ken Blankenship war eines der vielen anonymen Einfamilienhäuser im Neubaugebiet des Vororts Clear Lake, wo etliche leitende Angestellte des JSC, wohnten. Für einen Junggesellen war es recht groß, und im grellen Schein der Sicherheitsbeleuchtung sah Jack, dass der Vorgarten makellos gepflegt war, jeder Wildwuchs im Keim erstickt. Dieser Vorgarten, der noch um drei Uhr morgens so hell erleuchtet war, entsprach genau dem, was man von Blankenship erwartete, war er doch für seinen Perfektionismus ebenso bekannt wie für sein fast krankhaftes Sicherheits- bedürfnis. Wahrscheinlich ist in diesem Moment eine Überwachungskamera auf uns gerichtet, dachte Jack, während er mit Obie darauf wartete, dass Blankenship die Haustür öffnete. Sie mussten mehrmals klingeln, bis endlich drinnen das Licht anging. Dann erschien Blankenship an der Tür, ein gedrungener kleiner Napoleon im Bademantel. »Es ist drei Uhr morgens«, sagte er. »Was in aller Welt tun Sie hier?« »Wir müssen mit Ihnen reden«, sagte Gordon. »Ist etwas mit meinem Telefon nicht in Ordnung? Hätten Sie nicht vorher anrufen können?« »Wir können das Telefon nicht benutzen. Nicht in dieser Angelegenheit.« Sie betraten das Haus. Erst als die Haustür ins Schloss fiel, sagte Jack: »Wir wissen, was das Weiße Haus zu verbergen versucht. Wir wissen, wo die Chimäre herkommt.« Blankenship starrte ihn an. Seine Verärgerung über die gestörte Nachtruhe war augenblicklich verflogen. Dann sah er Gordon an, als suchte er bei ihm nach einer Bestätigung für Jacks Worte. »Es erklärt alles«, sagte Gordon. »Die Geheimniskrämerei des USAMRIID. Die übersteigerte Reaktion der Regierung. Und die Tatsache, dass das Verhalten dieses Organismus unsere Ärzte vor ein so unlösbares Rätsel stellt.« »Was haben Sie herausgefunden?«, Jack beantwortete die Frage. »Wir wissen, dass die Chimäre DNS des Menschen, der Hausmaus und einer Froschart in sich vereinigt. Aber das USAMRIID will uns nicht verraten, welche andere DNS sich noch auf dem Genom befindet. Es will uns nicht verraten, was die Chimäre in Wirklichkeit ist oder wo sie herkommt.« »Sie haben mir gestern Abend gesagt, der Bazillus sei in einer Nutzlast von SeaScience an Bord gelangt. In einer Archäen- Kultur.« »Das haben wir auch gedacht. Aber Archäen sind harmlose Lebewesen. Sie können beim Menschen keine Krankheiten auslösen, weshalb das Experiment auch von der NASA ange- nommen wurde. Irgendetwas an dieser speziellen Archäenart ist aber anders. Etwas, wovon SeaScience uns nichts gesagt hat.« »Was meinen Sie mit ›anders‹?« »Ihre Herkunft. Sie stammen aus dem Galapagos-Graben.« Blankenship schüttelte den Kopf. »Ich verstehe nicht, was daran so bedeutend sein soll.« »Die Kultur wurde von Wissenschaftlern entdeckt, die mit dem Forschungsschiff Gabriella unterwegs waren. Es gehört SeaScience. Einer dieser Wissenschaftler war ein gewisser Dr. Stephen Ahearn, der mit dem Flugzeug zur Gabriella geflogen wurde, offenbar, weil man ihn ganz kurzfristig als Berater benötigte. Eine Woche später war er tot. Sein Mini-U- Boot verkeilte sich am Grund des Grabens, und er erstickte.« Blankenship sagte nichts, sah Jack aber unverwandt in die Augen. »Dr. Ahearn war bekannt für seine Forschungen über Tektite«, sagte Jack. »Dabei handelt es sich um glasartige Fragmente, die entstehen, wenn ein Meteorit auf der Erde einschlägt. Das war Dr. Ahearns Spezialgebiet. Die Geologie von Meteoriten und Asteroiden.«, Immer noch schwieg Blankenship. Warum zeigt er keine Reaktion?, überlegte Jack. Begreift er nicht, was das bedeutet? »SeaScience hat Ahearn nach Galapagos geflogen, weil man das Urteil eines Geologen benötigte«, sagte Jack. »Man brauchte eine genaue Identifizierung dessen, was man auf dem Meeresgrund gefunden hatte. Nämlich einen Asteroiden.« Blankenships Miene war jetzt vollkommen starr. Er drehte sich um und ging in die Küche. Jack und Gordon folgten ihm. »Deshalb hat das Weiße Haus solche Angst vor der Chimäre!«, sagte Jack. »Sie wissen, wo sie herkommt. Sie wissen, worum es sich dabei handelt!« Blankenship nahm den Telefonhörer ab und wählte eine Nummer. Kurz darauf sagte er: »Hier ist Ken Blankenship, Direktor des JSC. Ich muss mit Jared Profitt sprechen. Ja, ich weiß, wie spät es ist. Es handelt sich um einen Notfall; wenn Sie mich also bitte mit seinem Privatanschluss verbinden würden …« Es war einen Augenblick still. Dann sagte Blankenship: »Sie wissen Bescheid. Nein, ich habe es ihnen nicht gesagt. Sie sind selbst drauf gekommen.« Pause. »Jack McCallum und Gordon Obie. Ja, Sir, sie stehen hier in meiner Küche.« Er reichte Jack den Hörer. »Er möchte mit Ihnen sprechen.« Jack nahm den Hörer. »Hier spricht McCallum.« »Wie viele Leute wissen Bescheid?«, fragte Jared Profitt ohne Umschweife. Die Frage machte Jack augenblicklich klar, wie vertraulich diese Information war. Er antwortete: »Unser medizinisches Personal ist eingeweiht. Und ein paar Mitarbeiter aus der Lebenswissenschaftlichen Abteilung.« »Können Sie alle es für sich behalten?« »Das kommt darauf an.« »Worauf?« »Ob Ihre Leute mit uns zusammenarbeiten. Ihre Informationen, an uns weitergeben.« »Was wollen Sie, Dr. McCallum?« »Vollständige Offenlegung der Fakten. Alles, was Sie über die Chimäre herausgefunden haben. Die Autopsieergebnisse. Die Resultate der klinischen Versuche.« »Und wenn wir nicht kooperieren? Was geschieht dann?« »Dann werden meine Kollegen bei der NASA Faxe an jede Nachrichtenagentur im Land schicken.« »Was genau wollen Sie ihnen sagen?« »Die Wahrheit. Dass dieser Organismus nicht irdischen Ursprungs ist.« Es war lange still. Jack hörte seinen eigenen Puls in der Muschel pochen. Haben wir richtig geraten? Haben wir wirklich die Wahrheit entdeckt? Schließlich sagte Profitt: »Ich werde Dr. Roman bevollmächtigen, Ihnen alles zu sagen. Er wird Sie in White Sands erwarten.« Die Leitung war tot. Jack legte auf und sah Blankenship an. »Seit wann wissen Sie Bescheid?« Blankenships Schweigen stachelte Jacks Zorn nur weiter an. Drohend trat er einen Schritt vor, und Blankenship wich zurück. »Seit wann wissen Sie Bescheid?« »Erst … erst seit ein paar Tagen. Ich musste schwören, nichts zu verraten.« »Das waren unsere Leute, die da oben verreckt sind!« »Ich hatte keine Wahl! Die sind wegen dieser Sache alle total in Panik! Das Weiße Haus, das Pentagon.« Blankenship holte tief Luft und sah Jack direkt in die Augen. »Sie werden noch verstehen, wovon ich rede. Sie werden es verstehen, wenn Sie nach White Sands kommen.«, 20. August Mit dem einen Ende des Staubands zwischen den Zähnen zog Emma die Schlinge um ihren linken Arm fest an, bis die Venen wie blaue Würmer unter ihrer blassen Haut hervortraten. Rasch wischte sie mit einem Alkoholtupfer über die Ellenbeugenvene und zuckte zusammen, als die Nadel ihre Haut durchstach. Wie ein Junkie, der es kaum erwarten kann, sich den Schuss zu setzen, injizierte sie den gesamten Inhalt der Spritze, wobei sie nach der Hälfte das Stauband lockerte. Als sie damit fertig war, schloss sie die Augen und ließ sich treiben, während sie sich ausmalte, wie die HCG-Moleküle als kleine Sternchen der Hoffnung durch ihre Adern strömten und in ihr Herz und ihre Lungen wirbelten. Sich durch Arterien und Kapillargefäße ausbreiteten. Sie bildete sich ein, sie könnte die Wirkung des Hormons schon spüren – wie ihr Kopfschmerz sich langsam verflüchtigte und die heißen Flammen des Fiebers zu einem schwachen Glimmen erstickt wurden. Noch drei Dosen sind übrig, dachte sie. Noch drei Tage. Sie stellte sich vor, wie sie aus ihrem eigenen Körper hinausschwebte, und sie sah sich selbst wie aus großer Entfernung, als einen mit dunklen Flecken gesprenkelten Fötus, der zusammengerollt in einem Sarg lag. Eine Schleimblase trat aus ihrem Mund und zerplatzte zu leuchtenden, zappelnden Fäden, die aussahen wie Maden. Abrupt öffnete sie die Augen und merkte, dass sie geschlafen hatte. Geträumt. Ihr Hemd war schweißdurchtränkt. Das war ein gutes Zeichen. Es hieß, dass das Fieber zurückgegangen war. Sie massierte ihre Schläfen und versuchte die Traumbilder zu verbannen, doch es gelang ihr nicht; Wirklichkeit und Albträume waren eins geworden. Sie zog das schweißnasse Hemd aus und streifte sich ein frisches aus Dianas Spind über. Trotz ihrer Albträume hatte der, kurze Schlaf sie erfrischt, und sie war wieder hellwach und bereit, sich auf die Suche nach neuen Lösungen zu machen. Sie schwebte in das US-Labor und rief auf dem Computer alle Dateien über die Chimäre auf. Todd Cutler hatte ihr mitgeteilt, dass es sich um einen außerirdischen Organismus handelte, und alles, was die NASA inzwischen über diese Lebensform wusste, war auf ihren Bordcomputer übertragen worden. Sie ging die Dateien noch einmal durch, weil sie hoffte, auf irgendeine neue Inspiration zu stoßen, auf einen neuen Ansatz, auf den noch niemand gekommen war. Alles, was sie las, war deprimierend vertraut. Sie öffnete den Genom-Ordner. Eine Nucleotidsequenz ergoss sich in einem nicht enden wollenden Strom aus den Buchstaben A, C, T und G über den Monitor. Das war der genetische Code der Chimäre – jedenfalls Teile davon. Die Teile, die das USAMRIID der NASA zur Verfügung gestellt hatte. Wie hypnotisiert starrte sie auf den Bildschirm, über den die Zeilen des Codes zogen. Dies war die Essenz der fremden Lebensform, die in ihr heranwuchs. Der Schlüssel zum Feind. Wenn sie nur wüsste, wie sie ihn benutzen konnte. Der Schlüssel. Plötzlich fiel ihr ein, was Jack zuletzt über Hormone gesagt hatte. Damit ein Hormon funktionieren kann, muss es einen bestimmten Rezeptor in der Zielzelle binden. Es ist wie ein Schlüssel, der auf der Suche nach dem passenden Schloss ist. Warum sollte ein Säugetierhormon wie das HCG die Fortpflanzung einer außerirdischen Lebensform unterbinden? Warum sollte ein solcher Organismus, der sich so von allem Leben auf der Erde unterschied, die passenden Schlösser zu unseren Schlüsseln enthalten? Auf dem Computerbildschirm war inzwischen das Ende der Nucleotidsequenz erreicht. Sie starrte auf den blinkenden Cursor und dachte an die irdischen Spezies, deren DNS die Chimäre, geplündert hatte. Indem sie sich diese neuen Gene angeeignet hatte, hatte sich die fremde Lebensform in ein Wesen verwandelt, das Element von Mensch, Maus und Frosch in sich trug. Sie rief Houston über Funk. »Ich muss mit jemandem von den Lebenswissenschaften sprechen«, sagte sie. »Mit jemand Bestimmtem?«, fragte der Capcom. »Einem Amphibienexperten.« »Bleiben Sie dran, Watson.« Zehn Minuten später meldete sich ein Dr. Wang von der Lebenswissenschaftlichen Abteilung der NASA. »Sie wollen etwas über Amphibien wissen?«, fragte er. »Ja, über Rana pipiens, den Leopardfrosch.« »Was kann ich Ihnen darüber erzählen?« »Was geschieht, wenn der Frosch menschlichen Hormonen ausgesetzt wird?« »Irgendwelchen bestimmten Hormonen?« »Östrogen zum Beispiel. Oder HCG.« Dr. Wang antwortete ohne Zögern. »Die Anwesenheit von Östrogenen in der Umgebung hat auf Amphibien generell negative Auswirkungen. Das ist sogar ziemlich gut erforscht. Einige Experten führen den weltweiten Rückgang der Froschpopulationen auf die Verunreinigung von Bächen und Teichen mit östrogenartigen Substanzen zurück.« »Was sind das für Substanzen?« »Bestimmte Pestizide haben zum Beispiel ähnliche Eigenschaften wie Östrogen. Sie bringen das endokrine System der Frösche durcheinander und behindern ihre Fortpflanzung und ihre gesunde Entwicklung.« »Es bringt sie also nicht direkt um?« »Nein, es stört nur die Fortpflanzung.« »Sind Frösche besonders empfindlich dafür?«, »O ja. Weit mehr als Säugetiere. Außerdem haben Frösche eine durchlässige Haut, das macht sie generell empfänglicher für Giftstoffe. Das ist sozusagen ihre, nun ja, ihre Achillesferse.« Achillesferse. Sie schwieg einen Moment, während sie darüber nachdachte. »Dr. Watson?«, fragte Wang. »Haben Sie noch irgendwelche Fragen?« »Ja. Gibt es eine Krankheit oder ein Toxin, das einen Frosch töten würde, für Säugetiere aber harmlos wäre?« »Das ist eine interessante Frage. Was Toxine anbelangt – da käme es auf die Dosis an. Gibt man einem Frosch eine geringe Menge Arsen, bringt es ihn um. In einer größeren Dosis würde Arsen allerdings auch einen Menschen töten. Dann wiederum gibt es mikrobielle Erkrankungen, ausgelöst von bestimmten Bakterien oder Viren, die nur für Frösche tödlich sind. Ich bin kein Arzt, also kann ich nicht mit Bestimmtheit sagen, ob sie für Menschen harmlos sind, aber …« »Viren?«, unterbrach sie ihn. »Welche Viren?« »Nun, zum Beispiel Ranaviren.« »Von denen habe ich noch nie etwas gehört.« »Die sind nur Amphibienexperten ein Begriff. Es handelt sich um DNS-Viren. Sie gehören zur Familie der Iridoviren. Wir glauben, dass sie das ödematöse Syndrom bei Kaulquappen auslösen. Die Kaulquappen schwellen an, und es kommt zu inneren Blutungen.« »Und das ist tödlich?« »Allerdings.« »Tötet das Virus auch Menschen?« »Ich weiß es nicht. Ich glaube, das weiß niemand. Aber ich weiß, dass Ranaviren auf der ganzen Welt komplette Froschpopulationen ausgelöscht haben.« Die Achillesferse, dachte sie. Ich habe sie gefunden., Die Chimäre war, indem sie ihrem eigenen Genom die DNS des Leopardfroschs hinzugefügt hatte, zum Teil ein amphibisches Lebewesen geworden. Und sie hatte auch die wunden Punkte der Amphibien übernommen. Sie fragte: »Gibt es eine Möglichkeit, an lebende Exemplare dieser Ranaviren heranzukommen? Um sie gegen die Chimäre zu testen?« Es war lange still. »Ich verstehe«, sagte Dr. Wang schließlich. »Das hat noch niemand versucht. Niemand ist auch nur auf den Gedanken gekommen …« »Können Sie das Virus besorgen?«, unterbrach sie ihn. »Ja. Ich weiß von zwei amphibienwissenschaftlichen Forschungslabors in Kalifornien, die mit lebenden Ranaviren arbeiten.« »Dann tun Sie es. Und setzen Sie sich mit Jack McCallum in Verbindung. Er muss darüber informiert werden.« »Er ist gerade mit Gordon Obie nach White Sands aufgebrochen. Ich werde sie dort anrufen.« Steppenläufer kullerten in einer Wolke aus peitschendem Sand über die Straße. Die Männer fuhren an dem Wachhäuschen und dem elektrischen Zaun vorbei auf das öde Armeegelände. Jack und Gordon stiegen aus dem Wagen und blinzelten zum Himmel empor. Die Sonne war ein trüber orangefarbener Fleck, verdunkelt von dem Staub, den der Wind hier unentwegt aufwirbelte. Sie hatten nur ein paar Stunden schlafen können, bevor sie in Ellington gestartet waren, und allein das bloße Tageslicht tat Jacks Augen weh. »Hier entlang, meine Herren«, sagte der Fahrer. Es war ein ganz anderer Empfang als bei Jacks letztem Besuch. Diesmal behandelte der Geleitschutz der Armee sie höflich und mit Respekt. Diesmal erwartete Dr. Isaac Roman sie, in der Eingangshalle, wenn er auch über ihre Ankunft nicht übermäßig glücklich schien. »Nur Sie dürfen mit mir kommen, Dr. McCallum«, sagte er. »Mr. Obie wird hier warten müssen. So ist es abgemacht.« »Ich habe keine solche Abmachung getroffen«, erwiderte Jack. »Mr. Profitt hat das für Sie getan. Es ist nur ihm zu verdanken, dass Sie dieses Gebäude betreten dürfen. Ich habe nicht allzu viel Zeit, also bringen wir es hinter uns.« Er drehte sich um und ging in Richtung der Fahrstühle. »Ein typisches Exemplar von Arschloch Marke US-Army«, sagte Gordon. »Gehen Sie nur. Ich warte hier.« Jack folgte Roman in den Aufzug. »Unsere erste Station ist Ebene U 2«, sagte Roman, »wo unsere Tierversuche untergebracht sind.« Die Fahrstuhltür öffnete sich, und sie standen vor einer Glaswand. Es war ein Sichtfenster. Jack trat an das Fenster und blickte sich in dem dahinter liegenden Labor um. Er sah ein Dutzend Arbeiter, die biologische Schutzanzüge trugen, sowie Käfige mit Klammeraffen und Hunden. Direkt am Fenster standen gläserne Rattenkäfige. Roman deutete auf die Ratten. »Sie werden bemerken, dass auf jedem Käfig Datum und Uhrzeit der Infektion vermerkt sind. Ich kann mir keine bessere Art und Weise vorstellen, die tödlichen Eigenschaften der Chimäre zu demonstrieren.« Die sechs Ratten in dem mit »Tag 1« beschrifteten Käfig schienen bei bester Gesundheit und strampelten munter in ihren Laufrädern. In dem zweiten Käfig waren bereits erste Anzeichen der Krankheit zu erkennen. Zwei der sechs Ratten zitterten heftig und hatten blutrote Augen. Die anderen kauerten in einem lethargischen Haufen aufeinander. »Die ersten beiden Tage«, erklärte Dr. Roman, »bilden die, Fortpflanzungsphase der Chimäre. Sie müssen verstehen, dass dies allem widerspricht, was wir von der Erde her kennen. Gewöhnlich muss eine Lebensform das Stadium der Reife erreichen, bevor sie sich fortpflanzen kann. Die Chimäre pflanzt sich jedoch zuerst fort und beginnt dann zu reifen. Sie teilt sich mit großer Geschwindigkeit und produziert bis zu hundert Ableger in achtundvierzig Stunden. Sie sind zunächst mikros- kopisch klein – mit dem bloßen Auge nicht zu erkennen. So klein, dass Sie sie einatmen oder durch die Schleimhäute absorbieren können. Sie ahnen nicht einmal, dass Sie infiziert sind.« »Sie sind also bereits in dieser frühen Phase ihres Lebenszyklus ansteckend?« »Sie sind in jeder Phase ihres Lebenszyklus ansteckend. Sie müssen lediglich in die Atemluft gelangen. Das geschieht normalerweise um den Todeszeitpunkt des Opfers herum, oder wenn der Körper einige Tage nach dem Tod aufplatzt. Sobald Sie mit der Chimäre infiziert sind, sobald sie sich in Ihrem Körper zu vermehren begonnen hat, fangen die einzelnen Ableger an zu wachsen. Sie entwickeln sich zu …« Er hielt inne. »Wir wissen nicht so recht, wie wir es nennen sollen. Eihüllen, würde ich sagen. Denn sie enthalten eine larvenähnliche Lebensform.« Jacks Blick wanderte weiter zu dem mit »Tag 3« gekennzeichneten Käfig. Hier lagen alle Ratten in Zuckungen; sie schlugen mit den Beinen um sich, als würde man ihnen permanent Stromstöße versetzen. »Am dritten lag«, fuhr Roman fort, »wachsen die Larven bereits sehr rasch. Allein durch ihre Ausdehnung verdrängen sie die Gehirnmasse des Opfers. Sie schädigen die neurologischen Funktionen des Wirtsorganismus nachhaltig. Und am vierten Tag …« Sie schauten in den vierten Käfig. Alle Ratten bis auf eine waren tot. Man hatte die Kadaver noch nicht entfernt; mit steifen, Beinen und offenen Mäulern lagen sie da. Es gab noch drei weitere Käfige, die den Prozess der Zersetzung dokumentierten. Am fünften Tag begannen die Kadaver anzuschwellen. Am sechsten Tag waren die Bäuche noch stärker aufgebläht, bis die Haut so straff war wie das Fell einer Trommel. Eine zähe Flüssigkeit sickerte aus den offenen Augen und glitzerte auf den Nasenlöchern. Und am siebten Tag … Jack blieb vor dem Fenster stehen und starrte in den siebten Käfig. Zerfetzte Kadaver lagen am Boden verstreut wie geplatzte Luftballons; die aufgerissene Haut gab den Blick auf einen schwarzen Brei aus zersetzten Organen frei. Und am Gesicht einer Ratte klebte eine gallertartige Masse aus matt leuchtenden Kügelchen, die leise zitterten. »Die Eihüllen«, sagte Roman. »In diesem Stadium sind die Körperhöhlen damit prall gefüllt. Sie wachsen mit erstaunlicher Geschwindigkeit, indem sie sich vom Gewebe des Wirts ernähren. Sie verdauen seine Muskeln und Organe.« Er sah Jack an. »Sind Sie mit dem Lebenszyklus parasitischer Wespen vertraut?« Jack schüttelte den Kopf. »Die ausgewachsene Wespe injiziert ihre Eier in eine lebende Raupe. Die Larven wachsen heran und ernähren sich von der Hämolymphflüssigkeit des Wirtstieres. Die Raupe ist während dieser ganzen Zeit am Leben. Sie brütet eine fremde Lebensform aus, die sie von innen auffrisst, bis die Larven schließlich aus dem berstenden Kadaver des Wirts ausschlüpfen.« Roman blickte auf die toten Ratten. »Auch diese Larven vermehren sich im Körper eines lebenden Opfers und wachsen dort heran. Und das Wirtstier stirbt schließlich daran. An dieser Masse von Larven, die sich im Schädel ausbreiten. Die an der Oberfläche der grauen Gehirnmasse nagen, Kapillargefäße beschädigen und innere Blutungen auslösen. Der Druck steigt. Die Blutgefäße in, den Augen schwellen an und platzen. Der Wirt leidet unter furchtbaren Kopfschmerzen, Sehstörungen und Verwirrungs- zuständen. Er taumelt und stolpert herum, als sei er betrunken. Und nach drei oder vier Tagen ist er tot. Und diese Lebensform ernährt sich immer weiter von der Leiche. Plündert ihre DNS und benutzt sie zur Beschleunigung ihrer eigenen Evolution.« »Und wohin führt diese Evolution?« Roman sah Jack an. »Wir kennen den Endpunkt nicht. Mit jeder neuen Generation erwirbt die Chimäre DNS von ihrem Wirt. Die Chimäre, mit der wir jetzt experimentieren, ist nicht mehr die Gleiche, mit der wir angefangen haben. Das Genom ist jetzt komplexer geworden, die Lebensform höher entwickelt.« Immer menschenähnlicher, dachte Jack. »Das ist der Grund für die absolute Geheimhaltung«, sagte Roman. »Irgendein Terrorist, irgendein feindliches Land könnte weitere Exemplare dieses Lebewesens aus dem Galapagosgraben gewinnen. In den falschen Händen wäre dieser Organismus …« Er verstummte. »Also ist nichts daran das Werk von Menschenhand?« Roman schüttelte den Kopf. »Der Organismus wurde durch Zufall in dem Tiefseegraben entdeckt. Die Gabriella holte ihn an die Oberfläche. Zuerst glaubte Dr. Koenig, sie sei auf eine neue Unterart von Archäen gestoßen. Stattdessen hatte sie das hier gefunden.« Er sah auf die wimmelnde Masse von Eiern. »Tausend Jahre waren sie in den Trümmern dieses Asteroiden gefangen. Sechstausend Meter unter dem Meeresspiegel. Das hat sie während all dieser Zeit in Schach gehalten. Nur die Tatsache, dass der Asteroid in den Ozean und nicht auf das Festland gestürzt ist.« »Jetzt verstehe ich, weshalb Sie mit der Überdruckkammer experimentiert haben.« »Die Chimäre hat über Jahrhunderte in diesem Meeresgraben ein harmloses Dasein gefristet. Wir dachten, wir könnten sie, wieder unschädlich machen, indem wir sie den gleichen Druckverhältnissen aussetzten.« »Und, ist es Ihnen gelungen?« Roman schüttelte den Kopf. »Nur vorübergehend. Diese Lebensform hat eine dauerhafte Veränderung erfahren, als sie der Mikrogravitation ausgesetzt war. Auf irgendeine Weise hat sich ihr Fortpflanzungsmechanismus in Bewegung gesetzt, als sie an Bord der ISS kam. Es scheint, als sei sie auf dieses todbringende Verhalten programmiert. Allerdings bedurfte es der Abwesenheit von Schwerkraft, um dieses Programm wieder zu starten.« »Wie vorübergehend ist diese Überdrucktherapie?« »Die infizierten Mäuse bleiben gesund, so lange sie in der Kammer sind. Wir haben sie jetzt zehn Tage am Leben gehalten. Aber wenn wir eine Maus herausnehmen, nimmt die Krankheit wieder ihren Lauf.« »Was ist mit den Ranaviren?« Erst vor einer Stunde hatte Dr. Wang von der Lebenswissenschaftlichen Abteilung der NASA Jack telefonisch informiert. In diesem Moment war ein Vorrat dieses Amphibienvirus mit einem Jet der Air Force auf dem Weg zu Dr. Romans Labor. »Unsere Wissenschaftler sind der Meinung, es könne funktionieren.« »Theoretisch ja. Aber es ist zu früh, um ein Rettungsshuttle zu starten. Wir müssen zuerst beweisen, dass das Ranavirus wirkt, sonst setzen Sie das Leben einer weiteren Shuttle-Crew aufs Spiel. Wir brauchen Zeit, um das Virus zu testen. Einige Wochen mindestens.« Emma hat nicht einige Wochen Zeit, dachte Jack. Sie hat nur noch für drei Tage HCG. Schweigend blickte er auf den Käfig mit den Rattenkadavern. Auf die Eier, die in ihrem Nest aus Schleim glitzerten. Wenn ich doch nur mehr Zeit gewinnen könnte. Zeit. Plötzlich kam ihm ein Gedanke. Er erinnerte sich an, etwas, was Roman gesagt hatte. »Sie sagten doch, die Über- druckkammer hätte die Mäuse bisher zehn Tage lang am Leben gehalten.« »Das stimmt.« »Aber die Discovery ist erst vor zehn Tagen abgestürzt.« Roman wich seinem Blick aus. »Sie hatten die Tests mit der Kammer von Anfang an geplant. Und das heißt, Sie wussten bereits, womit Sie es zu tun hatten, noch bevor Sie die Autopsien durchgeführt haben.« Roman drehte sich um und ging auf die Aufzüge zu. Er schnappte erschrocken nach Luft, als Jack ihn am Kragen packte und herumwirbelte. »Das war keine kommerzielle Nutzlast«, rief Jack. »Habe ich Recht?« Roman stieß ihn von sich und wankte rückwärts auf die Wand zu. »Das Verteidigungsministerium hat SeaScience als Tarnung benutzt«, sagte Jack. »Sie haben die Firma dafür bezahlt, dass sie an Ihrer Stelle das Experiment zur ISS geschickt hat. Um die Tatsache zu vertuschen, dass diese Lebensform von militärischem Interesse ist.« Roman drückte sich an der Wand entlang in Richtung Fahrstuhl. Er schien sich aus dem Staub machen zu wollen. Jack hielt ihn an seinem Laborkittel fest und packte ihn noch fester am Kragen. »Das war kein Bioterrorismus! Das war Ihr eigener beschissener Fehler!« Romans Gesicht wurde dunkelrot. »Ich … ich kriege keine Luft!« Jack ließ ihn los. Romans Beine gaben nach, und er sackte mit dem Rücken an der Wand in sich zusammen. Eine Zeit lang konnte er nicht sprechen, rang nur nach Luft. Als er schließlich etwas sagte, brachte er nur ein Flüstern zustande. »Wir konnten, nicht vorhersehen, wie es sich verhalten würde. Wie es sich in der Schwerelosigkeit verändern würde …« »Aber Sie wussten, dass es eine außerirdische Lebensform war.« »Ja.« »Und Sie wussten, dass es eine Chimäre war. Dass sie bereits Amphibien-DNS enthielt.« »Nein. Nein, das wussten wir nicht.« »Erzählen Sie mir keinen Scheiß!« »Wir wussten nicht, wie die Frosch-DNS auf das Genom gelangt war! Es muss in Dr. Koenigs Labor passiert sein. Irgendeine Panne. Sie hatte den Organismus in dem Tiefsee- graben entdeckt und letztlich herausgefunden, um was es sich dabei handelte. SeaScience wusste, dass wir interessiert sein würden. Ein außerirdischer Organismus – selbstverständlich hatten wir Interesse! Das Pentagon bezahlte die KC-135- Experimente. Wir finanzierten den Nutzlastraum auf der ISS. Es konnte nicht als militärische Nutzlast deklariert werden. Es hätte zu viele Fragen gegeben, zu viele Kontrollen und Sonder- sitzungen. Die NASA hätte sich gefragt, weshalb die Armee sich so für diese harmlosen Meeresmikroben interessiert. Aber im privaten Sektor werden keine Fragen gestellt. Also ging es als kommerzielle Nutzlast an Bord, betreut und bezahlt von Sea- Science. Unter der wissenschaftlichen Leitung von Dr. Koenig.« »Wo ist Dr. Koenig?« Roman richtete sich langsam auf. »Sie ist tot.« Damit hatte Jack nicht gerechnet. »Wie ist das passiert?«, fragte er leise. »Ein Unfall.« »Und das soll ich glauben?« »Es ist die Wahrheit.« Jack sah sich den Mann genau an und kam zu dem Schluss,, dass er nicht log. »Es ist vor über zwei Wochen in Mexiko passiert«, sagte Roman. »Kurz nachdem sie bei SeaScience gekündigt hatte. Das Taxi, in dem sie saß, hatte einen Totalschaden.« »Und der Überfall des USAMRIID auf ihr Labor? Sie wollten dort gar keine Nachforschungen anstellen, nicht wahr? Sie wollten nur sicherstellen, dass alle ihre Unterlagen vernichtet wurden.« »Wir reden hier über eine außerirdische Lebensform. Einen Organismus, der viel gefährlicher ist, als wir ursprünglich dachten. Ja, das Experiment war ein Fehler. Eine Katastrophe. Stellen Sie sich vor, welche Folgen es haben könnte, wenn Terroristen auf der ganzen Welt in den Besitz dieser Informationen kämen.« Deshalb war die NASA im Dunkeln gehalten worden. Deshalb durfte die Wahrheit nicht herauskommen. »Und das Schlimmste haben Sie noch gar nicht gesehen, Dr. McCallum«, sagte Roman. »Was heißt das?« »Es gibt da noch etwas, was ich Ihnen zeigen will.« Sie fuhren mit dem Aufzug eine Ebene tiefer, nach U 3. Tiefer in den Hades, dachte Jack. Wieder traten sie heraus und standen vor einer Glaswand, hinter der sich ein weiteres Labor mit Arbeitern in Raumanzügen befand. Roman drückte auf den Knopf der Gegensprechanlage und sagte: »Würden Sie bitte das Exemplar herbringen?« Ein Laborantin nickte. Sie ging zu einem großen begehbaren Stahltresor, drehte an dem gewaltigen Kombinationsschloss und verschwand hinter der Tür. Als sie wieder herauskam, schob sie einen Handwagen vor sich her, auf dem ein Tablett lag mit einem Stahlbehälter darauf. Sie rollte den Wagen vor das Sichtfenster., Roman nickte. Sie öffnete den Stahlbehälter, nahm einen Plexiglaszylinder heraus und setzte ihn auf dem Tablett ab. Der Inhalt schwamm in einem klaren Formalinbad. »Das haben wir aus Kenichi Hirais Wirbelsäule herausgeholt«, sagte Roman. »Sein Rückgrat hat es beim Absturz der Discovery vor der Wucht des Aufpralls geschützt. Als wir es entfernt haben, hat es noch gelebt. Gerade noch.« Jack wollte etwas sagen, doch er brachte kein einziges Wort heraus. Er hörte nur das Summen der Ventilatoren und das Rauschen seines eigenen Blutes, während er voller Entsetzen auf den Inhalt des Zylinders starrte. »Das ist es, was sich aus den Larven entwickelt«, sagte Roman. »Das ist das nächste Stadium.« Jetzt verstand er alles. Den Grund für die Geheimhaltung. Dieses in Formalin konservierte Etwas, das zusammengerollt in einem Plexiglaszylinder steckte, hatte alles erklärt. Obwohl es beim Herausschneiden übel zugerichtet worden war, waren die wesentlichen Züge noch zu erkennen. Die glänzende Amphibienhaut. Der Larvenschwanz. Und das embryoartig gebogene Rückgrat – nicht das Rückgrat einer Amphibie, sondern etwas weitaus Entsetzlicheres –, dessen genetischer Ursprung nicht zu übersehen war. Wie ein Säugetier, dachte Jack. Vielleicht sogar wie ein Mensch. Es hatte schon begonnen, die Gestalt seines Wirts anzunehmen. Wenn man zuließe, dass es noch eine weitere Art infizierte, würde es sein Aussehen erneut verändern. Es würde die DNS jedes beliebigen Organismus auf der Erde plündern und so jede beliebige Form annehmen. Schließlich würde seine Entwicklung einen Punkt erreichen, an dem es keinen Wirt mehr brauchte, um zu wachsen und sich zu vermehren. Es würde zu einem unabhängigen und selbstständigen Wesen werden. Vielleicht sogar mit Intelligenz., Und Emma war eine lebende Brutstätte für diese Kreaturen, ihr Körper ein nährender Kokon, in dem sie heranwuchsen. Ein Schauer überlief Jack, als er auf dem Asphalt stand und über das kahle Rollfeld blickte. Der Armeejeep, der ihn und Gordon zum Air-Force-Stützpunkt von White Sands gebracht hatte, war nur noch ein glitzernder Punkt in der Ferne, der eine fächerförmige Staubwolke hinter sich herzog. Die grelle Weißglut der Sonne trieb ihm die Tränen in die Augen, und für einen Augenblick verschwamm das Bild der Wüste und wurde zu einer Unterwasserlandschaft. Er drehte sich zu Gordon um. »Es gibt keine andere Möglichkeit. Wir müssen es tun.« »Es gibt tausend Dinge, die schief gehen können.« »Die gibt es immer. Das gilt für jeden Start, für jede Mission. Warum sollte diese hier anders sein?« »Es wird keine Ausweichpläne geben. Keine Absicherung. Ich weiß, wovon ich rede. Das ist ein abenteuerliches Unterfangen.« »Gerade deshalb ist es machbar. Wie lautet noch mal das Motto von denen? Kleiner, schneller, billiger.« »Okay«, sagte Gordon. »Nehmen wir an, Sie werden nicht schon auf der Startrampe in tausend Stücke gesprengt. Nehmen wir an, die Armee schießt Sie nicht vom Himmel. Wenn Sie einmal oben sind, stehen Sie immer noch vor der großen Preisfrage: Wirkt das Ranavirus?« »Wissen Sie, Gordon, eins hat mir von Anfang an keine Ruhe gelassen. Warum war diese Amphibien-DNS auf dem Genom? Wie ist die Chimäre an die Froschgene gekommen? Roman glaubt, es war eine Panne. Ein Versehen in Dr. Koenigs Labor.« Jack schüttelte den Kopf. »Ich glaube nicht, dass es ein Versehen war. Ich denke, Dr. Koenig hat diese Gene absichtlich dorthin praktiziert. Als Sicherung.«, »Das verstehe ich nicht.« »Vielleicht hat sie an die Zukunft gedacht, an die möglichen Gefahren. An das, was geschehen könnte, wenn sich diese neue Lebensform unter dem Einfluss der Schwerelosigkeit ver- änderte. Für den Fall, dass die Chimäre jemals außer Kontrolle geraten sollte, wollte sie eine Möglichkeit haben, sie zu töten. Eine Hintertür, mit der sie ihre Abwehr umgehen konnte. Und genau das ist diese Hintertür.« »Ein Froschvirus.« »Es wird funktionieren, Gordon. Es muss funktionieren. Darauf wette ich mein Leben.« Ein Staubwirbel erhob sich zwischen ihnen und riss Sand und Papierfetzen mit sich. Gordon drehte sich um und blickte über den Asphalt hinweg auf die T-38, mit der sie aus Houston gekommen waren. Er seufzte. »Ich hatte befürchtet, dass Sie das sagen würden.«, 22. August Casper Mulholland futterte bereits seine dritte Packung Magentabletten, trotzdem hatte er immer noch das Gefühl, in seinem Innern brodelte ein Kessel voll Säure. In der Ferne glitzerte die Apogee II wie eine senkrecht in den Wüstensand gesteckte Patronenhülse. Es war kein besonders beein- druckender Anblick, schon gar nicht für dieses Publikum. Die meisten hatten schon einmal das die Erde erzittern lassende Getöse eines NASA-Starts miterlebt, hatten voller Ergriffenheit zu den gigantischen Feuersäulen aufgeblickt, auf denen das Shuttle sich majestätisch in den Himmel erhob. Die Apogee II hatte nicht die geringste Ähnlichkeit mit dem Shuttle. Sie sah eher aus wie eine Spielzeugrakete, und Casper konnte die Enttäuschung in den Augen der ungefähr ein Dutzend Besucher lesen, als sie die Stufen der neu errichteten Aussichtstribüne erklommen und über die trostlose Wüstenlandschaft hinweg in Richtung Startrampe blickten. Alle wollten es gewaltig. Alle standen nur auf Größe und Power. Das kleine Format, die elegante Schlichtheit, interessierte sie nicht. Wieder kam ein Kleinbus an und parkte neben der Tribüne. Eine neue Besuchergruppe strömte heraus, und alle hielten sich sofort die Hand über die Augen, um sie vor der grellen Morgensonne zu schützen. Er erkannte Mark Lucas und Hashemi Rashad, die beiden Geschäftsleute, die Apogee vor über drei Wochen einen Besuch abgestattet hatten. Er sah die wohl bekannte Enttäuschung über ihre Gesichter spielen, als sie blinzelnd in Richtung Startrampe spähten., »Näher können wir nicht an die Rampe ran?«, fragte Lucas. »Nein, leider nicht«, erwiderte Casper. »Es ist zu Ihrer eigenen Sicherheit. Wir haben es hier mit explosiven Treibstoffen zu tun.« »Aber ich dachte, wir würden einen gründlichen Einblick in Ihre Startvorbereitungen bekommen.« »Sie haben freien Zugang zu unserer Bodenkontrollstation – unserem Gegenstück zur Mission Control in Houston. Sobald sie in der Luft ist, fahren wir rüber und zeigen Ihnen, wie wir sie in eine niedrige Erdumlaufbahn steuern. Das ist die wahre Nagelprobe für unser System, Mr. Lucas. Jeder angehende Ingenieur kann eine Rakete starten. Aber sie sicher in die Umlaufbahn zu bringen und die Raumstation in einem Fly-by- Manöver zu passieren ist eine wesentlich kompliziertere Angelegenheit. Deshalb haben wir diese Demonstration um vier Tage vorverlegt – um genau den richtigen Zeitpunkt für einen Vorbeiflug an der ISS zu treffen. Um Ihnen zu beweisen, dass unser System bereits jetzt zu einer Rendezvous-Operation in der Lage ist. Auf so einen Vogel wie die Apogee II hat die NASA nur gewartet.« »Sie werden aber nicht wirklich andocken, oder?«, fragte Rashad. »Ich habe gehört, die Station steht unter Quarantäne.« »Nein, wir werden nicht andocken. Die Apogee II ist nur ein Prototyp. Sie kann sich nicht an die ISS dranhängen, weil sie kein orbitales Kopplungssystem besitzt. Aber wir werden nah genug an die Station heranfliegen, um zu demonstrieren, dass wir dazu in der Lage sind. Wissen Sie, allein die Tatsache, dass wir in unserer Startplanung so flexibel sind, ist schon ein ent- scheidendes Verkaufsargument. In der Raumfahrt ist Flexibilität doch der Schlüssel. Immer kann irgendetwas Unerwartetes dazwischenkommen. Der Unfall meines Partners zum Beispiel. Obwohl Mr. Obie jetzt mit einem gebrochenen Becken im Bett liegt, haben wir, wie Sie sehen, den Start nicht abgesagt. Wir, werden die gesamte Mission vom Boden aus steuern. Meine Herren, das nenne ich Flexibilität!« »Ich verstehe ja, weshalb man einen Start würde verschieben wollen«, sagte Lucas. »Wegen schlechter Witterung etwa. Aber warum mussten Sie ihn vier Tage vorziehen? Einige unserer Partner haben es nicht mehr rechtzeitig hierher geschafft.« Casper spürte, wie die letzte Tablette sich in einem neuen Schwall Magensäure auflöste. »Das ist eigentlich ganz einfach.« Er unterbrach sich, um sein Taschentuch herauszuholen und sich den Schweiß von der Stirn zu wischen. »Es hat mit dem Startfenster zu tun, von dem ich eben gesprochen habe. Die Umlaufbahn der Raumstation weist eine Inklination von einund- fünfzig Komma sechs Grad auf. Wenn Sie sich ihre Flugbahn auf einer Karte ansehen, erkennen Sie eine Sinuswelle, die zwischen einundfünfzig Komma sechs Grad Nord und einundfünfzig Komma sechs Grad Süd oszilliert. Wegen der Erdrotation überfliegt die Station bei jeder Umkreisung eine andere Stelle auf der Karte. Im Übrigen ist die Erde nicht vollkommen kugelförmig, was eine weitere Komplikation bedeutet. Wenn diese orbitale Flugbahn Ihre Abschussbasis schneidet, dann ist der Zeitpunkt für einen Start am günstigsten. Nachdem wir all diese Faktoren berücksichtigt hatten, blieben noch diverse Optionen für den Starttermin übrig. Dann muss immer über Tag- oder Nachtstart entschieden werden. Zulässige Startwinkel sind zu berücksichtigen. Die neuesten Wetterdaten …« Die Augen seiner Zuhörer wurden allmählich glasig. Sie konnten ihm längst nicht mehr folgen. »Jedenfalls«, schloss Casper mit einem Gefühl tiefer Erleichterung, »stellte sich heraus, dass sieben Uhr heute früh der beste Termin ist. Das leuchtet Ihnen doch sicherlich ein, nicht wahr?« Lucas schien sich zu schütteln, wie ein Hund, den man aus einem Nickerchen aufschreckt. »Ja, natürlich.«, »Trotzdem wäre ich gerne näher dran«, sagte Rashad mit Wehmut in der Stimme. Er blickte zu der Rakete hinüber, diesem stupsnäsigen kleinen Leuchtpunkt am Horizont. »Aus dieser Entfernung sieht sie ja nicht eben beeindruckend aus, was? So klein.« Casper lächelte, obwohl er spürte, wie sich sein Magen in nervöser Übersäuerung selbst zu verdauen begann. »Nun, Sie wissen ja, wie es heißt, Mr. Rashad. Nicht auf die Größe kommt es an, sondern auf das, was man damit anstellt.« Das ist die letzte Chance, dachte Jack. Ein Schweißtropfen rann über seine Schläfe und wurde vom Futter seines Helms aufgesogen. Er wollte seinen rasenden Puls beruhigen, doch sein Herz war wie ein wild gewordenes Tier, das aus seinem Brustkorb auszubrechen versuchte. So viele Jahre hatte er nur von diesem Augenblick geträumt: festgeschnallt im Pilotensitz, das Visier geschlossen, das Sauerstoffventil geöffnet. Der Countdown, der auf »Zero« zutickte. In seinen Träumen hatte Angst keine Rolle gespielt, nur Erregung und freudige Erwartung. Er hatte nicht damit gerechnet, vor Angst wie gelähmt zu sein. »Sie sind bei T minus fünf Minuten. Der Zeitpunkt zum Aussteigen wäre jetzt.« Es war die Stimme von Gordon Obie, mit dem er über Kabel verbunden war. Während der Vorbereitungen hatte Gordon Jack immer wieder die Gelegenheit gegeben, von seinem Vorhaben Abstand zu nehmen. Während des Fluges von White Sands nach Nevada. In den frühen Morgenstunden, als Jack im Hangar von Apogee Engineering den Raumanzug angelegt hatte. Und schließlich auf der Fahrt durch die stockfinstere Wüste zur Startrampe. Dies war Jacks allerletzte Gelegenheit. »Noch können wir den Countdown stoppen«, sagte Gordon, »und die ganze Mission abbrechen.«, »Ich bin nach wie vor klar zum Start.« »Dann ist das hier unser letzter Sprechkontakt. Es darf keine Funkmeldung von Ihrer Seite geben, keinen Downlink zur Erde, keinen Kontakt mit der ISS, sonst fliegt alles auf. Sobald wir Ihre Stimme hören, brechen wir die ganze Mission ab und holen Sie zurück.« Wenn wir das dann noch können, lautete der unausgesprochene Zusatz. »Habe verstanden.« Es war einen Moment still. »Sie müssen es nicht tun. Niemand erwartet es von Ihnen.« »Bringen wir es hinter uns. Zünden Sie einfach die verdammte Lunte an, okay?« Gordon antwortete mit einem deutlich vernehmbaren Seufzen. »Okay Sie sind startklar. Wir haben T minus drei Minuten und zählen weiter.« »Danke, Gordie. Für alles.« »Viel Glück und Gottes Segen, Jack McCallum.« Die Verbindung brach ab. Das war vielleicht die letzte menschliche Stimme, die ich in meinem Leben gehört habe, dachte Jack. Von diesem Moment an würde die Bodenkontrolle von Apogee nur noch Steuerdaten an die Bordcomputer des Orbiters funken. Das Raumschiff flog sich selbst; Jack war nichts weiter als der hilflose Affe auf dem Pilotensitz. Er schloss die Augen und konzentrierte sich auf seinen Herzschlag. Er hatte sich verlangsamt. Jack war jetzt merkwürdig ruhig; bereit, dem Unvermeidlichen ins Auge zu blicken, was immer das sein mochte. Er hörte das Surren und Klicken der Bordsysteme, die sich auf den großen Sprung vorbereiteten. Er stellte sich den wolkenlosen Himmel vor, die Atmosphäre, so dicht wie Wasser, gleich einem Meer aus Luft, das er durchschwimmen musste, um in das kalte, reine Vakuum, des Alls zu gelangen. Wo Emma mit dem Tod rang. Auf der Zuschauertribüne war eine ominöse Stille eingetreten. Die Countdown-Uhr, deren Bild auf dem Videomonitor zu sehen war, überschritt die »T-minus-60-Sekunden« -Marke und tickte weiter. Sie ziehen den Start durch, dachte Casper, und die Panik trieb ihm noch mehr Schweißperlen auf die Stirn. Im Grunde seines Herzens hatte er nicht geglaubt, dass dieser Moment je eintreten würde. Er hatte mit Verzögerungen gerechnet, mit einem Abbruch, sogar mit einem kompletten Rückzieher. Er hatte so viele Enttäuschungen durchlebt, hatte so viel Pech mit diesem verfluchten Vogel gehabt, dass die blanke Angst jetzt wie Galle in ihm hochstieg. Er ließ den Blick über die Gesichter auf der Tribüne schweifen und sah, dass viele Münder die Sekunden leise mitzählten. Aus dem Flüstern wurde allmählich ein rhythmisches Raunen. »Neunundzwanzig. Achtundzwanzig. Siebenundzwanzig …« Das Raunen schwoll zu einem allgemeinen Murmeln an, das mit jeder Sekunde lauter wurde. »Zwölf. Elf. Zehn …« Caspers Hände zitterten so heftig, dass er sich ans Geländer klammern musste. Er spürte das Pochen seines Pulsschlags in den Fingerspitzen. »Sieben. Sechs. Fünf …« Er schloss die Augen. O Gott, was hatten sie getan? »Drei. Zwei. Eins …« Die Zuschauermenge hielt wie gebannt gleichzeitig die Luft an. Dann rollte das Donnern der Feststoffraketen über ihn hinweg, und er riss die Augen auf. Er starrte in den Himmel, auf den Feuerschweif, der vom Horizont emporschoss. Gleich würde es passieren. Zuerst der grelle Blitz, dann, mit der, Verzögerung der Schallgeschwindigkeit, die Druckwelle der Explosion, die auf ihre Trommelfelle einhämmern würde. So war es bei der Apogee I gewesen. Aber der feurige Streifen zog weiter seine Bahn, bis am tiefblauen Himmel nur noch ein blasses Pünktchen zu erkennen war. Eine Hand schlug ihm kräftig auf den Rücken. Er zuckte zusammen und drehte sich um. Mark Lucas strahlte ihn an. »Saubere Arbeit, Mulholland! Was für ein fantastischer Start!« Casper riskierte noch einen ängstlichen Blick gen Himmel. Immer noch keine Explosion. »Aber Sie hatten ja wohl nie irgendwelche Zweifel, was?«, meinte Lucas. Casper schluckte. »Nicht die Spur.« Die letzte Dosis. Emma drückte auf den Kolben und leerte den Inhalt der Spritze in ihre Vene. Sie zog die Nadel heraus, drückte einen Wattebausch auf die Einstichstelle und winkelte den Arm an, um ihn festzuklemmen, während sie die Nadel entsorgte. Es kam ihr vor wie eine feierliche Zeremonie, bei der jede Handlung mit Ehrfurcht ausgeführt wird, begleitet von dem sicheren Wissen, dass sie all dies nie wieder spüren würde: den Einstich der Nadel, den Druck des Wattebauschs in ihrer Armbeuge. Wie lange würde diese letzte Dosis HCG sie noch am Leben halten? Sie drehte sich um und blickte auf den Mäusekäfig, den sie in das russische Modul gebracht hatte, wo es heller war. Das einzige überlebende Weibchen hatte sich zu einem zitternden Knäuel zusammengerollt; es lag im Sterben. Die Wirkung des Hormons war nicht von Dauer. Die Jungen waren am Morgen gestorben. Und morgen, dachte Emma, werde ich das einzige lebende Wesen an Bord der Station sein., Nein, nicht das Einzige. Sie hatte die Lebensform in ihrem Inneren vergessen. Die Hunderte von Larven, die schon bald aus ihrem Ruhezustand erwachen würden, um zu fressen und zu wachsen. Sie legte die Hand auf ihren Bauch wie eine Schwangere, die den Fötus in ihrem Leib fühlt. Wie ein echter Fötus würde der Organismus, den sie in sich trug, Teile ihrer DNS enthalten. In diesem Sinne war er ihr biologischer Abkömmling, und er besaß das genetische Gedächtnis jedes Wirts, dessen er sich je bedient hatte. Kenichi Hirai. Nikolai Rudenko. Diana Estes. Und jetzt Emma. Sie war die Letzte. Es gab keine weiteren Wirte, keine neuen Opfer, denn es gab keine Retter. Die Station war eine verseuchte Grabkammer, so verboten und unberührbar wie einst die Leprasiedlungen. Sie glitt aus dem RSM heraus und schwebte auf den Teil der Station zu, dessen Stromversorgung lahm gelegt war. Es war so dunkel, dass sie kaum den Weg durch den Verbindungsknoten fand. Bis auf das rhythmische Seufzen ihres eigenen Atems war hier alles totenstill. Sie atmete die Luftmoleküle ein, die ihren Weg durch die Lungen der Menschen genommen hatten, die jetzt tot waren. Immer noch spürte sie die Gegenwart der fünf, die ihr Leben verloren hatten, glaubte das Echo ihrer Stimmen zu hören, bis die letzten schwachen Lautfetzen sich schließlich verflüchtigten und der Stille wichen. Dies war die Luft, in der sie sich bewegt hatten, und sie war immer noch erfüllt von ihrem Sterben. Und bald, dachte sie, wird sie auch von meinem Tod erfüllt sein. 24. August Jared Profitt wurde kurz nach Mitternacht geweckt. Schon nach, dem zweiten Läuten des Telefons hatte er den Tiefschlaf abgeschüttelt und war hellwach. Er griff nach dem Hörer. Die Stimme am anderen Ende klang schroff. »Hier spricht General Gregorian. Ich habe soeben mit unserem Kontrollzentrum in Cheyenne Mountain gesprochen. Dieser so genannte Demonstrationsflug von Nevada aus befindet sich immer noch auf Rendezvouskurs mit der ISS.« »Welcher Flug?« »Der von Apogee Engineering.« Profitt runzelte die Stirn und versuchte den Namen einzuordnen. Jede Woche fanden überall auf der Welt zahlreiche Raketenstarts statt. Hunderte von kommerziellen Raumfahrtunternehmen testeten ständig Boostersysteme, schickten Satelliten in den Orbit oder feuerten gar die eingeäscherten Überreste Verstorbener ins All. Das Raumfahrtkommando hatte bereits neuntausend künstliche Objekte unter Beobachtung, die um die Erde kreisten. »Helfen Sie mir auf die Sprünge, was hat es mit diesem Start in Nevada auf sich?« »Apogee testet einen neuen wiederverwendbaren Raumgleiter. Sie haben ihn gestern Morgen um null-siebenhundertzehn abgefeuert. Sie haben die Luftfahrtbehörde vorschriftsmäßig informiert, aber wir haben erst nachträglich davon erfahren. Dieser Flug ist als Erprobung ihres neuen RLV in der Umlaufbahn deklariert. Eintritt in eine niedrige Erdumlaufbahn, Vorbeiflug an der ISS, dann Wiedereintritt. Wir verfolgen sie jetzt seit anderthalb Tagen, und ihre letzten orbitalen Zündungen lassen darauf schließen, dass sie der Station möglicherweise näher kommen, als sie uns gesagt haben.« »Wie nahe?« »Das hängt von ihren nächsten Zündungsmanövern ab.« »Nahe genug für ein tatsächliches Rendezvous? Ein Andockmanöver?«, »Das ist mit diesem speziellen Raumfahrzeug nicht möglich. Die technischen Daten ihres Orbiters liegen uns vor. Es ist nur ein Prototyp ohne orbitales Andocksystem. Sie können allenfalls vorbeifliegen und mal kurz winken.« »Winken?« Profitt setzte sich plötzlich im Bett auf. »Wollen Sie damit sagen, dass dieses RLV bemannt ist?« »Nein, Sir. Das war nur bildlich gesprochen. Apogee sagt, das Fahrzeug sei unbemannt. Es sind Tiere an Bord, darunter ein Klammeraffe, aber kein Pilot. Wir haben auch keine Sprechverbindung zwischen Bodenstation und Raumschiff aufgefangen.« Ein Klammeraffe, dachte Profitt. Seine Anwesenheit an Bord des Raumgleiters bedeutete, dass sie die Möglichkeit eines Piloten an Bord nicht ausschließen konnten. Die Umgebungs- sensoren des Orbiters konnten bei ihrer Kohlendioxidmessung nicht zwischen Tier und Mensch unterscheiden. Diese Informationslücke beunruhigte ihn. Noch mehr beunruhigte ihn der Zeitpunkt des Starts. »Ich kann nicht sagen, ob es einen Grund zur Besorgnis gibt«, sagte Gregorian. »Aber Sie hatten ja darum gebeten, über jedes Objekt, das in die Nähe der Station kommt, informiert zu werden.« »Erzählen Sie mir mehr über Apogee«, unterbrach Profitt ihn. Gregorian schnaubte verächtlich. »Kleine Fische. Eine Flugmaschinenfabrik mit zwölf Mitarbeitern drüben in Nevada. Waren ziemlich vom Pech verfolgt. Vor anderthalb Jahren ist ihnen der erste Prototyp zwanzig Sekunden nach dem Start explodiert, woraufhin sich alle ihre potenziellen Investoren in Luft aufgelöst haben. Es überrascht mich ein wenig, dass sie immer noch mitmischen. Der Booster basiert auf russischer Technologie. Der Orbiter ist eine schlichte Konstruktion ohne alle Extras; die Landung erfolgt mit Bremsfallschirmen. Die Nutzlastkapazität beträgt dreihundert Kilo plus Pilot.«, »Ich fliege sofort nach Nevada. Wir müssen die Sache genauer unter die Lupe nehmen.« »Sir, wir können jede einzelne Bewegung dieses Orbiters verfolgen. Im Moment sehen wir keinen Grund, einzugreifen. Das ist bloß eine unbedeutende Firma, die ein paar neue Investoren zu beeindrucken versucht. Sollte der Orbiter tatsächlich zu einem ernsthaften Problem werden, stehen unsere bodengestützten Abfangjäger jederzeit bereit, um den Vogel runterzuholen.« General Gregorian hatte wahrscheinlich Recht. Die Tatsache, dass ein paar übereifrige Raketenbastler beschlossen hatten, einen Affen ins All zu schießen, stellte noch keine nationale Bedrohung dar. Er musste äußerst behutsam vorgehen. Der Tod von Luther Arnes hatte im ganzen Land einen Aufschrei der Entrüstung ausgelöst. Nicht eben der günstigste Zeitpunkt, schon wieder ein Raumschiff abzuschießen – noch dazu eines, das von einer amerikanischen Privatfirma gebaut worden war. Aber einiges an dem Apogee-Flug bereitete ihm einfach Kopfzerbrechen. Der Zeitpunkt. Die Rendezvous-Manöver. Die Tatsache, dass sie nicht mit Sicherheit ausschließen konnten, dass der Flug bemannt war. Was sollte es denn anderes sein als eine Rettungsaktion? Er sagte: »Ich mache mich auf den Weg nach Nevada.« Fünfundvierzig Minuten später lenkte Profitt seinen Wagen aus der Einfahrt. Die Nacht war wolkenlos, und die Sterne leuchteten wie helle Stecknadelköpfe in einem tiefblauen Samtkissen. Es gab im Universum vielleicht hundert Milliarden Galaxien, und jede Galaxie enthielt wiederum hundert Milliarden Sterne. Wie viele dieser Sterne hatten Planeten, und auf wie vielen dieser Planeten gab es Leben? »Panspermia«, die Theorie, nach der das gesamte Universum von Leben erfüllt ist, war keine reine Spekulation mehr. Der Glaube, nur auf diesem kleinen blauen Klecks in diesem unbedeutenden Sonnensystem existiere Leben,, erschien inzwischen ebenso absurd wie die naive Ansicht der Alten, Sonne und Sterne drehten sich um die Erde. Die einzige unabdingbare Voraussetzung für die Entstehung von Leben war die Anwesenheit von Kohlenstoffverbindungen in Kombination mit Wasser in beliebiger Form. Beides war überall im Universum reichlich vorhanden. Und das bedeutete, dass andere Lebensformen, wie primitiv sie auch sein mochten, ebenso weit verbreitet sein konnten, und dass der Sternenstaub vielleicht mit Bakterien und Sporen geschwängert war. Aus solchen einfachen Formen war alles Leben hervorgegangen. Und was passierte, wenn solche Lebensformen als kosmischer Staub einen Planeten besiedelten, auf dem bereits Leben existierte? Das war Jared Profitts Albtraum. Früher hatte er die Sterne einfach nur schön gefunden. Früher hatte er das Universum mit Ehrfurcht und Staunen betrachtet. Wenn er heute in den Nachthimmel blickte, sah er nur die endlose Bedrohung. Er sah das biologische Armageddon. Die Eroberer der Erde, die aus dem Himmel herabstiegen. Die Zeit zum Sterben war gekommen. Emmas Hände zitterten, und das Pochen in ihrem Schädel war so heftig, dass sie die Zähne zusammenbeißen musste, um nicht laut zu schreien. Die letzte Morphiumspritze hatte die Schmerzen kaum lindern können, und das Narkotikum hatte sie derart benebelt, dass sie Schwierigkeiten hatte, irgendetwas auf dem Computerbildschirm zu erkennen. Oder auf der Tastatur unter ihren Fingern. Sie hielt inne, um das Zittern in ihren Händen unter Kontrolle zu bekommen. Dann begann sie zu schreiben. Persönliche E-Mail an: Jack McCallum Wenn ich einen letzten Wunsch hätte, dann würde ich, gerne noch einmal Deine Stimme hören. Ich weiß nicht, wo du bist und warum ich nicht mit Dir sprechen kann. Ich weiß nur, dass dieses Ding in mir drin bald den Sieg davonträgt. Während ich diese Zeilen schreibe, spüre ich schon, wie es an Boden gewinnt. Ich fühle, wie meine Kräfte nachlassen. Ich habe gekämpft, solange ich konnte. Aber jetzt bin ich müde. Ich will nur noch schlafen. Solange ich noch die Kraft zum Schreiben habe, will ich vor allem dieses eine sagen. Ich habe nie aufgehört, Dich zu lieben. Es heißt, dass niemand die Schwelle zur Ewigkeit mit einer Lüge auf den Lippen überschreitet. Es heißt, was auf dem Sterbebett gebeichtet wird, darf man getrost glauben. Und dies ist meine Beichte. Ihre Hände zitterten jetzt so stark, dass sie nicht weiterschreiben konnte. Sie setzte ihren Namen darunter und klickte auf »Abschicken«. Im Medizinschrank fand sie Valium. Es waren noch zwei Tabletten übrig. Sie nahm beide mit einem Schluck Wasser. Ihr Gesichtsfeld begann sich bereits zu verengen, und ihre Beine waren so taub, als gehörten sie gar nicht zu ihrem Körper, als seien es die Beine einer Fremden. Es blieb nicht mehr viel Zeit. Sie hatte nicht mehr die Kraft, einen EVA-Anzug anzulegen. Was spielte es schon für eine Rolle, wo sie starb? Die Station war bereits verseucht. Ihre Leiche war nur ein weiterer Gegenstand, der entsorgt werden musste. Sie tauchte zum letzten Mal in den dunklen Teil der Station. Die Kuppel war der Ort, wo sie ihre letzten wachen Momente verbringen wollte. Sie würde in der Dunkelheit schweben und hinunterblicken auf die Erde in all ihrer Pracht. Durch die Sichtfenster konnte sie den blaugrauen Bogen des Kaspischen Meeres sehen. Wolkenwirbel über Kasachstan und Schnee auf, den Gipfeln des Himalaja. Da unten leben Milliarden von Menschen ihr Leben, dachte sie. Und hier bin ich, ein sterbendes Fünkchen am Himmel. »Emma?« Es war Todd Cutler, dessen Stimme leise aus ihrem Kopfhörer drang. »Wie geht es dir?« »Nicht … nicht so besonders«, murmelte sie. »Schmerzen. Sehkraft lässt nach. Ich habe die letzte Valium genommen.« »Du musst durchhalten, Emma. Hör auf mich. Gib nicht auf. Noch nicht.« »Ich habe die Schlacht bereits verloren, Todd.« »Nein, das hast du nicht! Du darfst den Glauben nicht verlieren …« »An Wunder?« Sie lachte leise. »Das eigentliche Wunder ist, dass ich überhaupt hier oben bin. Dass ich die Erde von einem Ort aus sehe, an dem erst so wenige Menschen je gewesen sind …« Sie berührte das Glas der Kuppel und spürte die Wärme der Sonne. »Ich wünschte nur, ich könnte mit Jack sprechen.« »Wir versuchen, das hinzubekommen.« »Wo ist er? Wieso könnt ihr ihn nicht erreichen?« »Er arbeitet wie wild daran, dich nach Hause zu bringen. Das musst du uns glauben.« Tränen traten ihr in die Augen, und sie blinzelte. Ich glaube es. »Können wir irgendetwas für dich tun?«, fragte Todd. »Möchtest du sonst noch mit jemandem sprechen?« »Nein«, seufzte sie. »Nur mit Jack.« Es war still am anderen Ende. »Ich glaube … ich glaube, was ich jetzt am meisten will …« »Ja?«, sagte Todd. »Ich will schlafen. Das ist alles. Einfach nur schlafen.« Er räusperte sich. »Natürlich. Ruh dich nur gut aus. Ich bin immer hier, falls du mich brauchst.« Er schloss mit einem leisen, »Gute Nacht, ISS«. Gute Nacht, Houston, dachte sie. Und sie nahm den Kopfhörer ab und ließ ihn in der Dunkelheit davontreiben., Die Reifen der schwarzen Limousinen wirbelten eine gewaltige Staubwolke auf, als der Konvoi vor dem Eingang von Apogee Engineering zum Stehen kam. Jared Profitt stieg aus dem ersten Wagen aus und blickte zu dem Gebäude hinauf. Es sah aus wie ein Hangar, ein fensterloser, trister Industriebau, dessen Dach mit Satellitenanlagen gespickt war. Er nickte General Gregorian zu. »Sichern Sie das Gebäude.« Es verging kaum eine Minute, bis Gregorians Männer signalisierten, dass alles gesichert war. Profitt betrat das Gebäude. Drinnen traf er auf eine bunt gemischte Gruppe von Männern und Frauen mit angespannten und verärgerten Mienen, die zusammengepfercht in einer Ecke standen. Zwei Gesichter erkannte er sofort: den Direktor der Flugeinsatzabteilung Gordon Obie und den Shuttle-Flugdirektor Randy Carpenter. Die NASA war also hier, wie er bereits vermutet hatte. Dieses unscheinbare Gebäude mitten in der Wüste von Nevada hatte sich in einen rebellischen Ableger der Mission Control verwandelt. Im Unterschied zum Flugkontrollzentrum der NASA handelte es sich hier offensichtlich um eine Low-Budget-Produktion. Der Fußboden bestand aus nacktem Beton. Ein Gewirr von Kabeln und Drähten zog sich durch den ganzen Raum, und zwischen ausrangierten elektronischen Bauteilen schlich eine enorm übergewichtige Katze umher. Profitt trat zu den Flugkonsolen und warf einen Blick auf die einlaufenden Daten. »Wie ist der Status des Orbiters?«, fragte er. Einer von Gregorians Männern, ein Controller des US- Raumfahrtkommandos, antwortete: »Er hat die Ti-Zündung durchgeführt und bewegt sich jetzt entlang der R-Bahn. Er könnte in fünfundvierzig Minuten auf die ISS treffen.«, »Lassen Sie ihn nicht näher herankommen!« »Nein!«, rief Gordon Obie. Er löste sich aus der Gruppe und trat vor. »Tun Sie das nicht. Sie verstehen nicht …« »Es darf nicht zu einer Evakuierung der ISS-Crew kommen«, sagte Profitt. »Das ist keine Evakuierung!« »Was hat der Orbiter dann dort oben zu suchen? Er ist doch eindeutig auf Rendezvous-Kurs mit der Station!« »Nein, das ist er nicht. Das kann er gar nicht sein. Er hat doch gar kein Andocksystem; es ist völlig ausgeschlossen, dass er sich an die Station ankoppelt. Es gibt nicht die geringste Gefahr einer Kontamination.« »Sie haben meine Frage nicht beantwortet, Mr. Obie. Was hat die Apogee II da oben zu suchen?« Gordon zögerte. »Sie führt nur eine Annäherungssequenz durch, das ist alles. Die Fähigkeit der Apogee zu einem Rendezvous soll getestet werden.« »Sir«, warf der Controller des Raumfahrtkommandos ein. »Ich sehe hier eine schwerwiegende Anomalie.« Profitt fuhr herum und starrte auf die Konsole. »Was für eine Anomalie?« »Sie betrifft den Kabinendruck. Er ist auf fünfhundertfünfzig Hektopascal gefallen. Er sollte bei eintausendfünfzehn liegen. Entweder verliert der Orbiter rapide Luft, oder sie haben den Druck absichtlich gesenkt.« »Wie lange ist er schon so niedrig?« Rasch drückte der Controller einige Tasten, und auf dem Bildschirm erschien ein Schaubild, das die zeitliche Veränderung des Kabinendrucks darstellte. »Ihren Computern zufolge wurde über die ersten zwölf Stunden nach dem Start ein Kabinendruck von eintausendfünfzehn aufrechterhalten. Vor zirka sechsunddreißig Stunden fiel er auf siebenhundert und, blieb dann stabil bis vor einer Stunde.« Plötzlich warf der Controller den Kopf hoch. »Sir, ich weiß, was sie da machen! Es scheint sich um ein Prebreathe-Protokoll zu handeln.« »Wozu dient dieses Protokoll?« »Einer EVA. Einem Weltraumspaziergang.« Er sah Profitt an. »Ich glaube, da ist jemand an Bord des Orbiters.« Profitt wandte sich zu Gordon Obie um. »Wer ist an Bord? Wen haben Sie da hochgeschickt?« Gordon sah, dass es keinen Sinn mehr hatte, die Wahrheit zu verschweigen. Mit stiller Resignation erwiderte er: »Jack McCallum.« Emma Watsons Mann. »Dann ist es also doch eine Rettungsaktion«, sagte Profitt. »Wie sollte das denn funktionieren? Er geht raus, und dann?« »Dann kommen die Steuerdüsen zum Einsatz. Der Orlan-M- Anzug, den er trägt, ist entsprechend ausgestattet. Mit Hilfe der Düsen bewegt er sich von der Apogee II zur Station und steigt durch die Druckschleuse ein.« »Und dann holt er seine Frau raus und bringt sie zur Erde?« »Nein. Das ist nicht geplant. Hören Sie, er sieht ein – wir alle sehen ein –, dass sie nicht zurückkehren kann. Jack hat den Flug auf sich genommen, um das Ranavirus zur Station zu bringen.« »Und wenn das Virus nicht anschlägt?« »Das ist das Risiko dabei.« »Er begibt sich in die verseuchte Atmosphäre der Station. Wir würden niemals zulassen, dass er zurückkehrt.« »Das hat er auch nicht vor! Der Orbiter soll ohne ihn zurückkehren.« Gordon hielt inne und sah Profitt unverwandt an. »Es ist ein Flug ohne Rückfahrkarte, und Jack weiß das. Er hat die Bedingungen akzeptiert. Seine Frau liegt da oben im Sterben! Er kann und wird sie nicht allein sterben lassen.«, Profitt schwieg betroffen. Er blickte auf die Konsole und auf den Monitor, über den die Daten flossen. Während die Sekunden verstrichen, musste er an seine eigene Frau denken, an Amy, die im Bethesda Hospital im Sterben gelegen hatte. Er dachte daran zurück, wie er voller Panik durch den Flughafen von Denver gerannt war, um den nächsten Flug zurück zu ihr noch zu erreichen, und an seine Verzweiflung, als er außer Atem am Flugsteig angelangt war, nur um das Flugzeug zum Start davonrollen zu sehen. Er dachte daran, welche Verzweiflung Jack McCallum umtreiben musste, an die Höllenqualen, die es für ihn bedeutete, seinem Ziel zum Greifen nah zu kommen und es dann unerbittlich entschwinden zu sehen. Und er dachte: Auf der Erde wird niemand durch diese Aktion Schaden erleiden. Niemand außer McCallum. Er hat seine Entscheidung getroffen, in vollem Bewusstsein der Konsequenzen. Welches Recht habe ich, ihn daran zu hindern? An den Controller des Raumfahrtkommandos gewandt sagte er: »Überlassen Sie die Konsolen wieder Apogee. Lassen Sie die Leute mit ihrer Mission fortfahren.« »Sir?« »Ich sagte, lassen Sie den Orbiter seinen Flug fortsetzen.« Einen Augenblick herrschte fassungsloses Schweigen. Dann stürmten die Apogee-Controller wieder an ihre Plätze. »Mr. Obie«, sagte Profitt, indem er sich zu Gordon umdrehte, »Sie werden verstehen, dass wir McCallum auf Schritt und Tritt überwachen. Ich bin nicht Ihr Feind. Aber ich habe den Auftrag, für das Gemeinwohl Sorge zu tragen, und ich werde tun, was erforderlich ist. Wenn ich das geringste Anzeichen dafür entdecke, dass Sie vorhaben, einen dieser beiden Astronauten zur Erde zu bringen, werde ich die Vernichtung der Apogee II anordnen.« Gordon Obie nickte. »Ich habe nichts anderes von Ihnen erwartet.«, »Dann wissen wir beide, woran wir sind.« Profitt holte tief Luft und drehte sich zu der Konsolenreihe um. »Also dann. Sehen Sie zu, dass Sie diesen Mann zu seiner Frau schaffen.« Jack stand – oder vielmehr schwebte – auf der Schwelle zur Unendlichkeit. Kein noch so intensives EVA-Training im WET-F-Becken hätte ihn auf die Angst vorbereiten können, die jetzt in seinen Eingeweiden wühlte, auf die lähmende Furcht, die ihn erfasste, als er in die Leere des Weltraums starrte. Er hatte die Luke zum nach außen offenen Nutzlastdock aufgestoßen, und das Erste, was er erblickte, war weit unter ihm in Schwindel erregender Tiefe die Erde. Die ISS konnte er nicht sehen, sie schwebte über ihm, verdeckt vom Rumpf des Orbiters. Um sie zu erreichen, musste er durch diese Ladeluke schwimmen und sich auf die andere Seite der Apogee II begeben. Aber zuerst musste er sich zwingen, seinen Instinkt zu ignorieren, der ihn mit aller Macht zurück in die Luftschleuse treiben wollte. »Emma«, sagte er, und der Klang ihres Namens war wie ein leises Gebet. Er holte noch einmal Luft, bereit, den Rand der Luke loszulassen und sich in die Weite des Alls zu stürzen. »Apogee II, hier Capcom Houston. Apogee – Jack – bitte antworten.« Der Funkspruch aus seinem Kopfhörer kam für Jack völlig überraschend. Er hatte nicht damit gerechnet, dass man vom Boden aus Kontakt zu ihm aufnehmen würde. Die Tatsache, dass Houston ihn ganz offen mit seinem Namen anrief, konnte nur bedeuten, dass alles aufgeflogen war. »Apogee, wir bitten Sie dringend um Antwort.« Er schwieg. Sollte er zugeben, dass er sich in der Erdumlaufbahn befand? »Jack, man hat uns wissen lassen, dass das Weiße Haus nicht, in Ihre Mission eingreifen wird. Vorausgesetzt, Sie sind sich über einen wesentlichen Punkt im Klaren: Es wird keinen Rückflug geben.« Der Capcom machte eine Pause und fuhr dann leise fort: »Wenn Sie die ISS betreten, können Sie nicht zurück. Sie werden nie mehr heimkommen.« »Hier Apogee II«, antwortete Jack schließlich. »Nachricht erhalten und verstanden.« »Sie haben immer noch vor, es durchzuziehen? Überlegen Sie es sich gut.« »Was glauben Sie, weshalb ich hier bin? Um die schöne Aussicht zu genießen?« »Äh, wir haben verstanden. Aber bevor Sie fortfahren, sollten Sie eines wissen. Wir haben vor sechs Stunden den Kontakt mit der ISS verloren.« »Was soll das heißen, den Kontakt verloren?« »Emma antwortet nicht mehr.« Sechs Stunden, dachte er. Was ist in den letzten sechs Stunden passiert? Der Start lag zwei Tage zurück. So lange hatte es gedauert, bis die Apogee II die ISS eingeholt und die Rendezvous-Manöver abgeschlossen hatte. Während dieser ganzen Zeit war er von jeglicher Kommunikation abgeschnitten gewesen und folglich nicht auf dem Laufenden über das, was sich auf der Station abgespielt hatte. »Es könnte zu spät sein. Vielleicht wollen Sie es sich noch einmal überlegen …« »Was sagt die Biotelemetrie?«, unterbrach Jack ihn. »Wie ist ihr Rhythmus?« »Sie ist nicht angeschlossen. Sie hat sich die Kabel abgenommen.« »Dann wissen Sie es also nicht. Sie können mir gar nicht sagen, was los ist.« »Kurz bevor der Sprechkontakt abgebrochen ist, hat sie Ihnen, eine letzte E-Mail geschickt.« Leise fügte der Capcom hinzu: »Jack, es war ihr Abschiedsbrief.« Nein. Plötzlich ließ er den Rand der Luke los, stieß sich ab und tauchte kopfüber aus der Luftschleuse in die offene Ladebucht. Nein. Er schnappte nach einem Haltegriff und kletterte über die Ladeluke auf die andere Seite der Apogee II. Mit einem Mal war die Raumstation einfach da; sie schwebte über seinem Kopf, so riesig und ausladend, dass ihm vor Staunen einen Moment lang der Atem stockte. Dann erfasste ihn Panik, und er dachte: Wo ist die Druckschleuse? Ich sehe die Druckschleuse nicht! Da waren so viele Module, so viele Sonnensegel, ausgebreitet über eine Fläche doppelt so groß wie ein Footballfeld. Er fand sich nicht zurecht. Er hatte die Orientierung verloren, überwältigt und verwirrt von der gewaltigen Größe der Konstruktion. Dann entdeckte er die dunkelgrüne Sojus-Kapsel, die sich von der Silhouette der Station abhob. Er befand sich direkt unterhalb des russischen Teils. Plötzlich fand er sich wieder zurecht. Rasch wandte er den Blick zum amerikanischen Ende und erkannte das US-Wohnmodul. An dessen oberem Ende befand sich Node 1, und von diesem zweigte die Druckschleuse ab. Er wusste, wohin er sich wenden musste. Jetzt galt es also. Ohne Leine, ohne jeden Halt und nur auf seine Steuerdüsen angewiesen, musste er den leeren Raum durchqueren. Er startete den Düsensatz, stieß sich von der Apogee ab und nahm Kurs auf die ISS. Es war sein erster Weltraumspaziergang, und seine unge- schickten Bewegungen zeugten von seiner Unerfahrenheit. Er konnte nicht abschätzen, mit welcher Geschwindigkeit er sich seinem Ziel näherte. So prallte er mit derartiger Wucht gegen den Rumpf des Moduls, dass er fast zurückgeschleudert worden wäre und sich gerade noch an einem Handgriff festhalten konnte. Beeil dich. Sie stirbt., Krank vor Angst und in schnellen, heftigen Stößen atmend, hangelte er sich an der Außenseite des Moduls entlang. »Houston«, keuchte er, »ich brauche den Surgeon … er soll sich bereithalten …« »Roger, wird gemacht.« »Ich … ich habe Node 1 fast erreicht …« »Jack, hier Surgeon.« Todd Cutlers Stimme klang ruhig, aber eindringlich. »Du hast die letzten zwei Tage nicht mitbe- kommen, was gelaufen ist. Es gibt da ein paar Dinge, die du wissen musst. Emmas letzte Dosis HCG liegt fünfundfünfzig Stunden zurück. Ihre Laborwerte haben sich seither verschlechtert. Amylase und CPK sind enorm gestiegen. Beim letzten Funkkontakt klagte sie über Kopfschmerzen und schwindende Sehkraft. Das war vor sechs Stunden. Über ihren gegenwärtigen Zustand wissen wir nichts.« »Ich bin an der Luke zur Druckschleuse!« »Die Software der Station ist auf EVA-Modus umgestellt. Alles klar zum Druckausgleich.« Jack öffnete die Luke und hievte sich in die Mannschafts- schleuse. Als er sich umdrehte, um die Klappe wieder zu schließen, fiel sein Blick auf die Apogee II. Sie entfernte sich bereits von der Station. Sein einziges Rettungsboot flog ohne ihn nach Hause. Jetzt gab es endgültig kein Zurück mehr. Er schloss die Luke und verriegelte sie. »Druckausgleichs- ventil geöffnet«, meldete er. »Beginne mit der Kompression.« »Ich möchte nur, dass du auf das Schlimmste vorbereitet bist«, sagte Todd. »Für den Fall, dass sie …« »Sag zur Abwechslung mal etwas Nützliches.« »Okay. Okay, hier ist das Neueste von USAMRIID. Das Ranavirus scheint bei ihren Versuchstieren tatsächlich zu wirken. Allerdings ist der Effekt auf das Frühstadium begrenzt. Es wirkt nur, wenn es innerhalb von sechsunddreißig Stunden, nach der Ansteckung verabreicht wird.« »Und wenn man es danach gibt?« Cutler antwortete nicht. Sein Schweigen bestätigte die schlimmsten Befürchtungen. Der Druck in der Mannschaftsschleuse war auf neunhundert- fünfundsechzig Hektopascal gestiegen. Jack öffnete die Zwischenluke und tauchte in die Ausrüstungsschleuse. Dort riss er sich hastig die Handschuhe von den Händen, legte den Orlan- M-Anzug ab und streifte sich die wassergekühlte Unterbe- kleidung vom Leib. Aus den mit Reißverschlüssen gesicherten Taschen des Raumanzugs zog er verschiedene Packungen mit Medikamenten und fertig aufgezogene Spritzen mit Ranaviren. Er zitterte jetzt schon am ganzen Leib, halb gelähmt vor Angst angesichts dessen, was ihn im Inneren der Station erwartete. Er stieß die innere Luke auf. Und sah sich seinem schlimmsten Albtraum gegenüber. Sie schwebte im Halbdunkel des Verbindungsknotens wie eine Schwimmerin, die in einem dunklen Meer dahintreibt. Nur dass diese Schwimmerin am Ertrinken war. Ihre Arme und Beine wurden von rhythmischen Krämpfen geschüttelt. Heftige Zuckungen durchfuhren ihr Rückgrat, und ihr Kopf ruckte so wild hin und her, dass ihre Haare wie eine Peitsche durch die Luft sausten. Im Todeskampf. Nein, dachte er. Ich lasse dich nicht sterben. Verdammt noch mal, Emma, du wirst mich nicht verlassen. Er packte sie um die Hüfte und schleppte sie in das russische Ende der Station. Dorthin, wo die Module noch Strom und Licht hatten. Ihr Körper zuckte wie ein elektrischer Draht, durch den ein Stromstoß nach dem anderen jagt; sie wand sich in seinen Armen und schlug heftig um sich. Sie war so klein, so zerbrechlich, doch die Kraft, die durch ihren sterbenden Körper strömte, war so enorm, dass er seinem Griff zu entgleiten drohte. Er war nicht mit der Schwerelosigkeit vertraut und stieß immer, wieder wie ein Betrunkener gegen Wände und Luken, während er sich mühte, sie in das russische Servicemodul zu zerren. »Jack, sag doch was«, meldete sich Todd. »Was ist los?« »Ich habe sie in das RSM gebracht … lege sie jetzt auf den Behandlungstisch …« »Hast du ihr das Virus gespritzt?« »Ich muss sie zuerst festbinden. Sie hat Krämpfe …« Er zog ihr die Riemen über Brust und Hüfte und schnallte sie auf dem Behandlungstisch fest. Ihr Kopf schlug nach hinten aus, und ihre Augen verdrehten sich, bis nur noch die grässlich geröteten Lederhäute zu sehen waren. Gib ihr das Virus. Sofort. Ein Stauband war um den Rahmen des Behandlungstisches geschlungen. Er riss es los und band es um ihren heftig um sich schlagenden Arm. Er musste seine ganze Kraft aufwenden, um ihn zu strecken, damit die Ellenbeugenvene frei lag. Mit den Zähnen zog er die Verschlusskappe der Spritze ab. Darin stach er ihr die Nadel in den Arm und drückte den Kolben nieder. »Es ist drin!«, sagte er. »Die ganze Spritze!« »Was macht sie?« »Sie hat immer noch Krämpfe!« »Im Medikamentenschrank ist Dilantin für Infusionen.« »Ich sehe es. Ich lege einen Zugang!« Das Stauband schwebte vorbei. Er hatte fast vergessen, dass in der Schwerelosigkeit alles, was nicht befestigt war, im Handumdrehen außer Reichweite sein konnte. Er schnappte danach und griff erneut nach Emmas Arm. Einen Augenblick später meldete er: »IV Dilantin läuft im Schuss!« »Irgendwelche Veränderungen?« Jack starrte seine Frau an. Wortlos flehte er sie an: Bitte, Emma. Stirb mir jetzt nicht!, Allmählich entspannte sich ihr Rückgrat. Ihre Halsmuskeln wurden schlaff, und ihr Kopf schlug nicht mehr gegen den Tisch. Ihre Pupillen drehten sich wieder nach vorne, sodass er die Regenbogenhäute sehen konnte – zwei dunkle, von blutroter Lederhaut umringte Seen. Kaum war sein Blick auf ihre Pupillen gefallen, als ein Stöhnen aus seiner Kehle drang. Ihre linke Pupille war extrem geweitet. Schwarz und regungslos. Er war zu spät gekommen. Sie würde sterben. Er fasste ihr Gesicht mit beiden Händen, als könnte er sie durch pure Willenskraft zwingen, weiterzuleben. Aber während er sie anflehte, ihn nicht zu verlassen, wusste er, dass weder seine bloße Berührung noch seine Gebete sie retten würden. Der Tod war ein organischer Prozess. Biochemische Vorgänge wie der Ionenfluss durch die Zellmembranen kamen zum Stillstand. Die Gehirnwellen verflachten. Die rhythmischen Kontraktionen des Myokardiums wurden zu einem schwachen Zittern. Sein Wünschen und Flehen würden sie nicht am Leben halten. Aber sie war nicht tot. Noch nicht. »Todd«, sagte er. »Ich höre.« »Wie sieht die terminale Phase aus? Was geschieht mit den Versuchstieren?« »Ich verstehe nicht ganz …« »Du hast gesagt, das Ranavirus wirkt, wenn es früh genug verabreicht wird. Das muss doch heißen, dass es die Chimäre abtötet. Warum funktioniert es dann nicht, wenn man es später gibt?« »Die Gewebeschäden sind schon zu massiv. Es kommt zu inneren Blutungen …« »Wo? Was zeigen die Autopsien?« »Bei den Hunden war in fünfundsiebzig Prozent der Fälle eine, Hirnblutung die Todesursache. Die Enzyme der Chimäre beschädigen Blutgefäße an der Oberfläche der Großhirnrinde. Die Gefäße platzen, und die Blutung führt zu einem letalen Anstieg des Schädelinnendrucks. Wie bei einer schweren Kopfverletzung. Es kommt zu einer Hirnquetschung.« »Und wenn man die Blutung stillt und so die Hirnschädigung verhindert? Wenn man erreicht, dass die Patienten die akute Phase überstehen, könnten sie doch lange genug leben, damit das Ranavirus wirken kann, oder?« »Möglicherweise.« Jack starrte auf Emmas erweiterte Pupille. Eine schreckliche Erinnerung schoss ihm durch den Kopf: Debbie Haning, bewusstlos auf einer Krankenhaustrage. Er hatte Debbie nicht retten können. Er hatte zu lange gezögert, bevor er gehandelt hatte, und durch seine Unentschlossenheit hatte er sie verloren. Dich werde ich nicht verlieren. Er sagte: »Todd, ihre linke Pupille ist stark erweitert. Ich muss trepanieren.« »Was? Du müsstest blind arbeiten, ohne Röntgen …« »Es ist ihre einzige Chance! Ich brauche einen Bohrer. Sag mir, wo das Werkzeug aufbewahrt wird!« »Einen Moment!« Sekunden später war Todds Stimme wieder zu hören. »Wir wissen nicht genau, wo die Russen ihren Kram verstaut haben. Aber die Sachen der NASA sind im Vorratsschrank in Node 1. Sieh nach, was auf den Aufklebern steht, da ist der Inhalt der Packungen genau aufgelistet.« Jack schoss aus dem Servicemodul heraus. Wieder stieß er gegen Wände und Kanten, während er sich unbeholfen in Richtung Node 1 vorarbeitete. Seine Hände zitterten, als er den Schrank öffnete. Er zog drei Nomex-Beutel heraus, bis er denjenigen mit der Aufschrift »Bohrmaschine/Einsätze/Adapter« gefunden hatte. Rasch nahm er noch einen zweiten Beutel mit, Schraubenziehern und einem Hammer und stieß sich sofort wieder ab. Er hatte sie nur wenige Augenblicke allein gelassen, doch die Angst, sie tot vorzufinden, ließ ihn in höchster Eile durch das Zarya-Modul und zurück in das RSM fliegen. Sie atmete noch. Er klebte die Beutel am Tisch fest und zog die Bohrmaschine heraus. Sie war für Reparatur- und Bauarbeiten in der Raumstation gedacht, nicht für neurochirurgische Zwecke. Jetzt, wo er den Bohrer in der Hand hielt und darüber nachdachte, was er eigentlich vorhatte, ergriff ihn Panik. Er operierte unter unsterilen Bedingungen mit einem Instrument, das für Stahlschrauben und nicht für Fleisch und Knochen gedacht war. Er sah Emma an, die schlaff und reglos auf dem Tisch lag, und dachte an das, was unter diesem Schädeldach lag, dachte an ihre grauen Zellen, in denen ein Leben voller Erinnerungen, Träume und Gefühle gespeichert war. Alles, was einzigartig an ihr war, alles, was sie zu Emma machte – und jetzt mit ihr sterben würde. Aus dem Medizinschrank nahm er eine Schere und ein Rasiermesser. Dann packte er eine Strähne ihres Haars und schnitt es ab; anschließend rasierte er die Stoppeln ab, um in Höhe des linken Schläfenbeins eine Fläche für den Einschnitt freizulegen. Dein wunderschönes Haar. Ich habe dein Haar immer geliebt. Ich habe dich immer geliebt. Ihr restliches Haar steckte er zusammen, damit es nicht in die Wunde fiel. Mit einem Klebstreifen fesselte er ihre Hand an den Tisch. Immer schneller und schneller arbeitend, legte er sich jetzt die Instrumente zurecht. Den Absaugkatheter. Das Skalpell. Den Verbandmull. Er schwenkte die Bohreinsätze in Desinfektionsmittel und wischte sie mit Alkohol ab. Dann streifte er sich sterile Handschuhe über und griff nach dem Skalpell. Seine Haut fühlte sich klamm an in den Gummihandschuhen, als er den ersten Schnitt machte. Blut sickerte aus der Kopfhaut, und quoll zu einer Kugel an, die immer größer wurde. Er tupfte das Blut mit Gaze weg und schnitt tiefer, bis die Klinge über den Knochen kratzte. Den Schädel zu öffnen bedeutet, das Gehirn einem ganzen Universum feindlicher Invasoren aus dem Reich der Mikroben auszusetzen. Doch der menschliche Körper ist robust; er kann auch die gröbsten Attacken überleben. Das sagte er sich immer wieder, während er eine kleine Kerbe in das Schläfenbein ritzte und die Spitze des Bohrers in Position brachte. Die alten Ägypter und die Inka hatten mit Erfolg Schädeltrepanationen durchgeführt, hatten mit den primitivsten Werkzeugen und ohne jeden Gedanken an sterile Verfahrensweisen Löcher in Schädeldecken gebohrt. Es war machbar. Seine Hände waren ruhig, seine ganze Energie in wilder Entschlossenheit auf diese Aufgabe konzentriert, als er den Knochen zu durchbohren begann. Nur wenige Millimeter zu tief, und er verletzte das Gehirn. Tausende von kostbaren Erinnerungen wären von einer Sekunde auf die andere vernichtet. Oder er ritzte die Hirnhautarterie an und löste einen unstillbaren Blutstrom aus. Immer wieder hielt er inne, um Atem zu schöpfen und die Tiefe des Lochs zu überprüfen. Schön langsam. Schön langsam. Plötzlich spürte er, wie die letzte feine Knochenschicht nachgab und der Bohrer durchbrach. Sein Herz klopfte bis zum Hals, als er die Spitze vorsichtig herauszog. Sofort bildete sich eine Blutblase; langsam anschwellend quoll sie aus der offenen Stelle. Das Blut war dunkelrot – venös. Er seufzte erleichtert auf. Kein arterielles Blut. Schon jetzt ließ der Druck auf Emmas Gehirn langsam nach, da die innere Blutung durch diese neue Öffnung abfließen konnte. Er saugte die Blutblase ab und benutzte Gaze, um das nachsickernde Blut aufzunehmen, während er das nächste Loch bohrte, und dann das Nächste, bis er ihren Schädel in einem Kreis von einem Zoll Durchmesser perforiert hatte. Als das letzte Loch gebohrt und, der Kreis geschlossen war, waren seine Hände völlig verkrampft und sein Gesicht mit Schweißperlen bedeckt. Er durfte sich keine Ruhepause gönnen; jede Sekunde zählte. Er nahm einen Schraubenzieher und einen Schlosserhammer mit kugelförmiger Finne zur Hand. Lieber Gott, mach, dass es funktioniert. Dass ich sie retten kann. Den Schraubenzieher als Meißel benutzend, trieb er die Spitze behutsam in die Schädeldecke. Dann biss er die Zähne zusammen und hebelte den kreisförmigen Knochendeckel heraus. Ein Schwall Blut schoss hervor. Durch die vergrößerte Öffnung konnte es endlich entweichen, und nach und nach und nach floss es ganz aus der Schädelhöhle ab. Und noch etwas trat aus. Eier. Ein ganzer Klumpen davon schoss heraus und blieb zitternd in der Luft hängen. Er saugte sie mit dem Katheter in den Vakuumbehälter, wo sie keinen Schaden mehr anrichten konnten. Die kleinsten Lebensformen waren zu allen Zeiten die gefährlichsten Feinde des Menschen gewesen. Viren. Bakterien. Parasiten. Und jetzt ihr, dachte Jack und starrte den Behälter an. Aber wir können euch besiegen. Jetzt sickerten nur noch wenige Blutstropfen aus der Schädel- öffnung. Ihr Gehirn war von dem tödlichen Druck befreit. Er sah in Emmas linkes Auge. Die Pupille war immer noch erweitert. Doch als er mit einer Taschenlampe hineinleuchtete, hatte er den Eindruck – oder war es nur Einbildung? –, dass die Ränder ganz leicht zitterten, wie Wellen in einem Teich mit schwarzem Wasser, die zur Mitte hin treiben. Du wirst es überleben, dachte er. Er drückte eine Mullbinde auf die Wunde und legte einen neuen intravenösen Zugang mit Steroiden und Phenobarbital, um sie vorübergehend in ein tieferes Koma zu versetzen und ihr, Gehirn vor weiteren Schäden zu bewahren. Dann schloss er sie an das EKG an. Erst nachdem all das erledigt war, legte er endlich ein Stauband um seinen eigenen Arm und injizierte sich eine Dosis Ranaviren. Es würde sie entweder beide retten oder beide töten. Er würde es bald erfahren. Auf dem EKG-Monitor beschrieb Emmas Herz einen regelmäßigen Sinusrhythmus. Er nahm ihre Hand und wartete auf ein Zeichen. 27. August Gordon Obie betrat den SVO-Kontrollraum und ließ den Blick über die an ihren Konsolen arbeitenden Männer und Frauen schweifen. Der Großbildschirm mit der Weltkarte zeigte die gewundene Flugbahn der Raumstation an. In diesem Moment würden Dorfbewohner in der algerischen Wüste, die zufällig zum Himmel schauten, erstaunt einen merkwürdigen Stern erblicken, der über das Firmament zog, strahlender noch als die Venus. Einen Stern, der im ganzen Universum nicht seinesgleichen hatte, denn er war nicht von einem allmächtigen Gott oder von irgendwelchen Naturgewalten erschaffen worden, sondern von der schwachen Hand des Menschen. Und hier in diesem Raum, eine halbe Erdumrundung von der algerischen Wüste entfernt, saßen die Hüter dieses Sterns. Flugdirektor Woody Ellis drehte sich um und begrüßte Gordon mit einem traurigen Nicken. »Kein Ton. Nichts zu hören von da oben.« »Wie lange ist der letzte Funkkontakt her?« »Jack hat sich vor fünf Stunden abgemeldet, um ein wenig zu schlafen. Er hat sich seit drei Tagen nicht mehr richtig ausruhen können. Wir sollten ihn nicht stören.« Drei Tage, und in Emmas Zustand war immer noch keine, Veränderung eingetreten. Gordon seufzte und ging die hintere Reihe entlang zu der Konsole des Flight Surgeon. Dort saß Todd Cutler, unrasiert und mit fahlem Gesicht, und verfolgte Emmas Biotelemetriewerte auf dem Monitor. Und wann hat Todd das letzte Mal geschlafen?, fragte Gordon sich. Alle sahen erschöpft aus, aber niemand war bereit, die Niederlage einzugestehen. »Sie hält immer noch durch«, sagte Todd leise. »Wir haben das Phenobarbital abgesetzt.« »Aber sie ist nicht aus dem Koma erwacht?« »Nein.« Seufzend lehnte Todd sich zurück und kniff sich in die Nasenwurzel. »Ich weiß nicht, was ich sonst noch tun soll. So etwas ist mir noch nie vorgekommen. Ein neurochirurgischer Eingriff im Weltraum.« Viele von ihnen hatten im Verlauf der letzten Wochen solche Sätze gesagt. So etwas ist mir noch nie vorgekommen. Das ist mir neu. So etwas haben wir noch nie gesehen. Aber war das nicht die Quintessenz aller Forschung? Dass keine Krise vorhersehbar war, dass jedes neue Problem seine eigene Lösung erforderte; dass jeder Triumph auf Opfern gründete. Und es hatte Triumphe gegeben, selbst inmitten all dieser Tragödien. Die Apogee II war sicher in der Wüste von Arizona gelandet, und Casper Mulholland handelte gerade den ersten Vertrag seiner Firma mit der Air Force aus. Jack war immer noch gesund, obwohl er schon drei Tage an Bord der ISS war – ein Zeichen dafür, dass das Ranavirus sowohl zur Heilung der Chimäreninfektion als auch zur Vorbeugung geeignet war. Und allein die Tatsache, dass Emma noch am Leben war, durfte als Triumph gelten. Wenn auch vielleicht nur vorübergehend. Gordon empfand eine tiefe Traurigkeit, während er ihr EKG auf dem Monitor verfolgte. Wie lange kann das Herz noch weiterschlagen, wenn das Gehirn zerstört ist? Wie lange kann der Körper im Koma überleben? Dieses langsame Dahinsiechen, einer Frau mitzuerleben, die einst so voller Leben gewesen war, das war weit qualvoller, als Zeuge ihres plötzlichen Todes bei einer Katastrophe zu werden. Plötzlich richtete er sich, den Blick starr auf den Monitor gerichtet, kerzengerade auf. »Todd«, sagte er. »Was passiert da mit ihr?« »Was?« »Da stimmt etwas nicht mit ihrem Herz.« Todd hob den Kopf und blickte auf die Anzeige, die über den Bildschirm flimmerte. »Nein«, sagte er und streckte die Hand nach der Sprechtaste aus. »Das ist nicht ihr Herz.« Das schrille Heulen des Monitors schreckte Jack aus seinem Dämmerschlaf. In den Jahren der medizinischen Ausbildung und in den zahllosen Nächten im Bereitschaftsdienst hatte er gelernt, selbst aus dem tiefsten Schlaf sofort hellwach aufzutauchen; und kaum hatte er die Augen geöffnet, wusste er auch schon, wo er war. Er wusste, dass etwas nicht in Ordnung war. Er drehte sich in die Richtung des Geräuschs um und war einen Moment lang verwirrt, weil alles auf dem Kopf stand. Emma schien mit dem Gesicht nach unten an der Decke zu hängen. Eines ihrer drei EKG-Kabel hatte sich gelöst und trieb in der Luft wie ein Büschel Seegras im Wasser. Er vollführte eine Drehung um hundertachtzig Grad, und alles war wieder an seinem Platz. Er schloss das Kabel wieder an. Sein eigenes Herz raste, als er in banger Erwartung den Monitor beobachtete. Zu seiner Erleichterung leuchtete ein normaler Rhythmus auf. Und dann – noch etwas anderes. Die Linie erzitterte. Eine Bewegung. Er blickte auf Emma. Und sah, dass ihre Augen offen waren., »Die ISS antwortet nicht«, sagte der Capcom. »Versuchen Sie es weiter. Wir müssen ihn sofort sprechen!«, gab Todd zurück. Gordon starrte auf die Biotelemetrieanzeige. Er verstand nicht, was er da sah, befürchtete aber das Schlimmste. Das EKG flackerte auf und nieder und wurde dann plötzlich flach. Nein, dachte er. Wir haben sie verloren! »Es ist nur eine Unterbrechung«, sagte Todd. »Das Kabel hat sich gelöst. Vielleicht hat sie Krämpfe.« »Immer noch keine Antwort von der ISS«, sagte der Capcom. »Was zum Teufel geht da oben vor?« »Sehen Sie nur!«, sagte Gordon. Die beiden Männer erstarrten, als plötzlich ein neuer Leuchtpunkt auf dem Bildschirm auftauchte. Es folgte ein Zweiter und kurz darauf ein Dritter. »Surgeon, ich habe die ISS dran«, verkündete der Capcom. »Er verlangt sofort mit Ihnen zu sprechen.« Todd fuhr zusammen und beugte sich vor. »Ground Control, sichern Sie die Verbindung! Ich höre, Jack.« Es war eine private Unterhaltung; Todd allein hörte, was Jack sagte. In der Stille, die plötzlich eingetreten war, waren alle Augen auf die Konsole des Surgeon gerichtet. Selbst Gordon, der direkt neben Todd saß, konnte seinen Gesichtsausdruck nicht deuten. Todd saß vornübergebeugt da und hatte, wie um sich von jeglicher Ablenkung abzuschotten, beide Hände über die Kopfhörer gelegt. Dann sagte er: »Moment mal, Jack. Hier unten sind eine Menge Leute, die darauf warten, das zu hören. Sagen wir’s ihnen.« Todd drehte sich zu Flugdirektor Ellis um und reckte triumphierend den Daumen in die Luft. »Watson ist wach! Sie redet!«, Was dann geschah, würde sich unauslöschlich in Gordon Obies Erinnerung eingraben. Er hörte Stimmen, die zu lautstarken Jubelrufen anschwollen. Er spürte Todds Hand, die ihm kräftig auf den Rücken klopfte. Liz Gianni stieß ein wildes Triumphgeheul aus. Und Woody Ellis ließ sich mit einem Blick, der ungläubiges Staunen und Erleichterung ausdrückte, in seinen Stuhl fallen. Aber woran sich Gordon am deutlichsten erinnern würde, war seine eigene Reaktion. Er sah sich im Raum um und stellte plötzlich fest, dass seine Kehle eng wurde und sein Blick sich trübte. In all den Jahren bei der NASA hatte nie jemand Gordon Obie weinen sehen. Und das sollte verdammt noch mal so bleiben. Sie jubelten immer noch, als er sich von seinem Stuhl erhob und unbemerkt den Raum verließ. Fünf Monate später Panama City, Florida Als die Tür der Überdruckkammer sich endlich öffnete, hallte das Quietschen der Scharniere und das Klirren von Metall in dem riesigen NASA-Hangar wider. Jared Profitt beobachtete, wie zuerst die beiden Marineärzte ausstiegen und, sobald sie draußen waren, tief Luft holten. Sie hatten über einen Monat in dieser klaustrophobischen Enge verbracht und schienen von ihrer plötzlichen Rückkehr in die Freiheit noch etwas benommen. Dann machten sie kehrt, um den beiden anderen Insassen aus der Kammer zu helfen. Emma Watson und Jack McCallum stiegen aus. Beide sahen zu Jared Profitt hin und kamen auf ihn zu. »Willkommen zurück in der Welt, Dr. Watson«, sagte er, indem er die Hand zur Begrüßung ausstreckte. Nach kurzem Zögern schüttelte Emma ihm die Hand. Sie sah viel dünner aus als auf den Fotos. Zerbrechlicher. Vier Monate, Quarantäne im Weltraum, gefolgt von fünf Wochen in der Überdruckkammer, hatten ihren Tribut gefordert. Ihre Muskeln hatten sich zurückgebildet, und die dunklen leuchtenden Augen wirkten riesig in ihrem blassen Gesicht. Das nachwachsende Haar an ihrer Schläfe war, in auffallendem Kontrast zu ihrer braunen Mähne, silbergrau. Profitt sah die beiden Marineärzte an. »Würden Sie uns bitte allein lassen?« Er wartete, bis ihre Schritte verhallt waren. Dann fragte er Emma: »Fühlen Sie sich gut?« »Einigermaßen«, sagte sie. »Angeblich bin ich völlig gesund.« »Soweit sich das feststellen lässt«, verbesserte er sie. Die Unterscheidung war wichtig. Sie hatten zwar nachweisen können, dass das Ranavirus bei Versuchstieren in der Tat die Chimäre vernichtete, doch war die langfristige Prognose für Emma keineswegs sicher. Seit sie mit der Endeavour gelandet war, hatte sie sich wiederholt Bluttests, Röntgenuntersuchungen und Biopsien unterziehen müssen. Und obwohl alle Resultate negativ waren, hatte das USAMRIID darauf bestanden, dass sie während der Tests in der Überdruckkammer blieb. Vor zwei Wochen war der Druck in der Kammer auf den normalen Wert von einer Atmosphäre gesenkt worden. Sie war gesund geblieben. Auch jetzt war sie noch nicht gänzlich frei. Sie würde für den Rest ihres Lebens ein Forschungsobjekt bleiben. Er sah Jack an und las Feindseligkeit in den Augen des Mannes. Jack hatte nichts gesagt, doch er hatte den Arm in einer schützenden Geste um Emmas gelegt, einer Geste, die unmissverständlich sagte: Sie werden sie mir nicht wegnehmen. »Dr. McCallum, es ist Ihnen hoffentlich klar, dass ich alle Entscheidungen, die ich getroffen habe, aus gutem Grund so getroffen habe.« »Ich verstehe Ihre Gründe. Das heißt nicht, dass ich mit Ihren Entscheidungen einverstanden bin.«, »Dann sind wir uns immerhin so weit einig – wir verstehen uns.« Er bot ihm nicht die Hand an, weil er spürte, dass McCallum ihm die seine verweigern würde. Stattdessen sagte er nur:»Draußen warten einige Leute darauf, Sie zu sehen. Ich will Sie nicht länger von Ihren Freunden fern halten.« Er wandte sich zum Gehen. »Warten Sie«, sagte Jack. »Was geschieht jetzt?« »Sie sind frei und können gehen, wohin Sie wollen. Solange Sie regelmäßig zu den Untersuchungen kommen.« »Nein, ich meinte, was geschieht mit den Verantwortlichen? Mit denen, die die Chimäre an Bord gebracht haben?« »Diese Leute werden keine Entscheidungen mehr treffen.« »Das ist alles?« Jacks Stimme hob sich im Zorn. »Keine Bestrafung, keine Konsequenzen?« »Das wird alles in der üblichen Weise abgewickelt. So, wie es bei einer Regierungsbehörde immer gemacht wird, was die NASA letztendlich ist. Eine diskrete Abschiebung auf einen unbedeutenderen Posten. Und dann das Ausscheiden in aller Stille. Es kann keine Untersuchung geben, keine Enthüllungen. Die Chimäre ist zu gefährlich, als dass der Rest der Welt davon erfahren dürfte.« »Aber es sind Menschen zu Tode gekommen.« »Man wird es auf das Marburg-Virus schieben. Versehentlich mit einem infizierten Affen in die ISS eingeschleust. Luther Arnes’ Tod wird man auf eine technische Störung des CRV zurückführen.« »Irgendjemand sollte zur Verantwortung gezogen werden.« »Wofür, für eine Fehlentscheidung?« Profitt schüttelte den Kopf. Er drehte sich um und sah zu der geschlossenen Tür des Hangars, durch die ein Streifen Sonnenlicht fiel. »Hier ist kein Verbrechen zu bestrafen. Das sind Leute, die schlicht und einfach Fehler gemacht haben. Leute, die nicht wirklich, begriffen haben, womit sie es zu tun hatten. Ich weiß, dass das für Sie enttäuschend ist. Ich verstehe, dass Sie unbedingt jemandem die Schuld geben wollen. Aber in diesem Stück gibt es keine richtigen Schurken, Dr. McCallum. Es gibt nur … Helden.« Er wandte sich wieder um und sah Jack in die Augen. Einen Augenblick lang fixierten die beiden Männer einander. Profitt sah kein Anzeichen von Sympathie oder Vertrauen in Jacks Augen. Aber er sah Respekt. »Ihre Freunde warten auf Sie«, sagte Profitt. Jack nickte. Er ging mit Emma zur Tür des Hangars. Als sie über die Schwelle schritten, strömte helles Sonnenlicht in die Halle, und Profitt musste blinzeln, um die Silhouetten der beiden im Türrahmen sehen zu können. Jack hatte Emma den Arm um die Schultern gelegt, ihr Gesicht war ihm zugewandt. Lauter Jubel ertönte, als sie ins Freie traten und ihre Gestalten im blendenden Licht der Mittagssonne verschwanden.,

DIE SEE

, Eine Sternschnuppe zog in hohem Bogen über den Himmel und zersprang in tausend glitzernde Fünkchen. Emma schnappte vor Staunen nach Luft und atmete den Duft des Windes über der Bucht von Galveston ein. Seit sie wieder zu Hause war, kam ihr alles neu und seltsam vor. Dieses ununterbrochene Panorama des Himmels. Das Schaukeln des Decks ihres Segelbootes unter ihrem Rücken. Das Geräusch der Wellen, die gegen den Rumpf der Sanneke klatschten. Sie hatte so lange auf die einfachsten irdischen Erfahrungen verzichten müssen, dass sie schon die Berührung der Brise, die ihr Gesicht streifte, als kostbares Geschenk empfand. Während der monatelangen Quarantäne an Bord der Station hatte sie auf die Erde hinabgestarrt, voller Heimweh nach dem Geruch des Grases, dem Geschmack der salzigen Meeresluft, der Wärme des Bodens unter ihren nackten Füßen. Sie hatte gedacht: Wenn ich wieder zu Hause bin – falls ich je wieder nach Hause komme –, werde ich für immer dort bleiben. Jetzt war sie also hier, und sie genoss die Dinge der Erde mit allen Sinnen. Und doch ging ihr sehnsüchtiger Blick unwillkürlich hoch zu den Sternen. »Wünschst du dir jemals, du könntest wieder fliegen?« Jack hatte so leise gesprochen, dass sich seine Worte fast im Wind verloren. Er lag neben ihr auf dem Deck der Sanneke, hielt ihre Hand und blickte wie sie in den Nachthimmel empor. »Denkst du je: ›Wenn sie mir noch eine Chance geben würden, da raufzufliegen, würde ich zugreifen‹?« »Jeden Tag«, murmelte sie. »Ist das nicht seltsam? Als wir da oben waren, haben wir von nichts anderem geredet als vom Nachhausekommen. Und jetzt sind wir zu Hause und denken nur daran, wie es wäre, wieder zu fliegen.« Sie fuhr sich mit den, Fingern über die Stelle am Kopf, wo die kürzeren Haare als auffallend silberne Strähne nachwuchsen. Sie konnte den vernarbten Wulst noch spüren, wo Jacks Skalpell ihre Kopfhaut und Kopfschwarte durchschnitten hatte. Er war ein bleibendes Andenken an das, was sie an Bord der Station durchlebt hatte. Ein dauerhaftes Zeugnis der schrecklichen Ereignisse, eingemeißelt in ihr Fleisch. Und doch – wenn sie so in den Himmel blickte, empfand sie wieder die alte Sehnsucht nach der Weite des Weltraums. »Ich glaube, ich werde nie aufhören, auf eine neue Chance zu hoffen«, sagte sie. »So wie Seeleute immer wieder aufs Meer zurückkehren wollen. Ganz gleich, wie furchtbar die letzte Fahrt war. Ganz gleich, wie inbrünstig sie den Boden küssen, wenn sie an Land kommen. Nach einer Weile vermissen sie die See, und es zieht sie wieder hinaus.« Aber sie würde nie ins All zurückkehren. Sie war wie ein Matrose, der ans Land gefesselt ist, umgeben vom Meer, das so verlockend nah wie unerreichbar ist. Der Weg war ihr für immer versperrt, und das lag an der Chimäre. Obwohl die Ärzte des JSC und des USAMRIID an ihr keine Anzeichen einer Infektion mehr entdecken konnten, hatten sie keine absolute Gewissheit, dass die Chimäre ausgemerzt war. Sie konnte auch einfach nur ruhen, als scheinbar harmloser Bewohner ihres Körpers unbemerkt weiterleben. Niemand bei der NASA wagte vorherzusagen, was geschehen würde, sollte Emma je wieder an einer Raumfahrt teilnehmen. Also würde sie nie zurückkehren. Sie war jetzt einer dieser Geisterastronauten, immer noch Mitglied des Korps, aber ohne Hoffnung, je wieder zu einem Flugeinsatz zu kommen. Andere strebten jetzt danach, den Traum zu verwirklichen. Schon war ein neues Team an Bord der Station, um die Reparaturarbeiten und die biologische Säuberungsaktion zu vollenden, die sie und Jack begonnen hatten. Im kommenden Monat würden die letzten Ersatzteile für den beschädigten Hauptträger und die, Sonnensegel mit der Columbia ins All transportiert. Die ISS würde nicht sterben. Es hatte zu viele Menschenleben gekostet, diese Raumstation im Orbit zu verwirklichen; sie jetzt aufzu- geben würde bedeuten, all diese Opfer wären umsonst gewesen. Wieder schoss hoch oben eine Sternschnuppe über den Nacht- himmel, trudelte wie ein glimmendes Stück Kohle und verlosch. Die beiden warteten, hofften auf eine weitere. Andere Menschen, die eine Sternschnuppe erblickten, sahen darin vielleicht ein Omen, oder Engel, die vom Himmel herabschwebten, oder sie betrachteten sie als Gelegenheit, einen Wunsch loszuwerden. Emma sah sie als das an, was sie waren: kosmische Trümmer, die ihre unberechenbare Bahn durch die kalte, dunkle Weite des Alls zogen. Dass sie nichts weiter waren als Eis- und Gesteinsklumpen, machte sie nicht weniger staunenswert. Während sie den Kopf in den Nacken legte, um den Himmel abzusuchen, wurde die Sanneke von einem Wellenberg angehoben, und sie hatte das verstörende Gefühl, die Sterne würden auf sie zustürzen, und sie würden durch Raum und Zeit dahinrasen. Sie schloss die Augen. Ohne jede Vorwarnung begann ihr Herz in unerklärlicher Panik zu pochen. Sie spürte, wie ihr der eiskalte Schweiß auf die Stirn trat. Jack berührte ihre zitternde Hand. »Was ist los? Ist dir kalt?« »Nein. Nein, kalt ist mir nicht …« Sie schluckte krampfhaft. »Mir ist gerade ein schrecklicher Gedanke gekommen.« »Was für ein Gedanke?« »Wenn das USAMRIID Recht hat – wenn die Chimäre wirklich in einem Asteroiden auf die Erde gekommen ist –, dann ist das der Beweis, dass es da draußen Leben gibt.« »Ja. Das wäre der Beweis.« »Was, wenn es intelligentes Leben ist?« »Die Chimäre ist zu klein, zu primitiv. Sie besitzt keine Intelligenz.«, »Aber vielleicht diejenigen, die sie geschickt haben«, flüsterte sie. Jack war einen Moment lang vollkommen still. »Kolonisatoren«, sagte er leise. »Wie Samen, die vom Wind davongetragen werden. Wo immer die Chimäre landet, auf jedem Planeten, in jedem Sonnensystem würde sie die einheimischen Arten infizieren. Würde ihre DNS in ihr eigenes Genom aufnehmen. Sie brauchte nicht Millionen von Jahren, um sich an ihre neue Umwelt anzupassen. Sie könnte das gesamte genetische Instrumentarium der bereits existierenden Lebensformen übernehmen, das sie zum Überleben braucht.« Und wenn sie sich einmal eingenistet hat und die dominierende Spezies auf ihrem neuen Planeten geworden ist, was dann? Was war der nächste Schritt? Emma wusste es nicht. Die Antwort lag, so glaubte sie, in den Teilen des Chimären- Genoms, die sie noch nicht identifizieren konnten. In den DNS- Sequenzen, die nach wie vor ein Geheimnis blieben. Ein neuer Meteor zog über den Himmel, mahnte sie daran, dass der Weltraum sich ständig verändert, nie zur Ruhe kommt. Dass die Erde nur einer von vielen einsamen Wanderern in den unermesslichen Weiten des Alls ist. »Wir müssen bereit sein«, sagte sie. »Bevor die nächste Chimäre kommt.« Jack setzte sich auf und sah auf seine Uhr. »Es wird langsam kühl«, sagte er. »Fahren wir nach Hause. Gordon geht in die Luft, wenn wir diese Pressekonferenz morgen versäumen.« »Ich habe noch nie erlebt, dass er die Beherrschung verliert.« »Du kennst ihn auch nicht so gut wie ich.« Jack begann am Fallreep zu ziehen, und das Großsegel stieg auf und flatterte im Wind. »Er ist ein bisschen in dich verliebt, weißt du das?« »Gordie?« Sie lachte. »Das kann ich mir nicht vorstellen.«, »Und weißt du, was ich mir nicht vorstellen kann?«, sagte er leise und zog sie zu sich ins Cockpit. »Dass irgendein Mann sich nicht in dich verlieben würde.« Der Wind frischte plötzlich auf und blähte das Segel, und die Sanneke schoss durch das Wasser der Bucht von Galveston dahin. »Klar zum Wenden«, sagte Jack und steuerte sie durch den Wind, bis der Bug nach Westen zeigte. Nicht die Sterne wiesen ihm den Weg, sondern die Lichter am Ufer. Dort, wo sie zu Hause waren.,

GLOSSAR

Die NASA ist dafür bekannt, dass sie gerne mit Abkürzungen und Akronymen um sich wirft. Ein uneingeweihter Zeuge einer Unterhaltung zwischen NASA-Angestellten kann so schon einmal den Eindruck bekommen, eine Fremdsprache zu hören. Einige der in diesem Buch verwendeten Abkürzungen seien daher im Folgenden kurz erläutert.

APU

Auxiliary Power Unit, Hilfsenergieeinheit

CRV

Crew Return Vehicle, ein Raumgleiter, das »Rettungsboot« der Internationalen Raumstation

ECLSS

Environmental Control and Life Support Systems, Umgebungskontrolle und Lebenserhaltungssysteme

EKV

Exoatmospheric Kill Vehicle, Marschflugkörper zum Abschuss außer Kontrolle geratener Objekte, wie zum Beispiel defekter, Satelliten, in der Erdumlaufbahn

EMU

Extra-Vehicular Mobility Unit, Raumanzug mit Lebens- erhaltungssystem und Steuerdüsen für »Weltraumspaziergänge«

EVA

Extra-Vehicular Activity, Außenbordaktivitäten am Raumschiff; Weltraumspaziergang

ISS

International Space Station, Internationale Raumstation

IVA

Intra-Vehicular Activity, Aktivitäten im Inneren eines Raumfahrzeugs oder Moduls, in dem ein Vakuum herrscht, wozu wie beim Weltraumspaziergang ein Druckanzug mit Lebenserhaltungssystem erforderlich ist

JSC

Johnson Space Center, die NASA-Zentrale in Houston, Texas,

MMACS

Maintenance, Mechanical Arm, and Crew Systems Engineer, der für die Bordtechnik des Shuttle zuständige Ingenieur im Bodenkontrollzentrum

NSTS

National Space Transportation System, das Shuttle-Programm der NASA

ODS

Orbital Docking System, System zur Durchführung von Andockmanövern in der Umlaufbahn

OSO

On-board Systems Officer, der für die Bordtechnik der ISS zuständige Ingenieur im Bodenkontrollzentrum

RCS

Reaction Control System, eines der Antriebssysteme des Space Shuttle, das zum Manövrieren in der Umlaufbahn dient

RLV

Reusable Launch Vehicle, wiederverwendbares Raumfahrzeug,

RSM

Russian Service Module, eines der Elemente der Internationalen Raumstation ISS, gebaut in Russland

RTLS

Return to Launch Site, Abbruch eines Shuttle-Starts durch Rückkehr zum Startplatz

SRB

Solid Rocket Booster, Feststoffraketen, wie sie beim Start des Space Shuttle zum Einsatz kommen

SVO

Special Vehicle Operations, der Kontrollraum für die Internationale Raumstation im Johnson Space Center

TACAN

Tactical Air Navigation, elektronisches Navigationssystem, mit dem die Landung von Flugzeugen oder Raumfähren vom Boden aus gesteuert wird

TAEM

Terminal Area Energy Management, letzte Phase der Shuttle-, Landung, in der die Bodensysteme die Kontrolle übernehmen

TAL

Transatlantic Landing, Landung des Shuttle auf einem Ausweichlandeplatz in Europa oder Afrika

TVIS

Treadmill with Vibration Isolation System, ein speziell für das Fitnesstraining in der Schwerelosigkeit entwickeltes Laufband

USAMRIID

U. S. Army Medical Research Institute of Infectious Diseases, das medizinische Forschungsinstitut der US-Armee für ansteckende Krankheiten WET-F Weightless Environment Training Facility, NASA-Einrichtung, in der die Astronauten sich in Simulationen an die Schwerelosigkeit gewöhnen können,

DANKSAGUNG

Ohne die großzügige Hilfe von NASA-Mitarbeitern hätte ich dieses Buch nicht schreiben können. Mein herzlichster Dank gilt: Ed Campion, dem Leiter der Öffentlichkeitsabteilung der NASA, der mich persönlich auf einem faszinierenden Rundgang durch das Johnson Space Center begleitete. Den Flugdirektoren Mark Kirasich (International Space Station) und Wayne Hale (Shuttle) für Einblicke in ihre schwierigen Aufgaben. Ned Penley für seine Erläuterungen über den Vorgang der Auswahl von Nutzlasten. John Hooper, der mich mit dem neuen Crew Return Vehicle – dem Rettungsboot des Space Shuttle – vertraut machte. Jim Reuter (Marshall Space Flight Center) für seine Erläuterungen der Lebenserhaltungs- und Umweltsysteme der Raumstation. Den Flugärzten Dr. Tom Marshburn und Dr. Smith Johnston für Informationen über Besonderheiten der Notfallmedizin bei Schwerelosigkeit. Jim Ruhnke, der meine bisweilen abwegigen Fragen zur Technik beantwortete. Ted Sasseen, NASA-Mitarbeiter im Ruhestand, der seine Erinnerungen an eine lange Karriere als Raumfahrtingenieur mit mir teilte. Dankbar bin ich auch für die Hilfe, die mir Experten auf einer Reihe von anderen Gebieten gewährt haben: Bob Truax und Bud Meyer, den echten Raketentüftlern von, Truax Engineering, für die Hintergrundinformationen über wiederverwendbare Raumfähren. Steve Waterman für sein Wissen über Dekompressionskammern. Charles D. Sullivan und Jim Burkhart für Informationen über Amphibienviren. Dr. Ross Davis für neurochirurgische Details. Bo Barber, meiner unerschöpflichen Informationsquelle über Flugzeuge und Flugplätze. (Bo, mit dir würde ich jederzeit fliegen!) Schließlich muss ich wieder einmal danken: Emily Bestier, die mich meine Flügel ausbreiten ließ. Don Cleary und Jane Berkey von der Jane Rotrosen Agency, die wissen, was eine großartige Story ausmacht. Meg Ruley, die meine Träume in Erfüllung gehen lässt. Undmeinem Mann Jacob. Das hier ist unser Ding, Schatz.]
15

Similar documents

Pauline Gedge Der fremde Pharao
Pauline Gedge Der fremde Pharao Herrscher der Zwei Länder 01 Inhaltsangabe Seit Ende der zwölften Dynastie, etwa 1800 vor Christus, werden die Ägypter von einer fremden Macht regiert, die sie Setius nennen. Deren Könige sorgen sich we- nig um das Wohl des Landes, plündern seinen Reichtum und vernach
Wenn uns etwas unumstößlich erscheint, so das Fortschreiten der Zeit, die Unum-
Wenn uns etwas unumstößlich erscheint, so das Fortschreiten der Zeit, die Unum- kehrbarkeit von Vergangenheit und Zukunft. Ohne sie gäbe es kein Leben, keine Erfahrung, keine Wirklichkeitserkenntnis. Die Physik zeigt jedoch, daß durch die fundamentalen Naturgesetze für diese Phänomene keine Richtung
HARLIE – ein denkendes Wesen, das dem Denken von
HARLIE – ein denkendes Wesen, das dem Denken von Wissenschaftlern und Technikern entsprang. HARLIE – ein künstlicher Organismus aus tausenden von Kilometern Leitungen und Schaltungen. HARLIE – ein neuartiger Computer, der selbständig denkt und einen eigenen Willen entfaltet, ein ICH. HARLIE – ein Be
Die Autorin Klappentext
Die Autorin Frances Fyfield (eigentlich Hegarty) wurde 1948 in Derbyshire geboren.. Seit 1976 arbeitet sie in London als Anwältin, speziell im Bereich des Straf- rechts. Darüber hinausist sie für die juristische Berichterstattung der Zeit- schrift ›Woman's Realm‹ zuständig. Frances Fyfield hat bishe
Tess Gerritsen Verrat in Paris
Tess Gerritsen Verrat in Paris s&p 05/2006 Ein atemberaubendes Verwirrspiel um eine internationale Spionageaffäre beginnt, als Beryl nach Paris kommt. Sie will Nachforschungen über den mysteriösen Tod ihrer Eltern anstellen, zwei Mitarbeiter des Geheimdienstes, die bei ungeklärten Umständen ums Lebe
BASTEI LÜBBE TASCHENBUCH Band 24 293
BASTEI LÜBBE TASCHENBUCH Band 24 293 1. Auflage: November 2001 Vollständige Taschenbuchausgabe Bastei Lübbe Taschenbücher ist ein Imprint der Verlagsgruppe Lübbe Titel der amerikanischen Originalausgabe: Rocket Ship Galileo © 1947 by Robert A. Heinlein © für die deutschsprachige Ausgabe 2001 by Verl
BASTEI-LÜBBE-TASCHENBUCH Band 21211
BASTEI-LÜBBE-TASCHENBUCH Band 21211 Dieser Roman ist auf deutsch bereits unter folgendem Titel erschienen: ›Weltraummollusken erobern die Erde‹ © Copyright 1951 by Robert Heinlein © Copyright 1951 by World Editions, Inc. All rights reserved Deutsche Lizenzausgabe 1994 Bastei-Verlag Gustav H. Lübbe G
Taschenbücher von ROBERT A. HEINLEIN
Taschenbücher von ROBERT A. HEINLEIN im BASTEI-LÜBBE-Programm: 24001 Sternenkrieger 24118 Das neue Buch Hiob 24124 Die Katze, die durch Wände geht 24163 Die Sternenbestie 24176 Die Tür in den Sommer 21211 Die Marionettenspieler Robert A. Heinlein Farnhams Oase Science Fiction Roman Ins Deutsche über
ERNEST
ERNESTHEMINGWAYro ro roDIEHAUPTSTADTDERWELTSTORYSDrei der großartigsten und eindrucksvollsten Erzäh- lungen vom Meister der Kurzgeschichte – und mit «Schnee auf dem Kilimandscharo» eine Erzählung, die ihm selbst am liebsten war. ERNEST HEMING- WAY, 1899-1961, war Reporter in Kansas City, be- vor er
Clifford C. Russell – Kip nennen ihn seine Eltern und
Clifford C. Russell – Kip nennen ihn seine Eltern und Freunde – hat seinen Schulabschluß bestanden. Seine große Sehnsucht ist es, Ingenieurwissenschaften zu studieren, um eines Tages einen der begehrten Jobs auf der Mondstation zu bekommen. Bei einem Wettbewerb gewinnt er einen ausran- gierten Rauma
Isidor Heller DER GOLEM
IsidorHellerDER GOLEM eBOOK-Bibliothek Isidor Heller DER GOLEM Eine böhmisch-jüdische Sage (1842) eBOOK ebook-bibliothek.org BIBLIOTHEK littera scripta manet Isidor Heller (1816 – 1879) 1. Ausgabe, Juli 2006 © eBOOK-Bibliothek 2006 für diese Ausgabe Textbearbeitung nach: „Sonntags-Blätter für heimat
BASTEI LÜBBE TASCHENBUCH Band 23 214
BASTEI LÜBBE TASCHENBUCH Band 23 214 Erste Auflage: Juli 1999 Sie finden uns im Internet unter http://www.luebbe.de © Copyright 1949 by Robert A. Heinlein renewed 1976 by Robert A. Heinlein All rights reserved Deutsche Lizenzausgabe 1999 by Bastei-Verlag Gustav H. Lübbe GmbH & Co. Bergisch Gladbach
Das Buch Michael Harner ist einer der renommiertesten Experten im Bereich der
Das Buch Michael Harner ist einer der renommiertesten Experten im Bereich der Schamanenforschung und gehört zu den großen schamanischen Praktikern. Vor allem ihm ist es zu verdanken, daß der westlichen Welt der praktische Nutzen dieses uralten Heilsystems nahegebracht wurde. In seinem Grund- lagenbu
Harry Harrison Sternwelt
Harry Harrison Sternwelt Zu den Sternen Band 3 Heyne STERNWELT erschien ursprünglich als HEYNE-BUCH Nr. 06/3912 Titel der amerikanischen Originalausgabe STARWORLD Deutsche Übersetzung: Thomas Schlück Copyright © 1980 by Harry Harrison; mit freundlicher Genehmigung des Autors und seiner Agentur E. J.
Ann Granger IN DUNKLER TIEFE SOLLST DU RUHN ROMAN Inhalt KAPITEL 1
Ann Granger IN DUNKLER TIEFE SOLLST DU RUHN ROMAN Inhalt Tammy Franklin ist erst zwölf Jahre alt, doch sie hat bereits viel zu viel Erfahrungen mit dem Tod gemacht. Vor zwei Jahren starb ihre Mutter nach einer langen Krankheit, und nun wird die Leiche ihrer Stiefmutter in der Nähe eines Eisenbahngle
Der irdische Agent McGavin besitzt alle Eigenschaften, die
Der irdische Agent McGavin besitzt alle Eigenschaften, die einen Helden ausmachen: Kraft, Mut, meisterhafte Körperbe- herrschung, scharfe Intelligenz - und er hat eine »Spezial«- Ausbildung hinter sich. Aber er hat auch einen schwachen Punkt, eine Achillesferse: sein Gewissen ... Als man ihn in eine
MONOGRAPHIEN ZUR PHILOSOPHISCHEN FORSCHUNG Die Wiederholung Analysen zur Grundstruktur menschlicher Existenz im Verständnis Sören Kierkegaards Victor Guarda
MONOGRAPHIEN ZUR PHILOSOPHISCHEN FORSCHUNG Begründet von Georgi Schischkoff Band 194 Die Wiederholung Analysen zur Grundstruktur menschlicher Existenz im Verständnis Sören Kierkegaards Victor Guarda Forum Academicum in der Verlagsgruppe Athenäum • Hain • Scriptor • Hanstein MONOGRAPHIEN ZUR PHILOSOP
Sue Grafton Ausgespielt
Sue Grafton Ausgespielt s&p 06/2006 Kinsey Millhone soll auf eine junge Frau aufpassen, die zwei Jahre im Gefängnis gesessen hat, und ihr dabei helfen, in die Normalität zurückzufinden. Keine allzu schwierige Aufgabe für eine erfahrene Privatdetektivin. Doch Reba Lafferty hat eine düstere Vergangenh
Axel Hacke & Michael Sowa DER WEISSE NEGER WUMBABA
Axel Hacke & Michael Sowa DER WEISSE NEGER WUMBABA Kleines Handbuch des Verhörens Verlag Antje Kunstmann Malcolm, You Sexy Thing: Wie dieses Buch entstand Jedes Buch braucht Leser, wenn es fertig ist. Aber dieses kleine Buch hier benötigte Leser schon, bevor es entstan- den war, ja: Es hätte ohne di
Buch Sergius Golowin verfolgt die Spuren der Katze mit großer
Buch Sergius Golowin verfolgt die Spuren der Katze mit großer Detailkenntnis und viel Humor durch die Kulturgeschichte. Er weiß sachkundig von ihrer Bedeutung im alten Ägypten, bei den Griechen oder in der nordischen Mythologie zu berichten; schildert uns ihren Einfluß auf das Brautwerben im Alpenra
MICHTAIhL eBoAKdUoNrI NF ontane PHILOWSOPaHnIE dDEeRr uTAnT gen durch die Mark Brandenburg
MICHTAIhL eBoAKdUoNrI NF ontane PHILOWSOPaHnIE dDEeRr uTAnT gen durch die Mark Brandenburg Theodor Fontane Wanderungen durch die Mark Brandenburg Inhalt: Erster Teil: Die Grafschaft Ruppin Vorwort Am Ruppiner See Wustrau Karwe Radensleben Neuruppin Die Ruppiner Garnison Regiment Prinz Ferdinand Nr.
Eduard von Keyserling eB B Das Landhaus
Eduard von Keyserling eB B Das Landhaus Eduard von Keyserling Das Landhaus (1913) eBOOK ebook-bibliothek.org BIBLIOTHEK littera scripta manet Eduard von Keyserling (15.05.1855 – 28.09.1918) 1. Ausgabe, Juni 2006 © eBOOK-Bibliothek 2006 für diese Ausgabe © Brad Harrison 2006 für das Titelbild Der Bal
Christian von Kamp LETZTSCHRIFTEN eBOOK-Bibliothek
Christian von Kamp LETZTSCHRIFTEN eBOOK-Bibliothek Christian von Kamp LETZTSCHRIFTEN Roman (2005) eBOOK ebook-bibliothek.org BIBLIOTHEK littera scripta manet Christian von Kamp http://www.christian-von-kamp.de Bitte beachten Sie: Der Text sowie das Titelbild dieses Romans unterliegen dem Copyright.
›Ein düsterer Thriller … Jablokov vermischt die Welt eines Ray-
›Ein düsterer Thriller … Jablokov vermischt die Welt eines Ray- mond Chandlers und Dashiell Hammetts mit dem CYBERPUNK von William Gibson und Bruce Sterling.‹ Starlog Manchmal hat die Erinnerung ein Eigenleben. Früher einmal war er Theo Bronkman, einer der sieben verlore- nen Seelen, die während des
DIE LETZTE GENERATION MÜNCHEN
BRUCE T. HOLMES DIE LETZTE GENERATION Science Fiction Roman Deutsche Erstveröffentlichung WILHELM HEYNE VERLAG MÜNCHEN p0t0si HEYNE SCIENCE FICTION & FANTASY Band 06/4469 Titel der amerikanischen Originalausgabe ANVIL OF THE HEART Deutsche Übersetzung von Andreas Brandhorst Das Umschlagbild schuf Ji
TILL EULENSPIEGEL
TILL EULENSPIEGEL Zwölf seiner Geschichten frei nacherzählt von ERICH KÄSTNER mit elf farbigen Bildern und vielen Zeichnungen von WALTER TRIER VERLAG KURT DESCH MÜNCHEN ALLE RECHTE VORBEHALTEN LIZENZAUSGABE EÜR DEUTSCHLAND: VERLAG KURT DESCH MÜNCHEN MIT GENEHMIGUNG DES ATRIUM VERLAGES ZÜRICH, 1950 S
DAS DOPPELTE LOTTCHEN
ERICH KÄSTNER DAS DOPPELTE LOTTCHEN EIN ROMAN FÜR KINDER ILLUSTRIERT VON WALTER TRIER »Das doppelte Lottchen« gehört wohl zu den schönsten Büchern, die je für Kinder geschrieben worden sind. Erich Kästners Lust zum Fabulieren, sein köstlicher Humor machen alles Schwere leicht und den Kindern verstän
Tami Hoag Sünden der Nacht
Tami Hoag Sünden der Nacht s&p 05/2006 Eiskaltes Entsetzen packt die Bürger einer idyllischen Kleinstadt in Minnesota: Ein unschuldiges Kind aus ihrer Mitte wurde Opfer einer brutalen Entführung. Für die unerfahrene, aber hochtalentierte FBI-Agentin Megan O’Malley beginnt damit ein verzweifelter Wet
DIE GEIER
JOEL HOUSSIN DIE GEIER Science Fiction Roman Deutsche Erstausgabe WILHELM HEYNE VERLAG MÜNCHEN p0t0si HEYNE SCIENCE FICTION & FANTASY Band 06/4462 Titel der französischen Originalausgabe LES VAUTOURS Deutsche Übersetzung von Georges Hausemer Das Umschlagbild schuf Klaus Holitzka Redaktion: Friedel W
Christian von Kamp
Christian von Kamp todsichere Tips für ein mißlingendes Leben eBOOK-Bibliothek Christian von Kamp todsichere Tips für ein mißlingendes Leben (2006) eBOOK ebook-bibliothek.org BIBLIOTHEK littera scripta manet Christian von Kamp http://www.christian-von-kamp.de Bitte beachten Sie: Der Text dieses Ratg